1 Supplementary Materials and methods Biochemical Assays Post-sacrifice, mouse serum was assessed for alkaline phosphatase (ALP), aspartate transaminase (AST) and alanine transaminase (ALT) levels (U/L) by Sydney South West Pathology Service. Quantitative RNA analyses RNA from frozen liver tissue was extracted using TRIzol (Invitrogen), cDNA was generated from DNase I-treated RNA (1μg) using SuperScript III (Invitrogen), and gene expression levels were determined using TaqMan assays (Applied Biosystems, Suppl. Table 1) as per supplier instruction. Cycling conditions included 40 cycles of initial denature (95oC, 10min); denature/extension (95oC, 15s; 60oC, 1min). Data are expressed as either copy of the gene of interest per copy of 18S rRNA (standard curve method), or relative to 18S rRNA levels, as indicated. 2 Supplementary Table 1. TaqMan mouse gene expression assays. Primer/Probe Set 18S Eukaryotic 18S ribosomal RNA Inventoried Assay ID 4352930E Acta2 Actin, alpha 2, smooth muscle, Mm01546133_m1 Bcl2 B cell leukemia/lymphoma 2 Mm00477631_m1 Cdh1 Cadherin 1 (aka E-cad) Mm01247357_m1 Col1a1 Collagen, type I, alpha 1 Mm00801666_g1 Gli1 GLI-Kruppel family member GLI1 Mm00494654_m1 Gli3 GLI-Kruppel family member GLI3 Mm00492333_m1 Hhip Hedgehog interacting protein Mm00469580_m1 Ifng Interferon gamma Mm00801778_m1 Il-6 Interleukin 6 Mm00446191_m1 Ptc1 Patched homolog 1 Mm01306905_m1 Shh Sonic hedgehog Mm00436528_m1 Snai1 Snail homolog 1 (Drosophila) Mm00441533_g1 Tgfb1 Transforming growth factor, beta 1 Mm03024053_m1 Tnf Tumor necrosis factor Mm00443258_m1 Vim Vimentin Mm01333430_m1 Zeb2 Zinc finger E-box binding homeobox 2 Mm00497193_m1 Gene Name Supplementary Table 2. Primers for in situ hybridisation PCR template generation including T7 or T3 RNA polymerase promoter sequences. Target Type Primer Sequence (5’ 3’) mShh Forward; T7 Reverse; T3 Forward; T7 Reverse; T3 TAATACGACTCACTATAGGGAGAGGGTTTGG AAAGAGGCGGCACCC ATTAACCCTCACTAAAGGGAGACACGGAGTT CTCTGCTTTCACAG TAATACGACTCACTATAGGGAGACCCAGCTC GCTCCGCAAACA ATTAACCCTCACTAAAGGGAGAGGTGCGCCA GCGTGGGTTA mShh mGli1 mGli1 Product Size (bp) 489 455 3 Histopathology and immunohistochemistry Mouse 5μm paraffin liver sections were used for H+E, Picrosirius red (PSR) and immunohistochemistry. H+E and PSR staining was carried out by staff from the Histopathology Lab, University of Sydney. Heat-mediated antigen retrieval was performed using Universal Decloaker (Biocare Medical). Endogenous peroxidase activity was blocked with 3% (v/v) hydrogen peroxide in methanol. Primary antibodies to detect α-SMA (ab32575), CK7 (ab90083) and IHH (sc13088) were used. Following HRP-conjugated secondary antibody addition (Dako), signal was detected using DAB. Isotype IgG controls and secondary antibody alone controls returned no specific staining (Suppl. Fig 1B). Immunofluorescence Frozen liver sections (4μm) were fixed in 10% neutral buffered formalin or 1:1 acetone/methanol. Sections were incubated in primary antibody (Suppl. Table 3), prior to addition of an AlexaFluor-conjugated secondary (Invitrogen). Mouse primary antibodies were directly conjugated to CF dyes using Mix-n-StainTM CFTM Dye Antibody Labelling kit (Biotium). Isotype IgG controls were conducted in parallel (Suppl. Fig. 1A,C). 4 Supplementary Table 3. Primary antibodies used for immunofluorescence. Marker Protein Catalogue ID Supplier α-ac-tubulin α-acetylated tubulin T6074 Sigma-Aldrich γ-tubulin γ-tubulin C7604 Sigma-Aldrich CD45 Leukocyte common antigen 550539 BD Pharmingen CK18 M7010 Dako sc-53532 Santa Cruz Z0334 Dako ab7181 ab7195 Abcam Pan-CK Cytokeratin 18 Epithelial cell adhesion molecule Glial fibrillary acidic protein GLI- Kruppel family member GLI2 Pan-cytokeratin Z0622 Dako Pan-Hh Hedgehog ligand (SHH, IHH) sc-1194 Santa Cruz SHH Sonic Hedgehog ab53281 Abcam SMO Smoothened LS-A2668 LifeSpan Vimentin Vimentin MAB2105 R&D EpCAM GFAP GLI2 Western blot Whole liver tissue was homogenised in RIPA buffer containing protease and phosphatase inhibitors (Roche). Protein lysates (10-60μg) were separated by SDS-PAGE and transferred to PVDF. Membranes were incubated in primary antibody overnight (Suppl. Table 4) and detected using ECL HRP substrate. GAPDH demonstrated equal protein loading of whole liver and cell lysates. 5 Supplementary Table 4. Primary antibodies used for Western blot. Marker Protein Catalogue ID Supplier α-SMA α-smooth muscle actin BCL2 B-cell lymphoma 2 CYCLIN D1 Cyclin D1 Epithelial cell adhesion molecule Glyceraldehyde-3-phosphate dehydrogenase GLI-Kruppel family member GLI1 GLI-Kruppel family member GLI3 Hepatocyte nuclear factor 3β ab32575 554218 #2876 #2926 Abcam BD Pharmingen Cell Signalling Cell Signalling ab32392 Abcam AM4300 Ambion sc-20687 Santa Cruz sc-6155 Santa Cruz #3143 Cell Signalling sc-21742 Santa Cruz sc-9024 Santa Cruz PTCH1 Osteopontin Hedgehog ligand (SHH, IHH, DHH) Patched 1 ab5315 Abcam SMO Smoothened ab72130 Abcam V5 V5-tag R960-25 Invitrogen EpCAM GAPDH GLI1 GLI3-R HNF3β OPN Pan-Hh Cell culture Murine liver hepatocyte cell line H2.35 (CRL-1995™) was sourced from CellBank Australia (CRMI, Westmead, Australia) and cultured per distributor’s instructions. The murine LPC line BMOL1.2 and human hepatic stellate cell line LX2 were propagated as previously described[1, 2]. BMOL1.2 media did not include EGF. Where appropriate, cells were selected using blasticidin (5μg/mL) for 7 days. 6 Vector Construction Human GLI1 (hGLI1) and GLI3-repressor (hGLI3R) cDNAs were subcloned into the pDONR221 gateway donor vector (Invitrogen). Recombination into pEF-DEST51 was performed as per manufacturer’s instructions. DNA containing eight concatenated GLI transcriptional response elements (8xGli minimal response promoter) was cloned into the promoterless luciferase reporter pGL4.10[luc2] (Promega, USA). Primary cilia (Pc) quantitation Double immunofluorescent staining to detect Pc (α-acetylated tubulin) and LPC marker EpCAM was performed in frozen mouse liver sections (WT TAA-20wk), as described previously. To quantify the number of Pc+/EpCAM+ vs. Pc/EpCAM+ cells, ten random fields of view (located within the fibrous septa) were counted/section (n=4), using the 100x objective. The number of Pc+/EpCAM+ cells and total number of EpCAM+ cells were recorded per field of view. Statistics All data are expressed as mean + standard error of the mean (S.E.M). A p<0.05 was considered significant. Statistical analyses were performed as described within the text or Figure legend. For Fig. 2A, data were analyzed using Multiple pairwise comparisons, One-way ANOVA, Bonferroni corrected. Significance difference between means (*) are indicated with p<0.0057 for Gli1, p<0.0038 for Gli3, and p<0.0013 for Hhip. Alternatively, a One-sided student t-test was used in analysis of Ptc1, *p<0.05. 7 Supplementary References [1] Tirnitz-Parker JE, Tonkin JN, Knight B, Olynyk JK, Yeoh GC. Isolation, culture and immortalisation of hepatic oval cells from adult mice fed a choline-deficient, ethionine-supplemented diet. Int J Biochem Cell Biol 2007;39:2226-2239. [2] Xu L, Hui AY, Albanis E, Arthur MJ, O'Byrne SM, Blaner WS, et al. Human hepatic stellate cell lines, LX-1 and LX-2: new tools for analysis of hepatic fibrosis. Gut 2005;54:142-151. Supplementary Figure legends Supplementary. Fig. 1. IgG controls for immunofluorescence and immunohistochemistry. (A) As a negative control for immunofluorescence studies, goat IgG (Hh ligand sc-1194), rabbit IgG (GLI2 ab7181) or rat IgG2a (vimentin MAB2105) was substituted at the same final concentration as the primary antibodies listed. 20x objective, TAA-20wks frozen liver tissue. (B) Representative rabbit IgG negative control for immunohistochemistry (IHH, αSMA or cytokeratin 7) using paraffin embedded TAA-20wks liver tissue. 20x objective. (C) IgG controls for TAA 20wk/human ALD confocal microscopy studies, 63x objective. DAPI, blue. No specific staining was observed. GLI2 IgG controls: rabbit IgG/rat IgG controls. 8 Supplementary Fig. 2. Liver histology and collagen deposition in the TAA model. Mouse paraffin liver sections from control 20wks and TAA-treated (4, 8, 20wks) mice were stained for (A) haemotoxylin and eosin (H+E). 20x objective. (B) Picrosirius red (PSR) staining. PSR detects collagen I (red), indicative of the degree of fibrosis. 10x objective. Supplementary Fig. 3. Liver injury markers in the TAA model. Mouse serum or whole liver samples were obtained from control 20wk and TAA-treated (4, 8, 20wk) mice. (A) Quantitation of ALP, ALT and AST enzyme levels (U/L) in mouse serum. Plots represent mean+S.E.M (n = 3-10 mice/group). Asterisk denote significant difference between means (TAA-treated group vs. control 20wk, or between treatment groups as indicated). Multiple pairwise comparisons, One-way ANOVA, Bonferroni corrected, ****p<0.0001. (B) qRTPCR to detect col1-1a, Acta2, Tgfb1, Tnf, Il-6 and Ifng transcripts. Data expressed as copies of the gene of interest per copy of 18S rRNA. Mean+S.E.M (n = 3-6 mice/group). Kruskal-Wallis followed by Dunn’s multiple comparisons test; *p<0.05, **p<0.01 vs. control 20wk. Supplementary Fig. 4. Expansion of hepatic stellate cell and liver progenitor cell populations following TAA treatment. (A) Immunohistochemistry to detect α-SMA (brown), expressed by activated HSCs or immunofluorescence to detect EpCAM (red), expressed by LPCs. 10x objective (top row), 20x objective (bottom row). (B) Immunohistochemistry to detect CK7+ve LPCs, present at the epithelial-mesenchymal interface. 40x objective. 9 Supplementary Fig. 5. Hh ligand protein was not detected in leukocytes or hepatic stellate cells in vivo, although small portal tract cells were Shh+ve. (A) High power view of Shh mRNA detected by ISH, with Shh+ve cells located at the epithelial-mesenchymal interface. Shh+ve hepatocytes (dashed white arrows). Shh+ve small cells (solid white arrows). 40x objective. (B) Double immunofluorescence determined that Hh ligand (SHH, IHH; red) proteins were not expressed by CD45+ve leukocytes (green), or glial fibrillary acidic protein (GFAP+ve)/vimentin+ve activated HSCs/myofibroblasts (green) Confocal microscopy, 63x objective. Supplementary Fig. 6. SHH is expressed by hepatocytes in human alcoholic liver cirrhosis. Immunofluorescence was performed using human ALD tissue to detect SHH and hepatocyte marker CK18. (A) Low power view of SHH (red) throughout the hepatic nodule. (B) High power view demonstrates SHH expression restricted to hepatocytes at the periphery of the nodule, and lack of expression within small cells through the fibrous septa. (C) Vesicular SHH staining within CK18+ve hepatocytes. Confocal microscopy, 63x objective. Supplementary Fig. 7. Co-localisation of GLI2 and Hh ligands within hepatocytes. Double immunofluorescence using frozen TAA-20wks tissue identified what cell populations co-expressed GLI2 and pan-Hh (SHH, IHH). (A) Image obtained at the epithelial-mesenchymal interface. Pan-Hh (red), GLI2 (green). (B) Demonstration of pan-Hh and GLI2 co-localisation within hepatocytes. Confocal microscopy, 63x objective. 10 Supplementary Fig 8. Primary cilia are expressed by EpCAM+ve but not vimentin+ve cells in Ptc+/- TAA-treated mice in vivo. Triple immunofluorescent staining on frozen liver tissue from Ptc+/- TAA-8wk mice identified what cell populations express primary cilia (Pc). (A) Pc (γ-tubulin, red; α-acetylated tubulin, green) structures are expressed by EpCAM+ve (white) LPCs (merged image, right). (B) Pc structures were not evident on vimentin+ (white) HSCs (left and right panels). Confocal microscopy, 63x objective. Supplementary Fig. 9. Quantitation of primary cilia expression by LPCs; Pc were not expressed by vimentin+ve HSCs during chronic liver injury in vivo. (A) Quantification of Pc+/EpCAM+ vs. Pc-/EpCAM+ cells in TAA 20wk liver tissue per field of view, 100x objective. (B) Pc structures (γ-tubulin, red; αacetylated tubulin, green) were not expressed by vimentin+ve (white) HSCs (left and right panels). TAA-20wk liver tissue. Confocal microscopy, 63x objective. Supplementary Fig. 10. EpCAM+ve liver progenitor cells (LPCs) are in close association with activated hepatic stellate cells, and express several LPC markers. Double immunofluorescence to detect (A) EpCAM+ve (green) LPCs in relation to α-SMA+ve activated HSCs. Co-localisation (yellow) of EpCAM (green) with LPC markers (B) CK19 (red), and (C) CD133 (red). 40x objective. 11 Supplementary Fig. 11. Primary cilia expression in liver cell lines. Immunofluorescence was performed to detect what liver cell lines express primary cilia (Pc) (γ-tubulin, red; α-acetylated tubulin, green). (A) Pc were detected on the murine progenitor cell line, BMOL1.2. Scale bars 12 μm (left), 3.9 μm (inset). Pc were not detected on (B) murine hepatocyte cell line, H2.35 or (C) human hepatic stellate cell line, LX2. Supplementary Fig. 12. Quantification of EMT-related genes in Ptc+/- vs. wt TAA-treated mice and correlation with Gli1. (A) qRT-PCR for EMTrelated genes E-cadherin (Cdh1) and vimentin (Vim) mRNA in whole liver. (B) qRT-PCR for EMT-related Hh-target genes Bcl2, Snai1 and Zeb2 mRNA in whole liver. (A, B) Mean+S.E.M., Mann-Whitney U test; *p <0.05, **p <0.01. (C) Significant correlation of Gli1 mRNA (Hh activation) with EMT-related Hh-target genes Bcl2 (Gli1 vs. Bcl2; Spearman r = 0.7053, p = 0.0005), Snai1 (Gli1 vs. Snai1; Spearman r = 0.6264, p = 0.0054) and Zeb2 (Gli1 vs. Zeb2; Spearman r = 0.7213, p = 0.0003) mRNA.
© Copyright 2026 ExpyDoc