DISS. ETH NO. 23258 Improving enzymatic oral therapies via sitespecific polymer conjugation A thesis submitted to attain the degree of DOCTOR OF SCIENCES of ETH ZURICH (Dr. sc. ETH Zurich) presented by JESSICA DAGMAR SCHULZ M. Sc. in Chemistry, ETH Zurich born on 16.08.1987 citizen of Germany accepted on the recommendation of Prof. Dr. Jean-Christophe Leroux Prof. Dr. Laura Nyström 2016 Abstract C ELIAC disease is an autoimmune disorder which is triggered by gluten, a main proteinic constituent of various grains. The disease-specific inflammation of the small intestine is developed upon gluten ingestion by individuals who carry a genetic predisposition (~1% worldwide). Thereby, immunogenic gluten peptides are taken up by the small intestine where they induce a cascade of inflammatory processes that leads to e.g., villus atrophy and intraepithelial lymphocytosis, which in turn increases the risk of developing certain cancers. Classical symptoms consist of abdominal pain, bloating and diarrhea, but patients also often suffer from fatigue, depression and anemia. Unfortunately, pharmaceutical treatments are not available and currently only a gluten-free diet can relieve patients from symptoms and helps avoiding the intestinal damage. Various pharmacological approaches have reached clinical trials among which one promising strategy to tackle celiac disease stands out: the oral application of enzymes that can cleave the gluten peptides in the gastro-intestinal tract. However, the harsh conditions of the oral route can deactivate the enzymes. In order to develop an efficient oral therapy the biomolecules need to be stabilized in vivo. To this end, in this work site-specific polymer conjugation was tested on prolyl endopeptidases (PEPs) known to effectively break-down gluten peptides. Conjugated polymers can stabilize proteins in the gastro-intestinal tract by protecting them from enzymatic degradation and physical denaturation. In addition, when performed in a site-specific manner polymer attachment can enable the enzymes to retain high activity upon modification. Two PEPs derived from Myxococcus xanthus (MX) and Spingomonas capsulate (SC) were engineered to contain cysteine residues that provided the free thiol groups on their surface to which the polymers were conjugated. A library of single, double and triple cysteinemutated PEPs was successfully produced with the aim of covering most of the enzymes’ surfaces upon polymer attachment. While mutagenesis caused activity loss in the SC mutants, all MX mutants preserved full MX wild-type (MX WT) activity and led to the successful generation of two threefold mutated variants (MX3.1 and MX3.2). Covalent site-specific polymer conjugation was subsequently investigated. First, two different sizes of the linear polymer poly(ethylene glycol) (PEG, 5 and 40 kDa) were I conjugated to mutant MXs. The threefold attachment of PEG to MX3.1 and MX3.2 caused different impairments on activity (30% vs. 65% respectively) indicating that the attachment sites are of high importance for activity preservation. Interestingly, no difference in activity was observed when comparing the MX conjugated to three PEG5 or PEG40 chains. Additionally, the polycationic dendrimer poly(amido amine) (PAMAM, 6.9 kDa) was attached to the cysteine-mutated MXs. The triple attachment of PAMAM to MX3.1 led to full MX WT activity indicating that the polymer chains do not interfere with the enzyme’s dynamics at these positions, probably due to the dendrimer’s compact and precise structure. The most active bioconjugates of MX3.1 with highest in vitro stability under simulated intestinal conditions were then tested in vivo. A gluten-specific sequence carrying a quenched dye that turns fluorescent upon peptide cleavage was orally administered to rats. Subsequently, MX or MX–polymer conjugate were applied and the cleavage of the substrate was detected through the rats’ abdomens over time. The MX WT and mutant MX were directly deactivated in the gastro-intestinal tract as no signal was observed. In the case of the conjugate with the three short PEG5 chains some fluorescence was detected but it was statistically not distinguishable from that of the native enzyme. In contrast, the longer PEG40 chain as well as PAMAM triply conjugated to MX3.1 led to significant signals upon oral administration. Importantly, the stabilization effect of the polymers was also maintained when the conjugates were administered to the digestive tract of rats 1 or 2 h before the substrate was applied. The findings presented in this thesis have helped gaining a better understanding of the protection of enzymes by polymers in the gastro-intestinal tract. By attaching the polymers site-specifically, structure-activity relationships could be established. Two of the triply mutated MX3.1 conjugates produced in this project successfully retained their activity in the digestive tract of rats and therefore position themselves as promising candidates for the supportive treatment of celiac disease. Finally, the knowledge stemming from this research is a valuable contribution to the general field of oral therapeutic proteins tract. II Zusammenfassung Z ÖLIAKIE ist eine Autoimmunerkrankung, die durch Gluten, Hauptbestandteil vieler Getreidesorten, ausgelöst werden kann. Die krankheitspezifische Entzündung des Dünndarms kann nach dem Konsum von Glutenprodukten in genetisch prädispositionierten Personen hervorgerufen werden (1% der weltweiten Bevölkerung). Immunogene Peptidfragmente, die durch den teilweisen Verdau von Gluten entstehen, können im Dünndarm von Zöliakieerkrankten aufgenommen werden. Dort induzieren diese eine Reihe von Entzündungsmenchanismen, die z.B. zu Zottenatrophie und intraepithelialer Lymphozytose führen. Klassische Symptome bestehen aus Bauchschmerzen, Blähungen und Diarrhö, wobei Patienten oftmals auch unter anderen Auswirkungen wie z.B. chronischer Müdigkeit, Depressionen und Anämie leiden. Zudem kann die chronische Entzündung zu einem höheren Darmkrebsrisiko führen. Bis heute ist keine medizinische Behandlung möglich und nur eine strikte gluten-freie Ernährung beugt Symptomen und der Entzündung im Dünndarm vor. Einige pharmakologische Ansätze, die der Behandlung von Zöliakie dienen könnten, wurden bereits in klinischen Studien getestet. Eine Möglichkeit der gluten-induzierte Entzündung vorzubeugen, ist die orale Verabreichung von Enzymen, welche die immunogenen Glutenpeptide im Magendarmtrakt verdauen und somit entgiften können. Jedoch werden auch Enzyme im Verdauungstrakt angegriffen, was oftmals zu deren Deaktivierung führt. Um nun eine effektive orale Therapie für Zöliakie entwickeln zu können, werden Methoden benötigt, welche Enzyme im Magendarmtrakt stabilisieren. Aufgrund dessen wurde die Strategie der ortsspezifischen Polymerkupplung auf Prolylendopetidasen (PEP) angewendet, da diese die immunogenen Glutenpeptide effektiv abbauen können. Die Polymere sollen hierbei die Enzyme von deaktivierenden Einflüssen abschirmen (z.B. Gallensäure, pH, Verdauungsenzyme), wobei die Aktivität der Enzyme durch die ortsspezifische Kupplung der Polymere erhalten bleiben soll. Hierfür wurden gezielt Aminosäuren zweier PEPs, isoliert von Myxococcus xanthus (MX) and Spingomonas capsulate (SC), zu Cysteinen mutiert um freie Thiolgruppen für die Polymerkonjugation an die Oberfläche der Enzyme zu platzieren. Eine Reihe von mutierten Enzymen wurde hergestellt und evaluiert, die ein, zwei oder drei Cysteine enthalten, mit dem Ziel letztendlich die gesamte Oberfläche der PEPs abzudecken, sobald III die Polymere gekuppelt sind. Während die Mutagenese erheblichen Aktivitätsverlust der SC Mutanten zur Folge hatte, wiesen alle MX Mutanten volle MX Wildtyp (MX WT) Aktivität auf, was zur erfolgreichen Produktion zweier dreifach cysteinmutierten Varianten führte (MX3.1 und MX3.2). Aufgrund dessen wurde die kovalente ortsspezifische Polymerkonjugation ausschließlich mit den MX Mutanten durchgeführt. Zunächst wurde das lineare poly(ethylene glycol) (PEG, 5 und 40 kDa) in zwei verschiedenen Größen an die MX Mutanten konjugiert. Die dreifache Kupplung von PEG an MX3.1 und MX3.2 zeigte unterschiedliche Auswirkungen auf deren Aktivität (30% bzw. 65% Aktivitätsverlust), womit die große Bedeutung der Kupplungsorte verdeutlich wurde. Interessanterweise gab es keinen Aktivitätsunterschied zwischen der dreifachen Kupplung von PEG5 oder PEG40 an MX. Anschlieβend wurde das polykationische Dendrimer poly(amido amine) (PAMAM, 6.9 kDa) über die Cysteine konjugiert. Dabei behielt MX3.1 auch nach dreifacher Kupplung von PAMAM eine der MX WT entsprechenden Aktivität. Hieraus schließen wir, dass das Dendrimer aufgrund seiner kompakten und präzisen Struktur nicht mit der Dynamik von MX interferiert, wenn es an diesen spezifischen Orten gekuppelt ist. Die besten Konjugate, hinsichtlich in vitro Aktivität und Stabilität in simulierten Darmbedingungen, wurden anschließend in einem in vivo Modell getestet. Hierbei wurde eine gluten-spezifische Peptidsequenz, die zudem einen gequenchten Farbstoff trägt, Ratten oral verabreicht. Anschließend wurde MX oder MX–polymer oral appliziert und sobald das Substrat gespalten wurde, konnte das entstehende fluoreszente Signal zeitabhängig durch die Bauchdecke der Tiere gemessen werden. MX WT und MX3.1 wurden umgehend im Magendarmtrakt deaktiviert, da kein Signal gemessen werden konnte. Obwohl das MXKonjugat, welches drei kurze PEG5 Polymere trägt, ein Signal verursachte, war dies nicht signifikant im Vergleich zu MX WT. Dreifach konjugierte PEG40- und PAMAMKonjugate zeigten ein intensives Signal. Der Grad der Stabilisierung wurde zudem untersucht, indem das PEG40 und PAMAM Konjugat 1 oder 2 h vor dem Substrat Ratten oral appliziert wurden. Die Experimente zeigten, dass beide MX–Polymere auch noch nach einiger Inkubationszeit im Magendarmtrakt hohe katalytische Aktivität aufwiesen. Die Erkenntnisse, die aus den präsentierten Resultaten gezogen werden können, trugen zu einem besseren Verständnis der Stabilisierung von Enzymen durch gekuppelte IV Polymere im Magendarmtrakt bei. Durch die ortsspezifische Kupplung konnten Zusammenhänge zwischen Polymerstruktur und der Aktivität der korrespondierenden Enzymkonjugate aufgestellt und deren Effekt in vivo bestimmt werden. Zwei der dreifach konjugierten MX3.1, welche in diesem Projekt erfolgreich hergestellt wurden, zeigten hohe Aktivität im Verdauungstrakt von Ratten und verkörpern demnach vielversprechende Kandidaten für eine Enzymtherapie gegen Zöliakie. Zudem hat dieses Projekt generell erhebliche Erkenntnisse zu dem Bereich der oralen Enzymtherapien beigetragen. V X Table of Contents Abstract I Zusammenfassung III 1 Background and Objectives 1 2 Improving oral drug bioavailability with polycations? 21 3 Engineering of two prolyl endopeptidases 47 4 Syntheses, in vitro and in vivo characterization of MX bioconjugates 63 5 General Conclusion & Outlook 85 6 Appendix 95 7 References 109 List of Abbreviations 131 Scientific Contributions 135 Acknowledgments 139 Chapter 1 Background and Objectives Chapter 1: Background and Objectives F OOD is an essential source of nutrients and energy but also pleasure, quality of life and more importantly health. Indeed, research has shown that diet has an impact on maintaining health or developing (chronic) diseases (e.g., heart disease, cancer, diabetes, Alzheimer’s disease or nutrient deficiencies).1–4 Thereby, food habits and changes in the nourishment can affect the raising prevalence of specific diseases. Globalization has influenced the diet as the population is nowadays generally able to consume a variety of international food to which it did not have access to a hundred years ago. Moreover, freshly prepared home-made meals are increasingly replaced by a take-away culture and highly processed products with a variety of food additives, high levels of sugar, salt and fat. However, not only convenience food or foreign nutrients that are relatively new in the nourishment are known to affect health; also common staple (e.g., milk or nuts) can trigger diseases such as food intolerance or allergy. These food-triggered diseases cause a variety of symptoms affecting the gastro-intestinal (GI) tract, respiratory tract, skin and blood circulation and are an increasing health issue in especially the Western society.5 Thereby, the cause might ultimately be linked to the change of diet and its impact on the digestive tract.6–8 Indeed, the gut microbiota alters with nourishment and its over- or underdevelopment can cause overreactions upon food intake.9 Additionally, genetic predisposition and lifestyle have an impact on the development of food-triggered diseases, contributing to the increasing number of patients suffering from food allergy or intolerance, which is also partially explained by the elevated awareness on the topic and improved diagnostic tools. To this end, there are a variety of complex reasons why the incidence of food-triggered diseases has increased, highlighting the unmet medical need of pharmaceutical treatments as a challenge to be tackled. Food allergy is defined as an abnormal immune response to food which can cause mild to severe effects. Generally, the immune system fights infections to maintain health but its misregulation can lead to a protective response when specific food content is identified as harmful. Egg, wheat, milk, peanut, tree nut or fish are major examples containing allergens that are known to trigger an immune response in individuals (Table 1.1). Thereby, a variety of symptoms occur e.g., shortness of breath, chest pain, itchy mouth, diarrhea, swelling of lips, tongue, and throat. Interestingly, children may develop tolerance over time, whereas food allergies usually remain a life-long condition in adults.10 Various studies were performed testing the impact of breast feeding, its duration and 1 Chapter 1: Background and Objectives introduction of food on the development of food allergies showing positive effects on their prevention. The World Health Organization has reviewed the scientific data and published a recommendation to exclusively breastfeed infants for six months.11 Moreover, several investigations including clinical studies have been performed in order to induce desensitization, which was performed subcutaneously, sublingually, transdermally and orally.12 Thereby, some success was achieved for egg, milk and peanut allergies. In these cases the amount of food tolerated was effectively increased but major side effects such as anaphylaxis were observed. Thus, due to its questionable safety, food immunotherapy is not yet an established treatment. Therefore, omitting the specific triggers in the diet is to date the only available treatment that effectively avoids symptoms. Table 1.1. The prevalence of food-related diseases (*in Europe or **worldwide). Food related disease Prevalence (%) Celiac Disease 0.4-1.2*13 Non-celiac gluten sensitivity 0.5-13**14 Wheat allergy 3.6*5 Milk allergy 6.0*5 Egg allergy 2.5*5 Peanut allergy 1.3*5 Tree nuts allergy 2.2*5 Fish and shellfish allergy 1.3*5 Lactose intolerance Histamine intolerance 2 (Scandinavia)15 ~60 (Italy)15 1**16 Food intolerance (or sensitivity) results from an enzyme deficiency in the GI tract. The insufficient break-down of food ingredients (e.g., lactose, histamine, sucrose or fructose, Table 1.1) can lead to GI responses, malabsorption, or metabolic problems.15,16 Fortunately, food supplements are available for some cases. These usually consist of the deficient enzyme such as lactase and diamine oxidase to treat lactose and histamine intolerance, respectively.17 Generally, effective strategies to avoid food intolerance 2 Chapter 1: Background and Objectives symptoms can only be developed once the trigger has been identified. When the symptoms are severe or no supplements are available on the market, the only effective treatment is omitting specific ingredients in the diet. It was investigated that genetic and environmental factors as well as drugs that inhibit digestive processes are involved but the mechanism by which some people lack or only partially express specific enzymes in the GI tract is complex and barely understood. Therefore, preventing the development of food intolerance or sensitivity has not been possible yet. Moreover, the intake of the protein mixture gluten, a major constituent of grains (i.e., wheat, barley, rye), can lead to symptoms similar to those obtained from food intolerance. However, because the overreaction to gluten is rather complex and cannot be categorized as food allergy or intolerance, it is defined as celiac disease or non-celiac gluten sensitivity (NCGS). Even though research on the pathogenesis, genetic predisposition, diagnostics and treatments for gluten-triggered abnormalities has developed enormously over the last two decades, various aspects are still to be understood. Celiac disease is a chronic autoimmune disorder mainly characterized by the small intestinal damage triggered by gluten, with a prevalence of ~1% in the western population (Table 1.1).13 Gluten consists of a polymeric (glutenin) and monomeric (gliadin) fraction, the latter being rich in proline and glutamine residues. The human GI system is unable to breakdown such peptides that are usually excreted in the stools without any autoimmune reaction. These peptides are, however, taken up by the lamina propria in genetically predisposed individuals where they induce an inflammatory process. When the peptides pass the epithelium the tissue transglutaminase 2 (tTG2) causes deamidation (transforming glutamine residues to glutamate), leading to negatively charged fragments.18 The peptide fragments, especially when deamidated, have a high binding affinity to the cell surface receptor human leukocyte antigen DQ2 or DQ8 haplotype (HLA-DQ2/8).19 Ninety percent of celiac patients express HLA with DQ2 and the remaining with DQ8.20 Antigen presenting cells present (deamidated) gliadin fragments to CD4+ T lymphocytes. These secrete pro-inflammatory cytokines (e.g., IL-18, TNF-α, IL-21 and IFN-γ), which in turn activate B lymphocytes. Subsequently, antibodies against gliadin and tTG2 are secreted and inflammatory CD8+ T lymphocytes and natural killer cells ultimately induce epithelial cells’ apoptosis. Mononuclear cells in the lamina propria and fibroblasts secrete metalloproteases 3 Chapter 1: Background and Objectives which injure the intestinal wall.21 The consequences of the autoimmune response include intestinal damage, crypt hyperplasia, villus atrophy and intraepithelial lymphocytosis. Therefore, “classical” symptoms of celiac disease constitute of diarrhea, abdominal pain and bloating. In addition, there are several “non-classical” symptoms which do not affect the GI tract including fatigue, infertility, and depression.20 Diagnosis of celiac disease is usually firstly indicated by a self-diagnosed food sensitivity. Thereafter, serological testing for immunoglobulins IgG and IgA is performed. Additional sequence-specific PCR can identify DQ2/8 alleles and duodenal biopsy can confirm the disease and identify the degree of inflammation.22 Even though NCGS was first described in 1976, research studies have focused on the gluten sensitivity intensively since 2010.14 Therefore, the prevalence of NCGS is mainly unknown, but estimated to be 0.63-6% of the population (Table 1.1).23 NCGS is defined as gluten sensitivity with negative celiac serology. Typical symptoms include abdominal pain, bloating, diarrhea, headache and chronic fatigue. The symptoms are usually induced upon gluten challenge and disappear upon gluten withdrawal. Unfortunately, there is no direct diagnosis of NCGS, but only the exclusion of celiac disease. Thereby, the diagnosis consists first of the self-reported food sensitivity, followed by negative celiac disease serology testing and the absence of villous atrophy on duodenal histology (when on a gluten-containing diet).22 Indeed, NCGS patients have normal intestinal permeability and minor histological changes of the GI tract. However, it is not clear yet if genetic background is as important as in celiac disease. Fifty percent of NCGS patients are tested positive for HLA-DQ2/8 alleles, which implies that genetic testing can only exclude celiac disease in half of the cases.24 More studies need to be performed in order to draw a defined line between the definition of celiac disease and NCGS, and also to specify the difference with wheat allergy since a variety of studies on NCGS have been performed with wheat rather than with gluten only. Broader knowledge of the pathogenesis could help developing diagnosis tools for NCGS as well as potential treatments. As described above, the pathogenesis of celiac disease is relatively well-investigated, but the causes for the development of the autoimmune reaction to gluten remain unclear (Table 1.1, Figure 1.1). The genetic predisposition is an important factor, but not all individuals expressing HLA-DQ2/8 (~40%) are sensitive to gluten (~1%), implying that 4 Chapter 1: Background and Objectives other factors are involved. Petersen et al.25,26 found that in the process of presenting gliadin fragments, specific residues in T-cells’ receptors are essential when complexing immunogenic gliadin peptides. Thus, the T-cell repertoire could also be another important genetic factor for the development of celiac disease. Although this finding needs to be further investigated, it might open new avenues to prevent the inflammatory process in the intestine. Moreover, various clinical and statistical studies have been performed to explore the correlation between environmental and geographical factors, the amount of gluten intake and the duration of breast feeding with the development of celiac disease. Indeed, it is broadly discussed if the amount of gluten intake promotes its development. Lionetti et al.27 have studied the correlation of the worldwide distribution of genetically predisposed populations with the amount of gluten intake and the prevalence of celiac disease (Figure 1.1). Interestingly, populations that consume higher amounts of wheat also have a higher frequency of HLA-DQ2 and DQ8 haplotypes. This trend is also observed within a nation. For example, in India the consumption of wheat is higher in the North, where the population also expresses the DQ2 allele to a higher extent (32% compared to 9–13% in the South).27 However, this did not correlate with the disease prevalence. In Europe the HLA DQ2 haplotype frequency as well as wheat consumption is comparable throughout the continent, but the prevalence of celiac disease differs among countries. Therefore, other factors need to be considered in order to fully understand the reasons for developing the disease. Earlier studies suggested that breastfeeding provided a protective effect against the development of celiac disease when gluten was introduced to high-risk infants in a strict time period (between four and six months of age).28,29 However, an international, randomized, placebo-controlled study involving 994 infants on high risk found that the development of celiac disease is not correlated with breastfeeding or its duration, nor with the time of gluten introduction. These findings were further supported by other studies.30– 32 Thus, the full picture of factors leading to the development of celiac disease remains elusive, making the prevention of celiac disease a significant challenge.33 5 Chapter 1: Background and Objectives Figure 1.1. World map of 1) level of wheat consumption in g/person/day, 2) frequency of HLA-DQ2 in %, 3) frequency of HLA-DQ8 in %, and 4) celiac disease prevalence in %. Reproduced from Lionetti et al.27 with permission. 6 Chapter 1: Background and Objectives The gluten-free diet (GFD) is still the only available treatment for celiac patients that prevents symptoms and helps curing the intestinal inflammation. Gluten consumption is generally rather high in the western population (20 g/day) and staying on a safe GFD can be complicated as the level of gluten content declared as safe is low (~10 mg/day) and may differ among countries.34 Moreover, the limitation to gluten-free food decreases the quality of life as recreational activities such as eating in restaurants or going on vacation etc. can be rather difficult.35 The market for gluten-free products is increasing though thanks to the raised awareness and number of diagnosed patients. However, these products are usually expensive compared to regular groceries and may not be affordable for underprivileged populations. Indeed, complying with a GFD can be a major complication in developing countries as the access to gluten-free products is difficult and withdrawal of gluten containing products is often impossible in regions where wheat constitutes a major part of the diet. Thus, the awareness of celiac disease in developing/poor countries needs to be supported with access to affordable gluten-free products. Notwithstanding, for reasons that are yet to be understood not all celiac patients respond successfully to a GFD as symptoms and especially the intestinal inflammation might persist. One possible explanation for the poor response to a GFD could be given by the small intestinal bacteria which are partially overgrown in celiac patients. Based on this principle, the antibiotic rifaximin inhibiting bacterial RNA synthesis was tested in poorly responding celiac patients. The clinical study indicated no difference between the treated and placebo group in terms of symptoms improvement (i.e., abdominal pain, reflux and diarrhea).36 Moreover, it is known that there is an association between exocrine pancreatic insufficiency and celiac disease, a possible explanation for persistent symptoms on a GFD. The benefits of administering Creon®, a pancreatic enzyme replacement therapy, is currently being evaluated in celiac patients on its the efficacy in diminishing the GI symptoms.37 With however general little success, studies seeking to identify the causes for the low response to a GFD are urgently needed in order to find suitable treatments for these severe cases. The strategies explored by investigations seeking suitable pharmaceutical treatments for celiac disease are very diverse.38,39 One approach focuses on the uptake of gliadin peptides in the small intestine which is upregulated in celiac patients. In general, 7 Chapter 1: Background and Objectives macromolecules such as the large gliadin peptide fragments are unable to pass the epithelial layer due to tight junctions that restrict the passage to the lamina propia. However, by interacting with the chemokine receptor CXCR3 gliadin peptides induce the expression and activation of zonulin, a protein that modulates the permeability of tight junctions, leading to enhanced intestinal accessibility (Figure 1.2).40 Therefore, antagonists of zonulin have been proposed as a possible therapy for celiac disease. Larazotide acetate (AT-1001) inhibited the opening of the tight junctions in the intestinal epithelium ex vivo and thus, helped to prevent gliadin-induced permeability.41,42 A phase I clinical trial successfully demonstrated that AT-1001 was well-tolerated and gave indications that it might reduce intestinal permeability.43 However, the follow-up trials failed on longer-term studies (2- and 7-week phase of treatment), showing no effect of AT-1001 on gluten-induced permeability of the intestinal epithelium.44,45 On the contrary, a 12-week phase IIb clinical study found that a daily dose of 0.5 mg of the zonulin antagonist improved symptoms such as abdominal pain, headache and tiredness (Table 1.2).46 The discrepancies of the studies could be related to the number of patients included in each trial, which was rather low in the first studies (86 or 177) compared to 342 in the second. Even though some success was obtained, the overall efficacy of AT-1001 remains unknown demanding further clinical investigations. Besides the paracellular transport of gliadin peptides, the transcellular route can also be involved in the fragment absorption. Indeed, it was found that secretory immunoglobulin A (sIgA) enhances the passage of gliadin peptides across the intestinal epithelium.47,48 The peptides can complex to sIgA which binds to the transferrin receptor CD71 of epithelial cells, leading to transcellular transport (Figure 1.2). Interestingly, it was found that CD71 is over-expressed on the apical side of the epithelium in untreated celiac patients.47 Therefore, the blockage of this transport pathway could constitute another option for treating celiac disease. However, it is not clear to which extent transcellular or paracellular transport of gliadin fragments is involved in celiac disease, demanding further investigations. 8 Chapter 1: Background and Objectives Figure 1.2. Suggested treatment options to prevent gluten-induced effects at the intestinal epithelium. 1) A characteristic feature of untreated celiac disease is compromised epithelial barrier function caused by abnormal expression of epithelial junction proteins, which enables paracellular passage of gluten peptides into the subepithelial compartment. This process, promoted by zonulin, has been proposed as a suitable therapeutic approach for celiac disease. 2) In addition to the paracellular route, intact gliadin peptides can pass through the epithelium transcellularly by a mechanism involving gliadin–sIgA complexes binding to transferrin receptor CD71. Blocking transcellular entry of gliadin peptides into the intestinal mucosa could be the basis of a novel therapeutic strategy in celiac disease. 3) Toxic gliadin peptides induce epithelial and other cells to secrete IL-15, which results in an increase in the number of intraepithelial lymphocytes. These intraepithelial lymphocytes become activated via epithelial MICA–NKG2D interaction, inducing cytotoxic effects on epithelial cells and ultimately increasing epithelial permeability. Blocking IL15-mediated effects has thus been suggested as a therapeutic option for celiac disease. Reproduced from Kaukinen et al.38 with permission. In celiac patients the toxic gliadin fragments induce the expression of the cytokine interleukin IL-15 by epithelial and other cells. IL-15 increases the number of intraepithelial lymphocytes and upregulates the expression of MICA in the epithelium, a cell surface protein serving as a ligand for the NKG2D receptor. NKG2D is a transmembrane protein being expressed by e.g., natural killer (NK) cells. The NKG2D-MICA activates T- and NK cells responses to epithelial cells and thus, mediates enterocyte apoptosis, which in turn leads to villous atrophy in the small intestine (Figure 1.2).49 Therefore, blocking IL-15 offers a potential therapeutic strategy to maintain the epithelial barrier functions. Transgenic mice that overexpress IL-15 in the intestinal epithelium showed extensive 9 Chapter 1: Background and Objectives villous atrophy that was successfully inhibited with an IL-15-blocking antibody directed against CD122.50 Moreover, anti-IL-15 monoclonal antibodies inhibited the overexpression of MICA, neutralized enterocyte apoptosis and downregulated the adaptive immune response in mucosal biopsies of the small intestine from celiac patients.38,51 A phase I clinical trial study is currently recruiting celiac patients to test the safety of a humanized monoclonal antibody, Mik-Beta-1, that blocks IL-15 actions (Table 1.2). This approach could be particularly important for severe cases of celiac disease because it might help diminishing the intestinal damage. However, it would not serve as a preventive therapy for the autoimmune response in the small intestine because other inflammatory cascades are induced in the lamina propia. Table 1.2. Overview of therapeutic approaches for celiac disease and *food supplements that have reached the market. The clinical trials of the green highlighted drug formulations are still ongoing, whereas the studies of the red highilghted potential therapeutics have been completed. Phase I Blockage of IL-15 Mik-Beta-1 Vaccination Nexvax2 Phase II Phase III On the market Anti-gliadin antibody AGY Gluten binder BL-7010 Zolunin antagonist AT-1001 Glutenase ALV003 STAN1 AN PEP Tolerase®G* Parasite therapy Hookworm CCR9 antagonist CCX282-B 10 Chapter 1: Background and Objectives As mentioned above, the gluten peptides get partially deamidated by the enzyme tTG2 once they have passed the intestinal epithelium layer. The negative charge increases their binding affinity towards the HLA-DQ2/8 molecules which triggers the inflammatory cascade. The inhibition of tTG2 is therefore a potential treatment for celiac disease as it could decrease the inflammatory process in the intestinal epithelium (Figure 1.3). A variety of reversible and irreversible tTG2 inhibitors have been developed, mostly unsuccessful though, due to the existence of nine TG homologs that make the inhibition far too unspecific.39 HLA-DQ2/8 molecules have been identified to be the most important genetic factor in celiac patients. Blocking the presenting of gliadin peptides by HLA-DQ2/8 is therefore another potential strategy to prevent the inflammatory process upon gluten intake (Figure 1.3). To this end, peptides which compete against gliadin fragments for their binding to HLA-DQ2/8 have been investigated for their potential anti-inflammatory effects. Despite being a promising concept, all attempts have so far failed due to structural similarities between gliadin peptides and the inhibitor molecules that still caused T-cell activation.52,53 Given that pro-inflammatory cytokines are secreted upon activation of T-cells, the immunoregulatory cytokine IL-10 has been successfully tested for its capacity to suppress T-cell activation ex vivo in organ cultures from celiac patients (Figure 1.3).54 IL-10 was not effective in a clinical pilot study which was, however, performed with celiac patients who poorly respond to a GFD being complex and barely understood cases.55 T-cell activation induces an extensive cytokine response whereas the usage of antibodies against IFN-γ, TNF or tTG2 could thus inhibit the inflammatory process. Although this approach showed success in other autoimmune disorders,56 these potential drug candidates have, however, not been substantially evaluated to treat celiac patients. Moreover, other HLA-associated diseases, e.g., rheumatoid arthritis and multiple sclerosis, showed clinical success in depleting B-cells with anti-CD20 antibodies.57,58 Even though this approach could also be a promising strategy for celiac disease, there has been little success so far.59 Generally, approaches focusing on the inhibition of a specific inflammatory process have not reached clinical relevance for celiac disease yet. This might be also explained by the various inflammatory pathways leading to insufficient suppression of the intestinal inflammation by focusing only 11 Chapter 1: Background and Objectives on one route. Thus, the combination of two or more treatments could lead to more profound success. Figure 1.3. Therapeutic options based on prevention of immunological cascades in the lamina propria . 1) After gaining access to the lamina propria, relevant gliadin peptides are deamidated by tTG2. tTG2 inhibitors have therefore emerged as drug candidates for celiac disease. 2) Gliadin peptides bind to HLA-DQ2 and HLA-DQ8 molecules on antigen presenting cells. HLA-blocking compounds could thus inhibit the presentation of gliadin peptides to T-cells, preventing downstream T-cell activation. 3) T-cell response in the mucosa could be suppressed by exogenous IL-10, anti-CD3-antibodies or by blocking the homing of T-cells into the small intestinal mucosa. 4) Activated T-cells secreting inflammatory cytokines such as IFN-γ and TNF have been suggested as therapeutic targets. 5) Selective B-cell depletion by antiCD20 therapy and blockage of the binding of celiac disease autoantibodies to their target have emerged as future therapeutic strategies. 6) A further means to prevent or treat celiac disease in the future is the induction of tolerance by vaccinations or modifying the inflammatory immune response by hookworm infection. 7) Other therapies include steroid therapy, which are used in refractory celiac disease. Reproduced from Kaukinen et al.38 with permission. 12 Chapter 1: Background and Objectives Another feature observed in celiac patients is the enhanced expression of the human chemokine receptor CCR9 in the duodenum that supports the homing of lymphocyte to the GI mucosa (Figure 1.3). Blocking the intestinal homing with the antagonist of CCR9 (CCX282-B) was therefore evaluated in a clinical trial with celiac patients.60 In a phase II trial study CCX282-B was tested in celiac patients by evaluating its effect on the ratio between villous height and crypt depth upon gluten challenge (Table 1.2). Although the study has been completed in 2008, the results have not been published yet. Interestingly, this approach was also tested for Crohn’s disease. Clinical studies found that CCX282-B was well-tolerated, but the follow-up clinical trial showed that the treatment was not effective in active Crohn’s disease patients.61,62 The hookworm infection has decreased its prevalence in human beings over time which is explained by today’s hygienic life-style. This infection is however thought to be an important player in the immune system due to its function as an “immune trainer”. Indeed, due to the “hygiene hypothesis” it is believed that the increasing prevalence of inflammatory diseases is caused by the diminishment of infections like the hookworm infection and is thus thought to be another therapeutic approach for celiac disease (Figure 1.3). The infection with parasitic helminth was tested for its capacity to suppress the inflammatory immune response in celiac patients. In a first phase IIa clinical trial, immunity and glutensensitivity were tested in celiac patients upon infection with the human hookworm necator.63 Thereby, no therapeutic effect was achieved as mucosal damage, systemic inflammatory immune responses and symptoms were comparable to those of the control group. In another clinical study, celiac patients who were inoculated with Necator Americanus showed a constant height-to-crypt depth ratio upon 1 g of gluten challenge.64 However, the number of volunteers in the study (12) as well as the amount of gluten administered were rather low, demanding further investigations although no upcoming clinical trials have been announced. Besides attempting to prevent specific actions in the celiac pathogenesis, an alternative strategy includes the induction of gluten tolerance through vaccination. The vaccine Nexvax2 was developed based on three immunodominant gluten peptides specific for HLA-DQ2 patients and is delivered intradermally as booster shots (Figure 1.3). Phase I clinical trial proved that the therapeutic is well-tolerated in positive HLA-DQ2 celiac 13 Chapter 1: Background and Objectives patients when weekly injected over two weeks (Table 1.2).65 A phase II clinical study to evaluate its safety, tolerability and pharmacokinetics in celiac patients with HLA-DQ2 predisposition is currently being carried out. One possible alternative to a GFD is the consumption of non-toxic wheat or cereals that are poor in gliadin components (Figure 1.4). Triticum monococcum (TM), also known as einkorn, was tested for its toxicity in comparison to wheat gliadin. While initial ex vivo studies carried out on intestinal biopsy samples from celiac patients showed promising results, a clinical study conducted later on indicated that the short-term challenge with a single-dose of 2.5 g TM was not enough to evaluate its toxicity on intestinal permeability.66,67 A follow-up phase II study assessed the longer term safety of 6 g TM over 60 days on celiac patients following a GFD for one year and found that the dose caused villous atrophy in four out of five volunteers, which indicated that the long-term administration of TM would not be safe for celiac patients.68 Another approach consists of gliadin sequestration in the stomach by the synthetic polymeric binder poly(hydroxyethyl methacrylate-co-styrene sulfonate) (P[HEMA-co-SS], BL-7010) (Figure 1.4).69–71 Once gliadin is bound to the polymer, it is masked from digestive enzymes. Thus, the formation of the immunogenic peptide fragments is decreased and the gliadin-polymer complex is excreted in the feces. Indeed, P[HEMA-co-SS] reduced the secretion of inflammatory cytokines ex vivo in mucosal biopsy specimens from patients with celiac disease.71 Moreover, studies with celiac disease mouse models showed reduced paracellular intestinal permeability and an attenuated systemic immune response to gluten.70 Phase I/II clinical trial evaluated the safety and systemic exposure of single and repeated administration to celiac patients (Table 1.2). Generally BL-7010 was found to be safe and well-tolerated upon multiple administered doses, and the dose of 1 g was selected for further investigations. Now, the formulation will be optimized and tested in well-controlled celiac patients upon gluten challenge. Another oral approach focuses on the administration of anti-gliadin chicken egg yolk IgY antibodies to inhibit the peptide absorption by binding and sequestering gliadin. Caco-2 cell culture studies showed promising results as IgY suppressed pro-inflammatory responses.72 AGY, the IgY antibody product, is currently being tested in celiac patients in a phase I clinical trial. 14 Chapter 1: Background and Objectives Generally, the GI immune system majorly influences the oral tolerance. Thereby, the microbes are responsible for nutrient absorption, barrier function and immune development and are thus key players in maintaining health or developing diseases.73 Thus, the degree of developed intestinal bacteria majorly influences the GI health. Interestingly, when analyzing the microbes of celiac patients, it was found that they present altered microbiota composition, e.g., the level of Bifidobacterium is lower than in the healthy population.74 In vitro and in vivo bifidobacteria reduced toxic effects of gliadin peptides.75,76 Thus, Bifidobacterium infantis was evaluated in active celiac patients in a clinical study and although no positive effects were observed on intestinal permeability or inflammatory abnormalities, patients suffered less from diarrhea.77 Even though probiotics could offer a new strategy to fight celiac disease, the influence of the gut microbiota has not been completely characterized in this autoimmune disease yet (Figure 1.4). A complete celiacspecific intestinal microbiota needs to be identified and its function in the development of the disease established. Only then reasonable probiotic-based alternatives will arise to treat or even prevent the sensitivity to gluten. Figure 1.4. Investigational approaches active in the lumen of the small intestine that could be used for celiac disease treatment. Gluten is highly resistant to degradation by GI enzymes and thus fairly long peptides enter the intestinal lumen. In patients with celiac disease, these peptides trigger deleterious downstream effects. 1) Cereal products from non-toxic cultivars produced by selection, breeding and genetic engineering would lack the harmful gluten peptides that induce the disease. 2) Sourdough fermentation leads to gluten degradation during food processing. The ingestion of foods produced by this technique should be safe for patients with celiac disease. 3) The degradation of harmful gluten peptides into non-toxic fragments can be accomplished after ingestion by probiotics such as bifidobacteria or by oral enzymes. 4) The binding of the polymer P(HEMA-co-SS) to gluten in the GI lumen can prevent the production of harmful gluten peptides and their downstream effects. Reproduced from Kaukinen et al.38 with permission. 15 Chapter 1: Background and Objectives One of the most promising approaches to treat celiac disease is the use of orally applied enzymes. Food supplements are available on the market for various food intolerances such as the intolerance to lactose. Unfortunately, this strategy is more difficult to implement in the case of celiac disease as the problem does not lie on the lack of a natural GI enzyme that can be orally applied. Herein, foreign enzymes need to be identified that can completely detoxify gluten by breaking down the proline and glutamine-rich gliadin peptides and that are safe and stable in the GI tract (Figure 1.4). Prolyl endopeptidase enzymes (PEPs) cleave peptides in a post-proline-specific fashion and have been isolated from a variety of bacteria and fungi, e.g., Mycococcus xanthus, Spingomonas capsulate, Aspergillus niger, Flavobacterium meningosepticum.78–82 Indeed, it was shown that PEPs are able to detoxify gliadin peptides and prevent the induction of a T-cell response in celiac patients.80,81 Moreover, the cysteine endoprotease B (EP-B2) isolated from germinating barley seeds is able to break down the peptides at glutamine residues.83 One advantage of EP-B2 is its high stability at acidic pH, which is important for the enzyme to efficiently break down the peptide fragments in the stomach before they reach the small intestine, as was successfully demonstrated in a rat model.84 The combination of both strategies (proline- and glutaminespecific enzymes) resulted in a mixture of the PEP derived from Sphingomonas capsulate (SC) and the EP-B2 which reached clinical trials as ALV003 (Table 1.2). In a phase I study it was proven that all tested doses of ALV003 were well-tolerated and did not cause any allergic reactions or other symptoms.85,86 Moreover, it was shown that the enzyme mixture were stable in fed stomachs as it cleaved gluten up to 88% in vivo.86 In a phase IIa trial celiac patients were treated daily with 900 mg ALV003 over six weeks which led to attenuate gluten-induced small intestinal mucosal injury upon a daily gluten intake of 2 g.87 To evaluate the effects of different ALV003 doses on the mucosa and symptoms of celiac patients a phase IIb clinical study is currently conducted. Moreover, the detoxification of gluten was evaluated in vitro with a mixture of commercially available proteases (aspergillopepsin from Aspergillus niger and dipeptidyl peptidase IV from Aspergillus oryzae).88 Phases I and II of clinical trials are currently ongoing for this mixture denominated STAN1. Additionally, a prolyl endoprotease derived from Aspergillus niger (AN) has shown high stability and efficacy at slight acidic pH (pH ~4–5) in vitro and in a dynamic in vitro GI model that mimics in vivo digestion.78,89 AN was therefore tested in phase I and II clinical trials with healthy participants to determine safety and efficacy with, however, 12 volunteers 16 Chapter 1: Background and Objectives only.90 Another study in which AN was evaluated in NCGS participants has just been completed but its results have not been published yet. Despite the data supporting its efficacy as a pharmaceutical treatment for NGCS being unpublished, the AN PEP-based enzyme supplement reached the market in the United States in the summer of 2015 under the name Tolerase®G. Thereby, the product needs to be carefully considered since the safety of gluten-intake by celiac patients upon Tolerase®G administration has not been demonstrated. Even though oral enzyme therapy constitutes a promising approach to treat celiac disease and maybe also NCGS, enzymes themselves are prone to get digested in the GI tract. Naturally occurring PEPs are generally rather unstable at the low acidic pH encountered in the stomach and are not resistant to the digestive enzymes found in the GI tract (especially pepsin). Hence, protective strategies are needed in order to deliver functional enzymes with high activity via the oral route. Recently, Wolf et al.91 engineered a naturally occurring acid-active peptidase by computational design in combination with mutagenesis.92 The gliadin endopeptidase Kuma030 was designed to target specifically the dipeptide PQ which is frequently found in the immunogenic gliadin fragments but much less in the sequence of other proteins. This feature is important to minimize potential sidereactions in vivo. The high efficiency of the engineered enzyme was shown by the potent degradation of immunodominant epitopes from wheat, barley and rye (> 99% within minutes). Due to the promising results the authors announced to perform in vivo studies to further analyze its potential as a therapeutic agent for celiac patients. Fuhrmann et al.93 developed an approach in which polymer conjugation to a PEP derived from Myxococcus xanthus (MX) stabilized the enzyme in vivo. Polymers with different character were randomly conjugated to MX via solvent-exposed lysine residues. The negatively charged poly(acrylic acid) (PAA) conjugate did not show stabilization in the GI tract of rats, whereas methoxy poly(ethylene glycol) (mPEG) covalently bound to MX improved the cleavage of a fluorescent immunogenic peptide in vivo. The most promising candidate was, however, the bioconjugate of MX and PG1 (poly-(3,5-bis(3-aminopropoxy)benzyl)-methacrylate), a positively charged dendronized polymer. The comparison of the native enzyme and MX– PG1 showed that the latter remained in the stomach of rats for longer time, indicating an interaction of the conjugate with the negatively charged mucosa. However, this conjugate was approximately four times less active than the native protein in vitro. Despite polymer 17 Chapter 1: Background and Objectives conjugation being a promising strategy with various products on the market (mainly applied to the blood), high loss in activity causes the application of higher amounts of the nonhuman material increasing the probability of side effects. Moreover, a direct comparison of the bioconjugates was not possible in this study due to a number of reasons. Firstly, randomly modified proteins are hard to characterize and reproduce caused by high heterogeneity of the conjugates. Secondly, PG1, PEG and PAA differ in size (59, 4.6, 14 kDa, respectively) and finally, due to random conjugation different numbers of polymer chains were attached to MX (1, 14, 15 polymer chains respectively). Nevertheless, polymer conjugation offers a promising approach to overcome the deactivation of PEPs in the GI tract while the drawbacks of random polymer attachment need to be tackled. Thus, the general aim of this project was to synthesize PEP–polymer conjugates using neutral and positively charged polymers attached in a site-specific manner. The objective included the efficient stabilization of the enzymes in vitro and in vivo while retaining high activity upon conjugation of a low number of well-placed polymer chains. In the first part of this work (Chapter 2), a review on the application of cationic polymers in oral drug delivery systems is presented. Herein, the effect of polycations on GI stability, efficiency and bioavailability of drugs (small molecules, peptides and proteins) is discussed focusing on polymer-drug solutions, nanoparticles and drug-polymer conjugates. In Chapter 3 the engineering of PEPs for which the crystal structures have been identified is presented (Figure 1.5). Thus, PEPs derived from MX and SC were modified by sitespecifically introducing cysteine residues on the surface of the proteins. A library of singly, doubly and threefold mutated MXs and SCs were synthesized, expressed and characterized. The mutants were assessed for their in vitro activity to ensure that the modifications did not cause major deactivation. Chapter 4 presents the site-specific polymer attachment to MX mutants and the evaluation of the best candidates in vivo. Polymers of different characteristics were conjugated to the cysteine mutated MXs to yield well-defined bioconjugates (Figure 1.5). Herein, a structural comparison of the conjugates was performed in terms of polymer length, structure (linear vs. dendrimer) and charge (neutral vs. positively charged). The parameters were evaluated in relation to their impact on enzymatic activity and stability in vitro. Moreover, to compare different strategies of polymer conjugation, random and site-specific polymer attachment were combined with two different kinds of polymers. Thereafter, the most promising MX–polymer conjugates were 18 Chapter 1: Background and Objectives evaluated for their ability to enhance enzymatic stability in the GI tract of rats. Herein, an immunogenic peptide that turns fluorescent upon cleavage by the enzyme/conjugates was monitored in vivo in real-time (Figure 1.5). Finally the work is concluded in Chapter 5 with a general outlook on this topic. Figure 1.5. Objectives of the doctoral thesis: 1) PEPs with identified 3D structures were chosen for mutagenesis experiments. The crystal structure of MX is presented with highlighted residues (red) which were modified to cysteines. Activity of mutants with 1-3 cysteine residues on the surface of the PEPs was evaluated with a model substrate releasing nitro-aniline upon cleavage. 2) Polymers of different character were site-specifically conjugated to the PEPs via the engineered cysteine residues. Additionally, site-specific and random conjugation was combined with two different polymers. The bioconjugates were tested for their activity and stability in vitro. 3) The most promising candidates were then evaluated for their stability in vivo. After their oral administration to rats, the signal of a probe that turns fluorescent upon cleavage was monitored in real-time. 19 Chapter 2 Improving oral drug bioavailability with polycations? This chapter is published in: Schulz, J. D., Gauthier, M. J., and Leroux J.-C. Improving oral drug bioavailability with polycations? Eur. J. Pharm. Biopharm. 2015; 97:427-3. Chapter 2: Improving oral drug bioavailability with polycations? 2.1. Introduction D RUG administration via the oral route is widely used, and is preferred due to its convenience and low associated costs. However, the oral delivery of compounds which are sensitive to degradation, poorly water soluble, or poorly membrane-permeable remains challenging. For example, biomacromolecular drugs such as proteins and polynucleotides can easily undergo denaturation or degradation in the GI tract due to pH fluctuations, and the presence of surfactants (e.g., bile salts) and enzymes.94,95 Furthermore, their high molecular weight and polarity lead to inefficient permeation through mucus and the epithelium. Among the different strategies that have been investigated to address this challenge, formulating drugs with polycations has been shown to increase their solubility, protect labile compounds from pH changes and digestive enzymes, and serve as permeation enhancers. In addition, polycations are particularly interesting for oral drug delivery because of their mucoadhesive properties, which increase the retention time of drugs in the GI tract, and their ability to promote the absorption process by a variety of mechanisms.96,97 Even though polycations can destabilize cell membranes and exhibit toxicity, compared to the parenteral route, the systemic exposure to polycations delivered orally is assumed to be low, and therefore better tolerance is expected.98,99 This contribution will begin by providing an overview of the intrinsic mechanisms by which the most widely investigated polycations (e.g., chitosan, poly(amido amine) (PAMAM), poly(L-lysine)) in pharmaceutical sciences can increase oral bioavailability or induce toxicity when co-administered alongside drugs. Thereafter, aspects of the formulation of drugs with polycations into nano/microparticles and bioconjugates are reviewed, including a presentation of the performance of such systems in vivo. This manuscript will not cover buccal delivery100 as well as the use of polycations in the preparation of tablets,101–103 or polycations complexed with polyanions in layer-by-layer assembling systems.104,105 21 Chapter 2: Improving oral drug bioavailability with polycations? 2.2. Free polycations Because of its simplicity, co-administration of polycations with drugs in solution (Figure 2.1A) is the most convenient and widely investigated manner to affect the oral bioavailability of therapeutic agents. This section introduces several polycations that have been orally co-administered with drugs, and discusses their toxicity and the mechanism by which they increase bioavailability. 2.2.1. Chitosan Chitosan is an attractive polymer for biomedical applications due to its biocompatibility, biodegradability, natural origin, and low cost. It is a linear polysaccharide with a molecular weight up to ca. 2,000 kDa, obtained by partial N-deacetylation of chitin (Figure 2.2A) from crustacean shells or mushrooms.106 Chitosan is composed of 2-amino-2-deoxy-Dglucopyranose and 2-acetamido-2-deoxy-D-glucopyranose units randomly linked together via β-(1,4) glycosidic bonds (Figure 2.2B). Its charge density, which influences properties such as solubility, permeability, and toxicity, is dependent on the degree of deacetylation (DA) because only the 2-amino-2-deoxy-D-glucopyranose units are ionizable.107 Chitosan’s aqueous solubility is limited by its pKa of ~5.5–6.5 to acidic solutions, where the polymer possesses a net positive charge. Although chitosan is generally considered as safe, toxicity has been reported to be strongly dependent on the DA. In vitro, highly deacetylated chitosan (DA 99%) exhibited toxicity towards monolayers of cultured intestinal epithelial cells (Caco-2), induced morphological changes in the form of a decrease in the number of microvilli, and an alteration in the organization of the terminal web.108 Conversely, chitosan with a lower degree of DA (≤ 65%) produced less morphological changes and generated signs of cytotoxicity only at high concentrations. In vivo, rats orally administered a chitosan oligosaccharide (1 kDa) at 2 g/kg/day did not show any significant behavioral changes or altered biochemical marker levels compared to control groups.109 Because of its relative good safety profile, chitosan is the most widely investigated polycation co-administered alongside drugs in oral delivery systems.110,111 Its ability to modulate the permeation through Caco-2 cell monolayers was found to depend on pH, molecular weight, and DA of chitosan. At pH 6.2, the transport of mannitol was significantly increased, whereas no effect was observed at pH 7.4 due polymer insolubility.112,113 Chitosan, with a DA of 65% and high 22 Chapter 2: Improving oral drug bioavailability with polycations? Figure 2.1. Drug–polymer formulations and their advantages. A: Drug formulations prepared with polycations by either simple mixing to obtain a polycation-drug solution, encapsulating the drug in polycationic micro- or nanoparticles, or by synthesizing a covalent drug–conjugate. B: The different formulations should enhance drug stability in the GI tract and shield the drug from the acidic pH, GI enzymes, and bile salts. C: Adequate drug release is required at the targeted site. This is achieved by either releasing the drug from the polymeric particle or by cleavage of the covalent bonds attaching it to the polymer. D: Transport across the intestinal membrane can occur via the paracellular and/or transcelluar pathway through epithelial or M cells. molecular weight (170 kDa), had a large impact (eight-fold increase) on the mannitol passage through Caco-2 cell monolayers. Inversely, lower molecular weight chitosan with a low DA was not able to affect its transport.108 However, Caco-2 cells lack the mucus layer which is an important barrier for drug absorption in vivo. This became evident as permeation of atenolol, a poorly absorbed hydrophilic drug, through Caco-2 cell monolayers increased significantly during chitosan exposure at concentrations five times lower than those used in the in situ rat perfusion model.114 Indeed, when administered as a solution to rats by single pass intestinal perfusions, chitosan only slightly improved the bioavailability of atenolol. Therefore, the influence of mucus on absorption enhancement by chitosan was tested on a mucin-producing cell line (HT29-H). While the permeation of mannitol was enhanced, a smaller effect was observed than for Caco-2 cell monolayers. Using fluorescently-labelled chitosan, it was shown that the mucus prevented the interaction between chitosan and 23 Chapter 2: Improving oral drug bioavailability with polycations? HT29-H cells. The role of the mucus was further revealed by reducing its thickness and showing that the labeled polymer could then achieve closer contact with the cells.114 The mechanism by which chitosan enhances mucosal absorption is multi-faceted and not fully understood. Interaction with the cell membrane is an important factor that can facilitate the absorption of drugs in the GI tract. Indeed, chitosan’s positive charges can interact electrostatically with the negatively charged sialic acid residues on mucin (pKa 2.6).96,97 The spatial distribution of zonula occludens-1 (ZO-1) (tight junction associated protein), occludin (transmembrane protein of the tight junctions), and cytoskeletal F-actin was altered in Caco-2 cell monolayers in the presence of chitosan.112,115,116 Additionally, chitosan reversibly and significantly decreases the transepithelial electric resistance (TEER) of Caco-2 cell monolayers, which is a measure of the tightness of epithelial cell layers.117 These findings are indicators that chitosan widens intercellular junctions, thus affecting paracellular transport (Figure 2.1D). Moreover, the importance of the positive charges was underlined by the fact that the increased transport of mannitol could be inhibited by heparin, a polyanion that complexes chitosan.115 In addition to poor permeability, premature digestion in the GI tract can be an important factor responsible for the low bioavailability of certain drugs, such as peptides. Therefore, polymers that can simultaneously enhance drug permeation and inactivate (or reduce the activity of) luminal digestive enzymes are particularly interesting (Figure 2.1B). Electrostatic interactions between polycations and enzymes present in the GI tract, or the change of local pH due to the buffering capacity of the numerous amino groups, could mitigate the activity of digestive enzymes. Although chitosan in solution was found to not intrinsically inhibit trypsin or carboxypeptidase B, it was superior in enhancing the bioavailability of the peptide buserelin in vivo compared to poly(acrylates), which are known to reduce the activity of luminal enzymes.118,119 Thus, for this rather stable drug, the increase in paracellular transport seems to play a more important role on the oral bioavailability than the inhibition effect on GI enzymes. Conclusively, various factors, especially chitosan’s architectural properties, e.g., DA and molecular weight, significantly influence its ability to enhance drug transport after oral administration when the polycation is co-administered. 24 Chapter 2: Improving oral drug bioavailability with polycations? Figure 2.2. Molecular structure of un-ionized polycations: A: chitin, B: chitosan, C: TMC, D: PAMAMNH2 G2, E: poly(L-lysine), F: poly(L-ornithine), G: poly(L-histidine), H: poly(ethylenimine). DA = degree of deacetylation. 2.2.2. N -trimethyl chitosan (TMC) As previously discussed, one of the challenges associated with the use of chitosan as an absorption enhancer is its low solubility at neutral to basic pH. This can be overcome by methylating its amino groups to produce the quaternary derivative N-trimethyl chitosan (TMC) (Figure 2.2C), which is water soluble over a broad pH range (pH 1–9).120 Trimethylated amino groups remain charged even at higher pH values and thus, the degree of quaternization (DQ) of TMC strongly impacts its characteristics. Lactate dehydrogenase assay of cells exposed to TMC demonstrated destabilization of the cell membrane when the DQ increased. This was confirmed when TMC was administered orally to mice showing that only a low DQ (22%) TMC was non-toxic at a dose of 540 mg/kg.121 Besides toxicity, the DQ is an important parameter for modulating the permeability of intestinal cells. At neutral pH, a rise in the DQ led to a more pronounced effect on TEER and permeability of mannitol through Caco-2 cell monolayers.122 In comparison, a TMC with a DQ of 40% was 2–3 fold less efficient than one with a DQ of 60% in promoting the 25 Chapter 2: Improving oral drug bioavailability with polycations? permeation/absorption of the peptide buserelin, both in vitro and in vivo.123 Moreover, exposure of fluorescently-labeled TMC to Caco-2 cell monolayers showed that the polymer remained localized in the intercellular space suggesting a paracellular pathway (Figure 2.3).113 Importantly, no labeled TMC was observed within the cells, implying the absence of nonspecific cell internalization. Moreover, similarly to chitosan, TMC did not inhibit α-chymotrypsin.117 It was reported that TMC was less effective in reducing TEER and increasing the permeability of various peptide drugs at acidic pH compared to chitosan.117 The positively charged amino groups of TMC are sterically hindered by methyl groups that may lead to a less efficient interaction with the mucin compared to the primary amino groups of chitosan.113 Nevertheless, TMC’s greater solubility at neutral and basic pH offers distinct advantages vs. chitosan leading to a more efficient absorption enhancer. However, as toxicity and permeation enhancement by co-administration of TMC directly correlate with DQ and thus, with the number of positive charges, it is essential to carefully choose a TMC candidate to meet efficacy and safety. Figure 2.3. Optical vertical cross-section (XZ image) through a Caco-2 cell monolayer after 60 min of incubation with fluorescein isothiocyanate-labeled dextran (1 mg/mL) and TMC (0.5%). Top is apical and bottom is basolateral. Arrow indicates paracellular transport. Reproduced from Kotzé et al.113 with permission. 26 Chapter 2: Improving oral drug bioavailability with polycations? 2.2.3. Poly(amido amine) (PAMAM) PAMAMs (Figure 2.2D) were first introduced in 1985, and are a class of water-soluble dendritic macromolecules constructed by the successive grafting of amino acrylate units to a multi-functional initiator core molecule. Each grafting step increases the “generation” number (G) of the dendrimers. Unlike typical synthetic polymers, dendrimers are unimolecular and have a correspondingly well-defined shape and size.124 Due to their specific synthetic route, all PAMAMs possess internal tertiary amino groups (pKa 3–6) and carry variable terminal groups. Particularly interesting are PAMAMs with terminal amino groups (pKa of 8–9) which are positively charged at physiological pH and possess mucoadhesive properties.125,126 Cytotoxicity, permeation, and transport mechanisms have been investigated for PAMAMs and surface-modified PAMAMs using monolayers of Caco-2 cells. The cytotoxicity of dendrimers seems to be directly related to the generation number. Although G0–G2 PAMAM did not show a significant effect on microvilli structure at 1 mM (Figure 2.4A), higher generation PAMAMs induced considerable cell-membrane damage and loss of microvilli above 0.01 mM (Figure 2.4B).127 This is likely caused by the increase in membrane interactions due to a higher number of positively charged amino groups per dendrimer. Indeed, the conjugation of six lauroyl moieties to PAMAM reduced its charge and decreased its cytotoxicity. In vivo, PAMAM generation was also found to impact toxicity. G4 PAMAM was tolerated in mice after oral delivery up to 300 mg/kg, whereas G7 showed toxicity > 30 mg/kg as revealed by changes in behavior, body weight, and biochemical parameters.128,129 The paracellular route is one possible transport pathway for dendrimers to cross the epithelium (Figure 2.1D) given that immunofluorescence studies showed a disruption of the staining pattern of tight junction proteins.130,131 However, dendrimer permeation was temperature-sensitive and was significantly reduced by an endocytosis inhibitor. This indicates that the transport mechanism of dendrimers through Caco-2 cell monolayers is not only via the paracellular pathway but may also involve endocytosis-mediated transepithelial transport by a transcellular route.130 Moreover, TEER was decreased transiently returning to > 95% of the initial values 24 h after exposure to G2 or G3 PAMAM.132 The transport of mannitol was favored, whereas co-administration of the G3 27 Chapter 2: Improving oral drug bioavailability with polycations? dendrimer enhanced the permeability to a greater extent than G2, which may result from the higher number of positive surface charges (64 amino groups, compared to 32 on the G2). Moreover, Lin et al.133 have examined the co-administration of PAMAMs with various hydrophilic molecules in an in situ intestinal rat model. It was found that the intestinal absorption of 5(6)-carboxyfluorescein increased by up to 11-fold in the presence of a 0.5% G2 PAMAM solution.133 The effect depended on the size of the molecule being transported leading to a significant increase with hydrophilic molecules up to 4 kDa. Transport of larger compounds (e.g., insulin, 5.8 kDa) could not be enhanced with PAMAMs. Thus, small PAMAMs in solution can act as a safe absorption enhancer for small to average size hydrophilic compounds. A B C Figure 2.4. Transmission electron microscopic images of Caco-2 cell monolayers after treatment with PAMAM dendrimers (1 mM) for 2 h: A: G2NH2; B: G4NH2; C: control cells. The images display a generation-dependent effect of PAMAM dendrimers on Caco-2 microvilli (magnification = 12,500×). Scale bars = 1 µm. Reproduced from Kitchens et al.127 with permission. 28 Chapter 2: Improving oral drug bioavailability with polycations? 2.2.4. Poly(L-lysine) and other polycations Polycations in solution other than chitosan/TMC and PAMAMs have been significantly less studied in oral drug delivery systems. Among them, poly(L-lysine) (Figure 2.2E), a natural homopolymer with a molecular weight generally ranging from 3 to 220 kDa, is produced by bacterial fermentation or organic synthesis.134 Its amino groups are positively charged at a broad pH range (pKa 9–10) creating a high charge density that is the reported cause of its cytotoxicity.135 The reduction of charge density via cyanate-modification successfully decreased its cytotoxicity up to 25-fold in a non-intestinal fibroblast cell line (L929).135 Furthermore, poly(L-lysine) was shown to affect intestinal epithelial monolayers in a dose- and time-dependent manner. More specifically, high molecular weight poly(Llysine) (300 kDa) had a higher impact on TEER and insulin passage through Caco-2 cell monolayers than a lower molecular weight variant (30 Dka). Stereochemistry did not appear to play a role as no difference was observed by replacing L-lysine by D-lysine.136 Exposure to poly(L-lysine) changed the pattern of cytoskeletal F-actin, and affected the distribution of ZO-1 leading to the hypothesis that it influences the paracellular route (Figure 2.1D). Similarly, other polycations such as poly(L-ornithine), poly(L-histidine), poly(ethyleneimine) (PEI) (Figures 2.2F–H), and protamine also induced a significant increase in transport of hydrophilic compounds through intestinal epithelial monolayers.137,138 Poly(L-histidine) was less effective than the other polycations, likely due to lower charge density resulting from the lower pKa of its imidazole units (pKa 6.5).137,139 Additionally, cytotoxicity studies identified PEI as being seven-fold more toxic than chitosan, whereas protamine exhibited only minimal cytotoxicity.138,140 Another polycation that has been recently investigated for the oral administration of drugs is the cell-penetrating peptide penetratin. When co-administered with insulin to diabetic mice, it significantly reduced glycemia, but the effect remained low compared to that achieved by the parenteral route.141 Stability experiments performed with rat intestinal fluids showed a difference between the two isomers, with D-penetratin being the more stable form. Overall, more detailed toxicity and permeability studies of the polycations need to be performed in GI models in vitro and in vivo in order to fully understand the impact of these co-administered polycations in an oral drug formulation. 29 Chapter 2: Improving oral drug bioavailability with polycations? 2.3. Polycationic micro- and nanoparticles A successful intestinal absorption enhancer needs not only to enhance transport through the intestinal epithelium, but also guarantee that the therapeutic agent remains intact until it reaches this location. Although solutions of polycations co-administered with model drugs have been shown to slightly improve the paracellular and/or transcellular uptake of hydrophilic compounds (Figure 2.1D), little or no stabilizing effects have been observed.114,118,123 Among the different systems that have been explored to stabilize drugs from digestion, nano- and microparticles based on polycationic systems are particularly promising. These can be conveniently prepared by electrostatic complexation with (poly)anionic drugs (Figure 2.2A). A variety of strategies to prepare particle formulations have been developed throughout the years including ionotropic gelation,142–144 condensation,145 emulsion/solvent evaporation,146 coacervation/precipitation,147,148 or chemical crosslinking.146 Incorporation of drugs into nano/microparticles can sterically shield them from enzymes and protect from pH changes by providing a more stable internal chemical microenvironment (Figure 2.1B). Furthermore, such systems also provide the means for enhancing intestinal drug transport via the mechanisms discussed in the previous section, and via microfold cells (M cells) found in the follicle-associated epithelium of the Peyer's patches.149 This section describes the characteristics of particle formulations, the mechanism of permeation, the role of M cell in the uptake process and therapeutic approaches. 2.3.1. Characteristics and mechanism of uptake The characteristics of drug-loaded particles are influenced by several physicochemical parameters. The molecular weight of the polycation can affect particle diameter and the rate of drug release (through particle disassembly) (Figure 2.1C). For instance, a decrease in size of chitosan yielded in smaller particles when proteins or plasmid DNA were complexed.148,150 Correspondingly, high molecular weight chitosan complexed more efficiently polynucleotides and negatively charged peptides/proteins due to larger scale cooperative interactions. However, its lower solubility (vs. shorter chains) led to the formation of larger particles. Additionally, higher polymer concentration led to an increase in size, but also to enhanced loading efficiency.148 With regard to TMC, the DQ significantly 30 Chapter 2: Improving oral drug bioavailability with polycations? influenced particle size, zeta potential, drug loading, and release rate.151 Higher DQ resulted in smaller particles due to increased charged density leading to greater complexation of insulin and a slower drug release rate.151 In contrast to polynucleotides, not all proteins exhibit a net negative charge over a broad pH range and thus, nanoparticle preparation with polycations is not necessarily possible. Helper anions that can complex the polycation are therefore employed to promote the formation of stable particles and can significantly influence their features. For example, polyanion hydroxypropyl methylcellulose phthalate or the smaller tripolyphosphate have been used to complex chitosan, and incorporate insulin.152 Hydroxypropyl methylcellulose phthalate, the macromolecular counter ion, formed larger particles, but led to significantly higher insulin entrapment and protection against degradation in simulated gastric fluids. Furthermore, higher loading efficiency is generally achieved when the size of the entrapped protein decreases.148 Protein size is, however, not the sole factor, as the charge of the incorporated drug dictates the level of interaction with the other components of the particle. Thus, the isoelectric point of the loaded drug has a determinant role as it regulates the drug’s overall charge which depends on the pH of the surroundings. Various strategies have been developed to increase the mucoadhesive properties of polymers. In addition to electrostatic interactions between polycations and mucin, van der Waals forces, hydrogen bonding, and hydrophobic interactions can strengthen mucoadhesion. Microparticles prepared with oleoyl-modified chitosan were slightly more mucoadhesive than chitosan particles on rat intestinal tissue, probably due to the contribution of hydrophobic interactions between the alkyl chains and the hydrophobic components of the mucus glycoprotein.153 Moreover, chitosan nanoparticles modified with up to 15% 3,4-dihydroxy-L-phenylalanine also exhibited improved mucoadhesion to rabbit intestinal mucosa. Although the key component of 3,4-dihydroxy-L-phenylalanine, catechol, has been identified to improve mucoadhesion of polymers, the mechanism remains unknown, though is most likely of non-covalent nature.144 Thiolation has been an additional modification made to polycations to improve their mucoadhesive properties. Thiolation promotes adhesion by formation of disulfide bridges with cysteine-rich mucin glycoproteins.151,154 Cationic thiolated nanoparticles (100–200 nm) prepared with TMC bearing cysteines were shown to improve mucoadhesion by 2–4-fold ex vivo compared to 31 Chapter 2: Improving oral drug bioavailability with polycations? unmodified TMC.151 Furthermore, thiolation enhanced particle stability via formation of intra-particle disulfide bonds, and contributed to increased absorption by inhibiting the intestinal P-glycoprotein (P-gp) and protein tyrosine phosphatase, the latter being involved in the opening and closing of the tight junctions.151,155,156 However, strong interaction with the mucus could inhibit the binding to the cell membrane leading to a decreased cell uptake. Thus, Perera et al.157 reported a strategy where a neutral to slightly negative zeta potential of nanoparticles was used to reduce interactions with the mucus. Once the particles have passed the mucus layer, the zeta potential turned positive by reacting with brush border membrane enzymes (i.e., alkaline phosphatase) leading to a higher uptake by intestinal cells.157 This represents an interesting approach, but follow up studies need to clarify its impact in vivo. In the GI tract, M cells appear to be the cells being most involved in particle transport as they possess high transcytotic activity, a thinner mucus layer, and irregular microvilli (Figure 2.1D).158 Indeed, particles smaller than ~5–10 µm are preferably taken up by M cells and transported into Peyer’s patches where they can degrade and release the encapsulated drug in the lymphoid tissue.159 Immunohistochemistry analysis on ex vivo tissues of mice orally gavaged with ovalbumin-loaded chitosan microparticles showed their ability to transport their content into the Peyer’s patches in vivo, confirming the involvement of M cells in chitosan particle GI absorption.160,147 Although M cells are more prone to internalize cationic particles than epithelial cells, they only represent ~10% of all cells in the intestine (human and mouse). However, the relative contribution of these cells towards total absorption is not available.149 Uptake of cationic nanoparticles by epithelial cells has been reported in a number of in vitro studies, but it is unclear how relevant this phenomenon is in vivo (aside from an immunological perspective), especially in primates.151,161 Using thiolated fluorescently-labeled TMC nanoparticles, it was found that particle absorption occurred both in the Peyer’s patches (M cells) and in the non-follicular mucosa (enterocytes) in rats, although at a slower rate.151 Roy et al.161 demonstrated in gene delivery experiments that chitosan nanoparticles (150–300 nm) transfected mouse intestinal and gastric cells after oral administration. However, the relative contribution towards the internalization of the nanoparticles by the different intestinal cell types was not directly investigated. Indeed, in another study performed in rabbits and where chitosan nanoparticles combined with an endosomolytic peptide were instilled directly in the small 32 Chapter 2: Improving oral drug bioavailability with polycations? intestine or colon, little reporter gene expression was seen.150 Interestingly, some expression in the mesenteric lymph node was observed supporting particle uptake in the Peyer’s patches. Further work is therefore needed to more precisely assess the contribution of both cellular uptake pathways in the trancytosis of nanoparticles. 2.3.2. Nucleic acids The successful oral delivery of nucleic acids requires their safe transport through the stomach/gut, efficient cell uptake, DNA/RNA release, and gene expression within the cell. When the target cell population lies outside the GI tract, then the delivery process becomes very challenging because the particles must permeate intact through the intestinal epithelium in order to reach distal tissues. Unfortunately, there are relatively few studies describing the use of polycations as oral delivery agents for nucleic acid drugs.162 This might be caused by low levels of transgene expression in such systems and the complexity of the challenges that need be overcome. 2.3.2.1. Therapeutic genes and gene vaccines Nucleic acids are increasingly used especially in gene therapy and gene vaccine delivery to treat a variety of diseases. Polycations are particular interesting for the oral delivery of genes as alternatives to traditional viral vectors because they are less immunogenic and can readily complex and condense DNA. Thus, Chen et al.163 have prepared chitosan–DNA nanoparticles (70–150 nm) containing plasmid DNA encoding for murine erythropoietin, a glycoprotein stimulating red blood cell production. The oral delivery of naked erythropoietin to mice did not cause a change in hematocrit, whereas orally-administered nanoparticles produced an 18% increase, indicating enhanced erythropoietin secretion.163 Nevertheless, the intramuscular injection of a viral vector carrying erythropoietin produced long-term and high-level erythropoietin expression, which has yet to be matched by oral delivery (Figure 2.5).164 Furthermore, plasmid DNA–chitosan nanoparticles (300 nm) encoded for factor VIII (FVIII) were orally administered to mice suffering from hemophilia A, a chronic disorder of the blood coagulation cascade caused by defective FVIII.165 Plasmid DNA was detected by real-time polymerase chain reaction in various tissues including the stomach, ileum, Peyer’s patches, liver, and spleen, with no difference between the naked and encapsulated DNA. The authors provided two hypotheses to rationalize 33 Chapter 2: Improving oral drug bioavailability with polycations? these findings. To administer the formulations, they used a gelatin base, which can act as a protective agent and thus, stabilize naked DNA. Furthermore, the assay used to determine the amount of DNA could not distinguish between degraded and intact DNA. However, proof of protection through encapsulation and improved transfection efficacy was demonstrated by higher FVIII protein production and enhanced phenotypic bleeding correction within one month. Unfortunately, the FVIII levels achieved remained very low (1–4%).165 Figure 2.5. Erythropoietin expression after oral delivery and intramuscular injection of DNA. Hematocrit was measured in mice after the oral delivery of erythropoietin encapsulated in chitosan nanoparticles (green bars, n = 9) or after intramuscularly injection of erythropoietin (blue bars, n = 2). Both formulations contained doxycycline (200 µg/mL), an antibiotic that serves as a transcription activator. Oral delivery led to a short term increased hematocrit count that decreased again after day 4, whereas a long-term effect was observed after injection. Mean ± SD .163,164 Plasmid DNA encoding for a peanut allergen was loaded into chitosan nanoparticles and then delivered orally to mice in order to treat peanut allergy.161 The level of tissue expression of bacterial β-galactosidase was higher with nanoparticles compared to naked DNA in both the stomach and small intestine, suggesting protection and increased transfer to the epithelium. Moreover, the encapsulated DNA induced a protective immune response in a peanut allergy mouse model in the form of increased antibody levels (IgA, IgG2a) and less anaphylaxis in response to peanut challenge. Similar results were obtained by Chew et al.166 who orally administered plasmid DNA encoding for native dust mite allergen Der p 34 Chapter 2: Improving oral drug bioavailability with polycations? 1 in chitosan nanoparticles to mice. An immune response was observed, while the intramuscular injection of the DNA alone was ineffective.166 In both studies the oral administration of naked DNA did not induce an immune response. These proof-ofconcept studies provided the impetus for more advanced work including multiple sensitization and kinetic studies. GRA1 DNA vaccination serves as a protective action against the infection with Toxoplasma gondii, which can cause toxoplasmosis, a parasitic disease. Chitosan nanoparticles loaded with GRA1 plasmid DNA and recombinant GRA1 protein were administered by gavage to mice.167 Despite the fact that the nanoparticles produced an immune response, it was not specifically protective against T. gondii. As the reported particles exhibited very high GI stability, the gene might have been inefficiently released. Thus, it would be interesting to gain a better understanding whether mucosal administration of encapsulated GRA1 can cause a specific local immune response by altering the structure of the system to more effectively release the DNA.167 Moreover, Negash et al.168 prepared cationic microparticles with the biodegradable and biocompatible polymer poly-(DL-lactide-co-glycolide)169 in combination with PEI170, and subsequently absorbed plasmid DNA. The DNA vaccine encoded the virus protein 2 targeting the infectious bursal disease virus (IBDV) that causes highly contagious viral infection in young chicken. It could be shown that the desired DNA vaccine was immunogenic and partially protective against viral challenge. 2.3.2.2. Therapeutic siRNA A very attractive therapeutic strategy to overcome inflammatory conditions such as Crohn’s disease in the GI tract is the use of small interfering ribonucleic acid (siRNA) to knockdown pro-inflammatory cytokines.171 However, RNA faces the same challenge as DNA when orally administered. Additionally, complexes prepared with siRNA are generally more prone to dissociate in physiological media than those obtained with plasmid DNA due to the lower molecular weight of siRNA.172,173 Laroui et al.174 succeeded in delivering a siRNA in vivo against tumor necrosis factor α (TNFα), a major proinflammatory cytokine that is produced by macrophages and dendritic cells in inflammatory bowel diseases. The nucleic acid was complexed with PEI or chitosan, loaded into poly(D,L lactide) (PLA) nanoparticles (~400 nm), and the latter sterically stabilized with poly(vinyl alcohol). Particles prepared with PEI afforded greater protection than chitosan against 35 Chapter 2: Improving oral drug bioavailability with polycations? degradation by RNases and allowed higher loading in the nanoparticles. These particles had an overall slightly negative zeta potential. However, during the GI transit, the degradation of the PLA matrix can occur,175,176 and eventually lead to the release of positively-charged PEI/siRNA complexes. After oral administration to mice with lipopolysaccharide-induced inflammation, TNFα concentration was reduced in the colon but not in the liver, demonstrating the restricted delivery of the siRNA to the colonic tissue.174 Based on the same system, CD98 siRNA was complexed with PEI, loaded into PLA nanoparticles (~450 nm), and delivered to mice with dextran sodium sulfate-induced colitis.175 The siRNA was selected to knockdown colonic CD98, which is overexpressed in inflammatory bowel diseases.177 It was shown that siRNA CD98-loaded nanoparticles (~500 nm) decreased colitis and down-regulated CD98 in intestinal macrophages, and more surprisingly in the intestinal epithelial cells. Recently, He et al.173 encapsulated siRNA in thiolated TMC nanoparticles through ionic gelation using sodium tripolyphosphate to mediate TNFα knockdown in macrophages. Longer polymeric chains resulted in higher stability towards RNA degradation tested in mouse serum and simulated GI tract fluids. In a mouse inflammatory model, an optimal balance between stability and ability to release the therapeutic could be achieved with 200 kDa TMC. In a subsequent study, thiolated TMC was complexed with antitumor small hairpin RNA-expression plasmid DNA and siRNA that induce apoptosis and inhibit angiogenesis, respectively.178 The presence of the plasmid DNA permitted the formation of more compact particles (130–160 nm). The nanoparticles were decorated with galactose residues to enhance uptake by hepatoma cells after systemic absorption. In vitro stability tests suggested that the particles would protect the nucleic acids in the GI tract and the bloodstream. After oral gavage to mice bearing subcutaneous hepatic tumors, the nucleic acids encapsulated within both galactose-decorated and non-decorated nanoparticles were deposited in the tumoral tissue and inhibited tumor growth.178 While promising, these data should be viewed with caution as the tumoral levels of DNA reached after oral intake were in the same order of magnitude as those achieved after parenteral administration of sterically stabilized nanovectors, despite the numerous hurdles encountered in the GI tract.179 It would be interesting to examine the generality of this observation in different tumor models. 36 Chapter 2: Improving oral drug bioavailability with polycations? 2.3.3. Proteins, peptides and low molecular weight drugs Apart from polynucleotides, cationic particles have been investigated as a means to deliver proteins, peptide, and small drugs. For example, tetanus toxoid vaccine was developed in 1890 and gave high hope in fighting tetanus, a disease of the nervous system which leads to painful muscle contractions. In the Third World, mass vaccination via oral administration could help prevent new infections. To this end, Harde et al.180 have encapsulated the tetanus toxoid into chitosan nanoparticles by ionic gelation with tripolyphosphate followed by covalent cross-linking using glutaraldehyde. Moreover, glucomannosylation was expected to facilitate particle uptake by antigen presenting cells due to high density of mannose and glucose receptors on their surface. In vivo evaluation after oral delivery to mice showed that naked tetanus toxoid failed due to poor protection in the GI tract and low level of uptake by antigen presenting cells. Inversely, the nanoparticle vaccine led to a protective immune response.180 In vivo challenge should be examined in additional animal species for a broader view of the applicability of the concept. Moreover, oral delivery of chitosan microparticles loaded with diphtheria toxoid increased local (IgA) and systemic (IgE) immune response in mice.181 Even though the systemic immune response was increased by 125-times when encapsulated diphtheria toxoid was administered compared to the negative control (diphtheria toxoid only), the dose–response relationship stated that a four-fold higher dose was needed to obtain an immune response comparable to that achieved after subcutaneous injection. The oral administration of insulin is an intensively studied topic to address the inconvenience of frequent injections in the management of diabetes. The oral delivery of chitosan particles loaded with insulin to diabetic rats led to a significant decrease (9.8-fold) in blood glucose levels compared to insulin dissolved in a chitosan solution.142,143,152 Additionally, the hypoglycemic effect of insulin encapsulated in TMC microparticles following oral intake was improved when the latter was functionalized with cysteine.151 Moreover, PAMAM G2–chitosan conjugates were prepared to encapsulate insulin in polycationic nanoparticles.182 After oral administration to diabetic mice, the bioavailability of insulin encapsulated in the polymer conjugate was found to be ~9% whereas delivered insulin chitosan nanoparticles led to a bioavailability of ~5%. However, despite these promising results which are reminiscent of other in vivo data obtained on rodents with non37 Chapter 2: Improving oral drug bioavailability with polycations? cationic delivery systems,183 the oral bioavailability of insulin remained low, showed high variability throughout the different in vivo studies, and may not be predictive of efficacy in humans.184 Dendrimers, with their highly branched architecture, offer a good platform for encapsulation and has been therefore intensively used to enhance the solubility and bioavailability of drugs. In general, they possess hydrophilic surfaces and hydrophobic cores leading to non-covalent interaction with drugs (e.g., hydrophobic and/or electrostatic interactions).185 Drug complexation with polycationic dendrimers was however seldom investigated, and only a few low molecular weight drugs such as doxorubicin, 7-ethyl-10hydroxy-camptothecin, and ketoprofen have been formulated with PAMAM (G3, G4, and G5, respectively).186–188 In vitro studies conducted with Caco-2 cells showed an enhanced cell uptake,188 but poor stability at acidic pH was obtained, especially regarding encapsulated ketoprofen and 7-ethyl-10-hydroxy-camptothecin, being necessary for the oral delivery of drugs.186,187 It has been previously described that partial shielding of positive charges can lower the cytotoxicity of polycations. Thus, chitosan chemically modified with PEG (5 kDa) has been used to formulate salmon calcitonin (protein used to treat hypocalcemia) in particles.189 PEGylation decreased chitosan’s cytotoxicity by 10–20-fold and increased the stability of the complexed peptide in simulated GI fluids. After oral gavage to rats, it was shown that the hypocalcemic effect was inversely related to the degree of PEGylation (Figure 2.6). This effect might be caused by the partial shielding of the positive charges of chitosan that can reduce the electrostatic interactions with the mucosa. While the PEGylated nanocapsules with 0.5% PEG–chitosan performed better than the control calcitonin solution, their efficacy did not differ from that of the non-PEGylated nanocapsules.189,190 Recently, Ma et al.191 modified PAMAM G5 with PEG (8%, 5 kDa) to improve solubility, transepithelial transport, and the therapeutic effect of probucol, a hydrophobic anti-hyperlipidemic drug. Liposomes which were modified with the PEGylated PAMAM and orally administered to LDLR-/- mice suffering from hypercholesterolemia were found to improve the effect of probucol on lowering the cholesterol and triglyceride plasma levels.191 While these results are potentially interesting, this study did not provide sufficient 38 Chapter 2: Improving oral drug bioavailability with polycations? information of the preparation of the control formulations to adequately assess the benefits of this relatively complex system. Figure 2.6. Hypocalcemic effect after oral administration in rats of calcium calcitonin in aqueous solution, encapsulated in chitosan–PEG 0.5% and 1%. Dose of salmon calcitonin is 500 IU, mean ± SD (n = 6). Reproduced from Prego et al.189 with permission. 39 Chapter 2: Improving oral drug bioavailability with polycations? 2.4. Polycation–drug conjugates Drugs can be covalently bound, rather than electrostatically complexed, to polycations to create a produg (Figure 2.1A). This can be achieved by direct conjugation to the polymer backbone, or via a linker molecule. The desired features of a polymer–drug conjugate often are the same as for the systems described above, namely, protect the drug from degradation, increase the aqueous solubility of hydrophobic drugs, increase bioavailability, possess minimal non-specific toxicity, and potentially provide mechanisms for drug targeting. Additionally, the conjugate can also prolong the residence time of the drug in the GI tract due to its mucoadhesive character and thus, enhance the overall uptake, as for the particulate systems in the previous section. Furthermore, release of the drug can be controlled by incorporating chemically or enzymatically degradable linkages between the drug and polymer (Figure 2.1C).192,193 Dendrimer–drug conjugates composed of PAMAM G3 and 5-aminosalicylic acid, a topical anti-inflammatory drug, have been prepared with azo linkers. Azo bonds are cleaved by azoreductases in the colon, which provokes drug release (or reconversion) specifically at this location. In vitro analysis indicated that the prodrug possessed the required pH and gastric stability leading to a stable prodrug formulation under these conditions. Drug targeting was successful, given that prodrug reconversion under colonic conditions gradually increased over time (23–38%), whereas only small amounts were found in the small intestinal homogenate. Additionally, differences in drug release could be obtained by altering the chemical structure of the linker.192 For instance, naproxen, a poorly water soluble drug, was conjugated to PAMAM G0 via different linkers (amide and ester bonds) leading to different pH, plasma, and liver stabilities.193,194 An amide linkage provided very high chemical and enzymatic stability, leading unsufficient drug release. Inversely, a lactic acid ester linkage was very stable under GI conditions, and showed a slow release of naproxen from the conjugate in human plasma and rat liver homogenate.193,194 It was found that PAMAM increased the permeation of naproxen across Caco-2 cell monolayers, especially when the conjugate further bore a lauroyl chain. Known substrates of P-gp (efflux transporter that reduces the oral absorption of several drugs) such as propranolol and terfenadine have been covalently conjugated to PAMAMs G1 and G3.195,196 The polycationic dendrimer enhanced paracellular and 40 Chapter 2: Improving oral drug bioavailability with polycations? transcellular transport, and the dendrimer was shown to be neither a P-gp inhibitor nor a P-gp substrate.197 The conjugation increased the solubility of the compounds and helped bypass the efflux system in vitro.195,198 In addition, the conjugation of drugs to PAMAM dendrimers might also reduce the latter’s toxicity as it decreases its overall positive charge. This was seen for lauroyl or PEG chain conjugation to PAMAM leading to a partial shielding of its charged character, which is the reported main cause of its toxic effect.197 After drug release, the dendrimer is no longer shielded, but may potentially exhibit lower toxicity because it becomes diluted. One major drawback of several anticancer drugs, such as paclitaxel and docetaxel, is their poor water solubility. Lee et al.199 have conjugated paclitaxel to a low molecular weight chitosan (6 kDa), which significantly increased its aqueous solubility. Moreover, only a low amount of paclitaxel was released under simulated gastric conditions, while most of it was released in rat plasma. The conjugate was tested in a murine melanoma-bearing B16F10 mouse model. It showed a 5-fold higher tumor uptake compared to free paclitaxel injected intravenously. The oral bioavailability of paclitaxel ranged between 20 to 85%, and was found to be independent of P-gp inhibition. An experiment performed with an 125I- radiolabeled polymer indicated substantial absorption of the conjugate. Although it cannot be excluded that part of the measured radioactivity corresponded to released 125I (thyroid levels were not measured in this work), additional data generated with a fluorescentlylabeled conjugate indicated some translocation in the ileum. A similar study was conducted with docetaxel, where the chitosan–drug conjugate exhibited an even higher oral absorption.200 In both cases, the antitumoral efficacy of the orally-administered conjugates was similar to the intravenously injected drugs, despite important differences in the pharmacokinetics and biodistribution profiles. It may be interesting to verify the generality of this phenomenon by repeating these experiments in other animal models. In another study, a low molecular weight chitosan (9 kDa) was conjugated to exendin-4 (4 kDa) (a glucagon-like peptide-1 mimetic for the treatment of type 2 diabetes) with a disulfide bond.201 The prodrug formed nanoparticles (~100 nm) due to electrostatic complexation between the positively charged chitosan and the negatively charged peptide. This led to increased stability towards digestion by trypsin. In vitro testing on INS-1 pancreatic β-cells to evaluate the amount of glucose-induced insulin secretion indicated that the conjugate retained its original biological activity. In vivo studies, conducted with a diabetic mouse 41 Chapter 2: Improving oral drug bioavailability with polycations? model, suggested that conjugation to chitosan resulted in a relative bioavailability of 6.4% vs. the subcutaneous route, and enhanced hypoglycemic efficacy after oral administration compared to the free peptide.201 Unfortunately, it was not possible to evaluate the role of the chemical linkage between the peptide and chitosan in the uptake process as control particles consisting of only the physical complex between the two macromolecules were not analyzed. In another study, similar data were also reported with an insulin–chitosan conjugate.202 Polymer conjugation can also be used to increase the stability of proteins that act in the GI tract.203 For example, Fuhrmann et al.93 recently showed that the binding of a positively charged dendronized polymer PG1 to a prolyl endopeptidase derived from MX prolonged the retention of the enzyme in the stomach and preserved its catalytic activity for several hours (Figure 2.7). Such an enzyme is currently being explored as a means to degrade the immunogenic peptidic sequences of gluten and could therefore be used as a supportive therapy for celiac disease.204 42 Chapter 2: Improving oral drug bioavailability with polycations? Figure 2.7. In vivo activity of MX PEP and MX–PG1 conjugate. A fluorescence-quenched model peptide was orally administered to rats. Cleavage of the peptide by co-administered enzymes (MX) or enzyme–polycation conjugate (MX–PG1) restores fluorescence, should they remain active in the GI tract. Images show the evolution of the fluorescent signal throughout the GI tract. MX is rapidly deactivated and no fluorescence is observed. MX–PG1 remains active in the stomach. A precleaved (and thus fluorescent) peptide serves as positive control in the first column. Reproduced from Fuhrmann et al.93 with permission. 43 Chapter 2: Improving oral drug bioavailability with polycations? 2.5. Concluding remarks There is now sufficient evidence that polycations have the ability to increase the transepithelial passage of drugs and biomacromolecules. The uptake pathways seem to be polymer- and system-dependent (soluble macromolecules vs. nano/microparticles vs. prodrug). Increased bioavailability is mainly achieved by promoting paracellular passage, though some systems may also permit transcytotic transport. Despite the numerous in vivo studies that have reported an increase in oral bioavailability, it still remains unclear to what extent this effect is sufficient to provide the necessary plasmatic drug concentrations for pharmaceutical development. It is our opinion that for class III drugs (high solubility, low permeability) only highly potent and relatively stable compounds having a high therapeutic index or vaccine antigens could benefit from oral delivery using polycations. Regarding nucleic acids, it is reasonable to assume that transfection would be mainly restricted to the cells of the GI tract, which could prove useful in several diseases of the colon. For class II drugs (low solubility, high permeability), polycations may help to improve bioavailability by enhancing solubility, but to maximize bioavailability, the system may need to be designed to release the low molecular weight active compound in the GI lumen before absorption takes place. One aspect that should be investigated in more detail is the impact of prolonged exposure to polycations, especially when the latter are non-digestible/degradable in the GI tract. Indeed, sustained exposure to polycations may expose the organisms to antigenic substances from the GI lumen, which would otherwise not cross the mucosa. Moreover, some polycations may also possess bacteriostatic or bactericidal activity and consequently may alter the gut flora or induce physiological changes. These effects are more delicate to identify but will provide essential information for the successful development of polycation-based drug delivery systems. 44 Chapter 3 Engineering of two prolyl endopeptidases Part of this chapter is published in: Schulz, J. D., Patt, M., Basler S., Kries H., Hilvert, D., Gauthier, M. A., Leroux, J.-C. Adv. Mater. 2015; DOI: 10.1002/adma.201504797. Chapter 3: Engineering of two prolyl endopeptidases 3.1. Introduction P ROTEIN engineering is a broad scientific field that has developed methods to study or modify proteins, in particular to understand protein folding, enzymatic catalytic processes and/or impair proteins’ properties.205 Among the existing approaches, rational design and directed evolution are well-established strategies. Thereby, site-directed or random mutagenesis is performed to engineer proteins, respectively.206 By modifying amino acids it is possible to identify essential residues for the enzymatic function or folding. Thereby, the enzyme’s mechanisms can be established or its activity enhanced by improved substrate cleavage in the binding pocket.207 Additionally, based on known scaffolds, computational design can develop artificial biomolecules like non-natural occurring biocatalysts.92,208,209 Usually this approach is performed in combination with sitedirected mutagenesis to specifically enhance the enzymes’ characteristics due to the often low initial activity of the starting design.207 Besides focusing on engineering proteins’ properties by mutagenesis, point mutations can also introduce reactive groups on the surface of proteins which can be coupled to other molecules. Indeed, the site-specific attachment of polymers to engineered residues of proteins constitutes a very attractive strategy to improve their properties, e.g., prevent aggregation or enhance in vivo stability.210– 212 In order to introduce promising conjugation sites, well-chosen residues of the protein are modified to either natural or unnatural amino acids containing side chains that are prone to react chemically with polymers. Indeed, a variety of techniques have been published to introduce unnatural amino acids to a protein sequence.213 Thereby, one of the most popular techniques to couple polymers via unnatural residues is click chemistry, whereas the side chains often contain alkyne and azide functional groups. In addition, other groups such as aryl halide, redox-active, and photo-reactive groups have been introduced as functionalities.213 Engineering proteins with unnatural amino acids is a promising scientific approach including drug development but has not found yet its way to the market.214,215 On the other hand, modifying residues to natural amino acids is a very common and well-established method. In this case the amino acid that is placed on the protein’s surface should be rather rare and/or naturally located in non-accessible locus of the protein in order to avoid competitive reaction with the polymer. Additionally, the amino 47 Chapter 3: Engineering of two prolyl endopeptidases acid should contain a reactive group for polymer attachment. Cysteine’s thiols are the strongest nucleophilic group upon the side chains of amino acids and the proportion of cysteines in proteins is generally rather low. Cysteines are often essential for protein structures as they can build di-sulfide bridges and are therefore mostly not found on the surface of proteins. Hence, modifying proteins’ residues to cysteine is the most commonly used approach to create conjugation sites for the site-specific attachment of polymers. This strategy offers an interesting approach to stabilize enzymes for therapeutic applications. Bacterial PEPs are enzymes that hydrolyze peptides at proline residues. They have the ability to degrade immunogenic peptides from gluten which are triggers for celiac disease, and have thus been evaluated as an oral adjuvant therapy.216 However, due to the harsh conditions in the GI tract and the lack of information that currently exists regarding the stabilization of orally administered therapeutic enzymes, the potential of PEPs as therapeutic agents for celiac disease has not yet fully unfolded. The site-specific polymer attachment to engineered residues of enzymes that are orally administered has not been tested so far, but offers a promising approach. To this end, detailed knowledge of the protein’s 3D structure is required in order to identify potential modification sites on which to carry out protein engineering. Fortunately, the crystal structures of the two PEPs, MX and SC, have been solved by Shan et al.82 Both enzymes share high similarities in their structure and are characterized by a catalytic domain, whose activity is gated by a second, β-barrel propeller domain (Figure 3.1). Aside from the two linear strands covalently connecting the domains, the specific enzyme structure is kept solely by domain–domain interactions. It is proposed that peptidic substrates induce conformational changes that lead to the opening of the domain interface. Following substrate entry into the binding pocket, the complex is temporarily stabilized by noncovalent interactions between the catalytic domain and the peptide.82 Figure 3.1 shows MX crystallized with a bound inhibitor and SC in an unoccupied form. The engineering of the two PEPs is described in the following chapter. Thereby, residues of the surfaces of the PEPs were modified in order to strategically place free and available thiol groups that would serve as sites for site-specific polymer conjugation. The strategy of PEPs’ engineering and the activity of the expressed mutants is presented and discussed. 48 Chapter 3: Engineering of two prolyl endopeptidases Figure 3.1. 3D structures of the PEPs illustrated with PyMOL. a) MX with the bound inhibitor Z-Alaprolinal shown as sticks in red and b) SC in an unoccupied conformation.82 49 Chapter 3: Engineering of two prolyl endopeptidases 3.2. Materials and Methods All chemicals were purchased at the highest possible analytical grade, and used as received. Site-directed mutagenesis: The gene encoding MX (Zedira, Darmstadt, Germany) and SC (Prozomix, Northumberland, UK) were amplified using the polymerase chain reaction (PCR) with the outer primers T7short and pET-T7up. Primers were purchased from Microsynth AG (Balgach, Switzerland) (Table 3.1). Site-directed mutagenesis was performed by overlap extension to mutate the residues to cysteine. The PCR products of MX were digested with Nde I and Hind III and the products of SC with Nde I and Xho I (20,000 U/mL, Biolabs® Inc., Ipswich, MA) and cloned into digested plasmid pET_28b (Novagen, Schaffhausen, Switzerland). Constructs were confirmed by DNA sequencing (Figures A1–A4), performed by Synergene (Schlieren, Switzerland). Expression and purification of MXs and SCs: Wild-type enzymes and mutants were expressed as recombinant proteins with C-terminal His6 tags in Escherichia coli BL21(DE3).79,217 More specifically, inoculum was grown at 37 °C until the OD600 reached 0.6 and then protein expression induced with isopropyl β-D-1-thiogalactopyranoside (0.1 mM, PanReac AppliChem, Darmstadt, Germany). The culture was incubated overnight at 22 °C for MX and 18 °C for SC, and cell lysis and purification steps were performed at 4 °C. Cell culture suspension was centrifuged at 10,000 × g for 20 min and the cell pellet of MX re-suspended in wash buffer (imidazole (15 mM), sodium phosphate (50 mM), sodium chloride (200 mM), tris(2-carboxyethyl)phosphine (TCEP, 1 mM), pH 8). Bacteria were again pelleted at 10,000 × g for 20 min and re-suspended in wash buffer (3 mL) per gram of pellet. The cell pellet of SC was not washed, but directly re-suspended in 3 mL per gram of pellet in imidazole (5 mM), benzamidine (1.5 mM; Acros, Geel, Belgium), pepstatin A (2 mg/L; Fluka, Buchs, Switzerland), leupeptin (2 mg/L; Sigma, Buchs Switzerland), Tris-HCl (50 mM), sodium chloride (0.2 M), TCEP (1 mM), pH 8.5. Cell lysis was performed by sonication (Sonicator UP200H, Dr. Hielscher GmbH, Teltow, Germany) and the solution clarified by centrifugation (30,000 × g for 45 min). The supernatant was loaded onto a NiNTA resin column (QIAGEN GmbH, Hilden, Germany) and incubated for a minimum of 2 h. 50 Chapter 3: Engineering of two prolyl endopeptidases Table 3.1. DNA sequences of primers used for site-directed mutagenesis. The codon encoding cysteine is highlighted in red. The blue background shows primers used for MX and the red highlighted part primers used for SC mutagenesis experiments. Primer Primer sequence (5’→ 3’) T7short TAATACGACTCACTATAGG pET-T7up CGGTGATGTCGGCGATATAG A25C_for GCAGCCATATGTCCTACCCGTGTACCCGGGCGGAGCAGGTTGTCG A25C_rev CGGGTAGGACATATGGCTGC S123C_for CCTCTACTGGCGCCAGGGGGAGTGTGGGCAGGAGAAGGTGCTGTTGG S123C_rev CTCCCCCTGGCGCCAGTAGAGG A328C_for GGATCCGGCGAAGCCGGCCCGCTGTTCGTGGAAGGAGATTGTCC A328C_rev GCGGGCCGGCTTCGCCGGATCC S338C_for GGAGATTGTCCCCGAGGACTGTTCCGCGTCCCTGCTGTCC S338C_rev GTCCTCGGGGACAATCTCC T417C_for CGTCAAATCTACAAGACGTCCGTCAGCTGTGGGAAGTCTGAGCTCTGGGCCAAGG T417C_rev GCTGACGGACGTCTTGTAGATTTGACG K461C_for CGTGGTGCACCGCAAGGACCTGTGTCGTGACGGCAACGCGCCCACG K461C_rev CAGGTCCTTGCGGTGCACCACG A96C_for CTCAAGCAGTTGCCCGAGCGT TGTGCGCTGGAAAAGCGGATGAAGG A96C_rev ACGCTCGGGCAACTGCTTGAG S351C_for CGTGCGGGTCGATCTGTCGGGCTGTACGCCGCGCTTCGATACC S351C_rev GCCCGACAGATCGACCCGCACG T441C_for GGTGCTGGCGCTCGATCCCGCCTGTGCGAAAACCACCCCGTGG T441C_rev GGCGGGATCGAGCGCCAGCACC A560C_for GCCGCGGGCGAATGGCTGATCTGTAATGGCGTGACGCCGCGCCACG A560C_rev GATCAGCCATTCGCCCGCGGC S643C_for GCTATTCGCCCTATCACAACGTGCGTTGTGGCGTGGACTATCCGGCCATCC S643C_rev ACGCACGTTGTGATAGGGCGAATAGC 51 Chapter 3: Engineering of two prolyl endopeptidases After three washing steps with wash buffer (5 mM imidazole, 50 mM Tris-HCl, 0.2 M sodium chloride, 1 mM TCEP, pH 8.5 for SC), the protein was eluted with 12 mL imidazole (150 mM), sodium phosphate (50 mM), sodium chloride (0.2 M), TCEP (1 mM), pH 8.0 or imidazole (0.2 M), Tris-HCl (50 mM), sodium chloride (0.2 M), TCEP (1 mM), pH 8.5 for MX and SC, respectively. Buffer exchange was performed with sodium phosphate (50 mM), sucrose (3%), TCEP (1 mM), pH 7.5 for MX and sodium phosphate (50 mM), sodium chloride (0.3 M), TCEP (1 mM) pH 8.0 for SC by ultrafiltration (Amicon 30 kDa MWCO, Schaffhausen, Switzerland). The quality of protein expression was determined by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE, 10%) (Figures 3.2, 3.3). Protein concentration was measured by spectrophotometry (NanoPhotometer® Pearl, IMPLEN, Munich, Germany) using its predicted extinction coefficients at 280 nm. In vitro activity: Enzymes were generally stored at 4 °C and used for activity assessment from the third day onwards after protein expression. MX or MX–polymer conjugates (0.5 µg/mL) were incubated at 37 °C with (benzyloxycarbonyl)-glycine-proline-pnitroaniline (2.5 µM, Bachem, Rorrance, CA) in sodium phosphate buffer (50 mM, pH 7.0). Enzyme activity was calculated from the slope of the absorbance change at 410 nm due to the release of nitroaniline, which was monitored for 5 min. The activity (slope) observed with the commercially available MX WT was set to 100%. Statistical analysis: The data were analyzed by parametric one-way ANOVA followed by a Dunnett`s post hoc or Tukey`s post hoc test. Differences were considered statistical significant at p < 0.05. 52 Chapter 3: Engineering of two prolyl endopeptidases Figure 3.2. SDS-PAGE (10%) analysis for protein expression of MX PEP and affinity chromatography stained with Coomassie blue for protein identification. Row identification: 1 molecular weight (MW) marker in kDa; 2 supernatant of induced cells after sonication; 3 flow through after protein binding to Ni-NTA resin; 4–6 wash steps 1–3; 7–13 elution fractions of the protein of interest a) MX3.1, b) MX3.2. Figure 3.3. SDS-PAGE (10%) analysis for protein expression of SC PEP and affinity chromatography stained with Coomassie blue for protein identification. Row identification: 1 molecular weight (MW) marker in kDa; 2 supernatant of induced cells after sonication; 3 flow through after protein binding to Ni-NTA resin; 4–6 wash steps 1–3; 7–14 elution fractions of the protein of interest a) SC3.1, b) SC3.2. Two protein bands with similar size were expressed as main products. The sequence of SC contains two start codons which are separated by 24 nucleotides. This leads to the expression of two SCs proteins with a difference of eight amino acids. 53 Chapter 3: Engineering of two prolyl endopeptidases 3.3. Results and Discussion The structural conformation of MX and SC and the proposed catalytic mechanism of the PEPs suggest that extensive motions need to be involved in substrate binding and cleavage. The two PEPs offer thus a challenging target for site-specific polymer conjugation as not only blockage of the active site by the polymer can reduce the enzymatic activity, but also interferences with their dynamics and shielding of amino acids on the surface being essential for initial interaction with the substrate. To explore methods of protecting PEPs with polymers without compromising their activity, locations for site-specific conjugation were introduced in three successive rounds of mutagenesis. Enzyme mutants with one to three engineered cysteine residues were produced in order to position free thiol groups on the surface of the enzymes. The thiols were then coupled to various polymers (vide infra) to produce a series of bioconjugates for analysis (see Chapter 4). However, a strategy to retain the enzymatic activity upon polymer conjugation and to not change the folding of the PEPs upon mutagenesis was essential. Firstly, mainly residues that resemble cysteine in size (i.e., alanine or serine residues) were selected for modification. The amino acids were also not sterically hindered by neighboring residues to ensure that the placed thiol groups were available for polymer attachment in order to facilitate polymer coupling. Figure 3.4 highlights the residues of MX chosen for mutagenesis Figure 3.4. Image sections of the 3D structure of with residues being chosen for mutagenesis experiments as red and blue sticks, MX (MX3.1 residues in red, MX3.2 residues in blue) are showing that no neighboring residues are presented with PyMOL. Amino acids are not sterically hindered by neighboring residues increasing the sterically shielding the amino acids. chance that these engineered cysteines are available for polymer attachment. a) S123, b) S338, c) K461, Moreover, the engineered cysteines should d) A25, e) A328, f) T417. be located in a positively charged micro- 54 Chapter 3: Engineering of two prolyl endopeptidases environment in order to stabilize the cysteine-polymer bond (Figure 3.5). Indeed, Shen et al. showed that positively charged neighboring residues increase the stability of a thiol– maleimide linkage used for coupling.218 Figure 3.5. Electrostatic charge distribution of the surface of MX. Charges are calculated with PyMOL. Color code of the surface shows residues +1.4 kT/e blue and –1.4 kT/e red. The black framed box presents the residues chosen for cysteine modification: a) S338, b) K461, c) S123, d) A25, e) A328, f) T417. A negative environment of the conjugation site was specified to destabilize bioconjugates.218 Regarding MX, three areas of the enzyme were selected as sites for modification, so that the grafted polymers would be roughly equidistant from one another (~4–7 nm) and at opposite ends of the protein in order to cover most of its solvent-accessible surface (Figure 3.6). Because the MX residues involved in substrate binding and the functionalities important for conformational rearrangements (i.e., opening and closing) were not known a priori, two sites were chosen for mutations in each region. The first area (“A” in Figure 3.6a) is located on the catalytic domain (residues A25 and K461) opposite the catalytic site, whereas the other two areas (“B”: S123, T417 and “C”: S338, A328) are on the β-barrel propeller domain. The first generation of mutagenesis yielded six single cysteine-mutated MXs (MX1.1–1.6; Figures 3.6a, b) that were expressed and assessed for 55 Chapter 3: Engineering of two prolyl endopeptidases their activity. All six variants maintained the activity of MX WT (Table 3.2). Because no loss in enzyme activity was obtained upon mutagenesis, two cysteine mutations were combined in order to produce three double-mutants of MX (MX2.1–2.3, Figure 3.7a). MX2.1 carries two cysteine residues on the β-barrel propeller domain and MX2.2 and MX2.3 carry one cysteine residue each on the catalytic domain and the β-barrel propeller domain. The doubly mutated enzymes were found to be as active as the MX WT control (Table 3.2). To further probe that mutagenesis on the surface of MX does not affect the activity, two triply-mutated forms of MX were produced by introducing cysteine residues simultaneously in regions “A”, “B”, and “C” (Figures 3.6a, 3.7b). These maintained the structure (Figure A5) and activity (Table 3.2) of MX WT. Hence, mutagenesis did not impair MX activity leading to the successful development of two mutants each carrying three cysteines on the surface that cover three different sites of the enzyme. Figure 3.6. Engineering of MX. a) 3D structure of the closed (inhibitor-complexed) form of MX with highlighted residues chosen for cysteine modification (MX1.1–MX1.6 in blue). The catalytic triad (Ser, Asp, His) is depicted in yellow, and the two linear strands covalently connecting the catalytic and β-barrel propeller domain of MX are shown in light black and indicated by an arrow. The three different regions of MX (A, B and C) where surface-exposed cysteines were introduced are circled. The residues targeted for mutation in each region are shown as spheres. The labeling of the residues consists of the original amino acid and the location in the amino acid sequence. (PDB 2BKL).82 b) Nomenclature used for the conjugates produced in the three rounds of mutagenesis. c) Distance of sites for polymer attachment. Residues chosen for mutagenesis and thus, for site-specific polymer attachment are highlighted in red and blue (MX3.1 and MX3.2, respectively). The distances were calculated with PyMol and are presented in Å (= 0.1 nm). 56 Chapter 3: Engineering of two prolyl endopeptidases Table 3.3. Activity of MX mutants. The location of the cysteine modification is presented with the labeling of the constructs and their activity. Mean ± SD (n = 3). Location of mutation Constructs Activity [%] ± SD None MX WT 101 ± 2.50 S123C MX1.1 79 ± 7.8 S338C MX1.2 98 ± 1.8 K461C MX1.3 91 ± 25 A328C MX1.4 88 ± 2.0 A25C MX1.5 82 ± 7.3 T417C MX1.6 77 ± 10 S123C + S338C MX2.1 96 ± 12 A328C + K461C MX2.2 81 ± 16 A25C + T417C MX2.3 93 ± 7.9 MX3.1 90 ± 9.6 MX3.2 89 ± 11 S123C + S338C + K461C A25C + A328C + T417C Figure 3.7. Second and third round of mutagenesis. The 3D structure of MX is presented with residues chosen for cysteine modification in colored spheres (prepared in PyMOL), whereas the same color code belongs to the one construct. The catalytic triad (Ser, Asp, His) is shown in yellow spheres. MX consists of two domains that are covalently connected by two linear strands shown in black.82 a) Three doubly cysteine-mutated MXs, b) two triple cysteine-mutated MXs. 57 a b Chapter 3: Engineering of two prolyl endopeptidases Figure 3.8. Engineering of SC. a) 3D structure of the unoccupied form of SC with highlighted residues chosen for cysteine modification (SC1.1–1.5 in blue). The active site (Ser, Asp) is depicted in yellow, and the two linear strands covalently connecting the catalytic and β-barrel propeller domain of SC are shown in light black and are indicated by an arrow. (PDB 1YR2).82,217 b) Nomenclature used for the conjugates produced in the three rounds of mutagenesis. c) Distance of sites for polymer attachment. Residues chosen for mutagenesis and thus, for site-specific polymer attachment are highlighted in red and blue (SC3.1 and SC3.2, respectively). The distances were calculated with PyMol and are presented in Å (= 0.1 nm). Regarding SC, again three rounds of mutagenesis were performed to introduce cysteine residues on the surface of the enzyme. In the first round, five singly mutated SCs were designed (SC1.1–SC1.5; Figures 3.8a, b) while applying the same rules as for MX. Residues being modified were similar in size to cysteine and located in a positively charged microenvironment. The distance between the modifications on the same domain was approximately 4 nm, whereas the distance between engineered cysteines across the two domains was longer (~7 nm, Figure 3.8c). However, the interdomain distance is expected to decrease when SC adopts a liganded conformation.82 Three cysteine modifications were located on the catalytic domain and two on the β-barrel propeller domain (Figure 3.8a). SC1.1–1.5 were expressed and assessed for their activity. SC1.1 and SC1.2 exhibited activity similar to SC WT, whereas SC1.3–SC1.5 showed significantly lower activity (Table 3.3). The cause for the partial activity loss is unclear but possibly related to impaired protein folding, dynamics or catalytic processes (i.e., substrate binding). 58 Chapter 3: Engineering of two prolyl endopeptidases Table 3.2. Activity of SC mutants. The location of the cysteine modification is presented with the labeling of the different SC variants and their activity. *p < 0.05 vs. SC WT. Mean ± SD (n = 3). Location of mutation Constructs Activity [%] ± SD None SC WT 105 ± 4.30 A96C SC1.1 81 ± 18 S351C SC1.2 114 ± 4.65 A560C SC1.3 54 ± 19* T441C SC1.4 64 ± 2.3* S643C SC1.5 52 ± 5.1* A96C + S351C SC2.1 58 ± 19* S351C + A560C SC2.2 50 ± 13* S643C + T441C SC2.3 71 ± 28 SC3.1 61 ± 13* SC3.2 38 ± 15* A96C + S351C + A560C S351C + A560C + T441C Figure 3.9. Second and third round of mutagenesis. The 3D structure of SC is presented with residues chosen for cysteine modification as colored spheres (prepared in PyMOL), whereas the same color code belongs to the one construct. The active site (Ser, Asp) is shown as yellow spheres. SC consists of two domains that are covalently connected by two linear strands shown in black.82 a) Three doubly cysteine-mutated SCs, b) two threefold cysteine-mutated SCs. 59 a b Chapter 3: Engineering of two prolyl endopeptidases To further probe the impact of cysteine mutagenesis on the surface of SC, sets of two mutations were combined to produce three doubly mutated SCs (SC2.1–2.3) carrying one cysteine modification on each domain (Figure 3.9a). Regarding SC2.1 and SC2.2, the high activity of SC1.2 could not be preserved but the constructs showed activity losses in the range of 42–50% compared to MX WT (Table 3.3). SC2.3 showed similar loss in activity (29%) with no statistical difference to MX WT due to the large standard deviation. Then, two triply mutated SCs were designed by combining three modifications so that two cysteines are placed on the catalytic domain and one cysteine mutation on the βbarrel propeller domain (Figure 3.9b). SC3.1 (A96C, S351C, A560C) was based on SC2.1 and exhibited ~60% WT activity being similar to the single mutant with the lowest activity of the three parental mutations (SC1.3, Table 3.3). SC3.2 (S351C, A560C, T441C) was constructed from SC2.2 and exhibited the largest loss in activity upon three rounds of mutagenesis (~40% WT activity). In contrast to MX, most single cysteine mutations of SC have caused significant activity losses. When combined, their detrimental effect was accumulating. Apparently, even residues on the surface of the PEP can impact the catalytic process to a certain degree. The catalytic triad is cleaving the peptidic substrates where the interface domain is taking a crucial part when complexing the peptide. However, first the substrate needs to interact with the enzyme to induce its opening. Not only the induction but also the process of opening and closing might be partially driven by residues on the surface of the PEPs; processes which might be disturbed by modifying the specific residues of SC to cysteines.219 Moreover, the cysteine mutations might also have affected the protein folding causing decreased activity. However, a detailed analysis of structural changes or impairment of the catalytic mechanism has not been part of this project. Based on the presented results, the highly active MX mutants were chosen for site-specific polymer conjugation. 60 Chapter 3: Engineering of two prolyl endopeptidases 3.4. Conclusion The structural similarities of MX and SC were previously proven by solving their crystal structures.82 However, site-directed mutagenesis of MX and SC showed that the modification of surface residues had different effects on their activity. The single cysteine mutants of SC showed partially decreased enzyme activity. When combining two or three cysteine modifications on SC, the sum of mutations caused a higher drop in activity. This implicates that the sites of SC chosen for modification must be somehow involved in catalytic processes and offer, therefore, no promising targets for polymer attachment. Regarding MX, all three rounds of mutagenesis did not influence enzyme activity. This led to the successful development of two highly active triply cysteine mutated MXs that serve as promising candidates for site-specific polymer conjugation. 61 Chapter 4 Syntheses, in vitro and in vivo characterization of MX bioconjugates Part of this chapter is published in: Schulz, J. D., Patt, M., Basler S., Kries H., Hilvert, D., Gauthier, M. A., Leroux, J.-C. Adv. Mater. 2015; DOI: 10.1002/adma.201504797. Chapter 4: MX bioconjugates, in vitro and in vivo 4.1. Introduction T HE catalytic properties of enzymes make them very attractive therapeutic agents for the treatment of diverse diseases.220 Enzymes efficiently and selectively catalyze reactions that can be harnessed to modify endogenous biomolecules and metabolic pathways. Furthermore, enzymatic drugs are often covalently modified with polymers such as PEG to improve their physicochemical and biological properties. Indeed, PEGylation is used to prevent aggregation,212 increase stability against proteolytic cleavage,203 enhance hydrodynamic volume, thereby slowing down renal clearance and increasing biological half-life,221 and, finally, reduce immunogenicity by masking antigenic epitopes.222 A variety of polymer-modified protein formulations have successfully reached the market,223 mostly prepared by randomly attaching polymers to solvent exposed lysine residues. However, when randomly attaching polymers, rather conjugation sites nor the number of conjugated polymer chains can be controlled, leading to a heterogeneous mixture of bioconjugates and thus, to poor reproducibility. Lysine residues are often multiple exposed on the surface of proteins and generally also at sites that are not attractive for polymer attachment, e.g., near the active site. Thus, random polymer attachment is typically associated with a loss of enzyme activity, so that large amounts of the often nonhuman protein must be administered to achieve the desired in vivo activity. This is potentially problematic since the amount of administered drug generally correlates with side-effects. Moreover, polymer conjugation has been most successful for enzymes acting on small substrates. Enzymes that target (oligo)peptides (such as PEPs) are potentially more challenging because they often require conformational flexibility, a property that may be hindered by polymer conjugation. Further, enzyme therapeutics for more aggressive biological environments than the blood, such as the GI tract, have received substantially less attention, in part because of severe activity loss under strongly denaturing/proteolytic conditions.203 In the case of celiac disease random polymer conjugation was performed on PEPs with the objective of improving enzyme stability in the GI tract. In a patent application,224 the random PEGylation of glutenases was reported. Although conjugates displaying > 100% of the catalytic activity of the native proteins were reported, in our hands93 random PEGylation systematically led to substantial loss in activity consistent with reports from 63 Chapter 4: MX bioconjugates, in vitro and in vivo most other PEGylated enzymes.225 Furthermore, the patent application in question provided only relatively limited in vitro analysis of the conjugates, and no in vivo experiments.224 More recently, our group has shown that random modification of MX with a polycationic dendronized mucoadhesive polymer stabilized the enzyme in the GI tract, leading to prolonged activity in this harsh environment.93 However, this conjugate was ~four-fold less active than the MX WT, which can be tentatively attributed to impaired protein dynamics or hindered substrate entry. As a consequence, higher doses of this conjugate would be required for therapeutic applications, possibly enhancing side-effects associated with the polycationic mucoadhesive polymer. Indeed, it is known that polycations promote the opening of tight junctions in the intestinal epithelium,226 which may allow other immunogenic or toxic substances to reach the blood. To this end, substantial efforts are currently focused on developing strategies to protect proteins more effectively without compromising their activity.227 These strategies include site-specific polymer conjugation to residues remote from the active site and the conjugation of polymers with defined architectures and bearing functional groups to better protect the enzymes.222,228–230 Site-specific polymer conjugation offers a promising tool to overcome the limitations of random polymer attachment due to the better control of polymer coupling. Thereby, homogenous products can be produced with a defined number of polymer chains at specific locations on the protein causing good reproducibility and high activity which are important factors for the pharmaceutical industry. Moreover, attaching polymers with well-defined structures helps to decrease the polydispersity of the bioconjugates and functional groups can positively influence the stability in vivo.93 Hence, this chapter demonstrates that protection of MX in the challenging environment of the GI tract can be achieved without compromising catalytic activity relative to the native protein. Thereby, a combination of controlling the properties of polymers and their ‘multi-site-specific’ attachment to the enzyme was performed. 64 Chapter 4: MX bioconjugates, in vitro and in vivo 4.2. Materials and Methods All chemicals were purchased at the highest possible analytical grade, and used as received. The fluorescence-quenched peptide substrate (HiLyte Fluor™647)– LPYPQPK(QXL™670) was custom-synthesized by Eurogentec (Seraing, Belgium) at 95% purity, and was supplied with an analytical chromatogram and mass spectrum. Site-specific polymer conjugation of MX: Mutant MX (0.65 mg/mL) was incubated overnight (4 °C) with 100 molar eq. (relative to protein) of either 5 kDa (Sigma-Aldrich) or 40 kDa (Jenkem Technology, Plano, TX) mPEG–maleimide in sodium phosphate buffer (50 mM, pH 8) (Figure 4.1a). Conjugates were purified by repetitive ultrafiltration (Amicon 30 kDa or 100 kDa MWCO) with sodium phosphate buffer (50 mM, pH 7.5). A generation 3 PAMAM (3.6 mM) with an ethylenediamine core and amino terminal groups (Figure 4.1b, Dendritech® Inc, Midland, MI) was modified with 2.5 eq. (relative to the dendrimer) of N-γ-maleimidobutyryl-oxysulfosuccinimide ester (Thermo Scientific, Waltham, MA) in 3-(N-morpholino)propanesulfonic acid (MOPS, 100 µL, 100 mM), pH 7.2 for 1 h at r.t. The resulting thiol-reactive dendrimer was purified by ultrafiltration (Amicon 5 kDa MWCO) with MOPS (50 mM, pH 7.2) and characterized by 1H-NMR spectroscopy (D2O, 400 MHz, Bruker AV-400) (Figure A6). Subsequently, mutant MX (0.65 mg/mL) was reacted with the singly modified dendrimer (100 eq. relative to protein) in MOPS (50 µL, 50 mM, pH 7.2) overnight at 4 °C. The conjugate was purified by repetitive ultrafiltration (Amicon 30 kDa MWCO) with MOPS buffer (50 mM, pH 7.5). Protein concentration was determined with the bicinchoninic acid (BCA) protein assay kit (Thermo Scientific) according to the supplier’s protocol or by absorbance measurement at 280 nm, and purity was confirmed by HPLC (Figures A7, A8). Complete conjugation was determined by SDSPAGE (10%) and by titrating residual thiol groups (Measure-IT™ Thiol Assay Kit, Life Technologies). 65 Chapter 4: MX bioconjugates, in vitro and in vivo a b H2NH2N NH2 H 2N N N H2N O H 3C O O N n O H 2N N N H 2N N H 2N N N H 2N H 2N N H 2N H 2N H2N NH2 NH2 NH2 N N N N N N N N N N N N N N N H 2N H2NH2N NH2 NH2 N NH2 N N NH2 NH2 N N NH 2 NH2 NH2 NH2 N N NH2 H2N NH2NH2 Figure 4.1. Molecular structure of a) mPEG–maleimide and b) PAMAM G3 with terminal amino groups. In vitro activity: MX or MX–polymer conjugates (0.5 μg/mL) were incubated at 37 °C with (benzyloxycarbonyl)-glycine-proline-p-nitroaniline (2.5 μM, Bachem) in sodium phosphate buffer (50 mM, pH 7.0). Enzyme activity was calculated from the slope of the absorbance change at 410 nm due to the release of nitroaniline, which was monitored for 5 min. The activity (slope) observed with the commercially available MX WT was set to 100%. In vitro stability: To assess stability, MX or MX–polymer conjugates (2 μg/mL) were incubated in simulated intestinal fluid USP pH 6.8 (10 mg/mL pancreatin from porcine pancreas, 4 × USP, Sigma-Aldrich) at 37 °C. At specific time points an aliquot was withdrawn to measure activity. To calculate the enzymatic half-life (t50), an exponential curve fitting of the graphs was performed with SigmaPlot (Figure A9). HPLC analysis: The PAMAM–GMBS conjugate was analyzed by HPLC (Merck Hitachi LaChrom, Tokyo, Japan) using a XBridgeTM BEH 300Prep C18 5 μm (10 × 150 mm) with 1 mL*min–1 flow rate, isocratic with water (+0.1% TFA) for 5 min followed by a linear gradient of ACN (+0.1% TFA) over 20 min (40 ̶ 60% v/v). The polymer–MXs were analyzed by HPLC with 1 mL*min–1 flow rate, isocratic with water (+0.1% TFA) for 5 min followed by a linear gradient of ACN (+0.1% TFA) over 20 min (10 ̶ 90% v/v). Random PEGylation: mPEG (5 kDa, methoxy PEG propionaldehyde, JenKem Technology) was conjugated to MX3.1 (0.325 mg/mL) in 200 µL sodium phosphate (20 mM), sodium cyanoborohydride (20 mM), pH 6, containing 100, 500, 1000, 2000 or 66 Chapter 4: MX bioconjugates, in vitro and in vivo 5000 eq. (relative to protein) of the reactive mPEG. The reaction was maintained at 4 °C overnight, after which time the conjugate was purified by repetitive ultrafiltration (Amicon 30 kDa MWCO) using MOPS buffer (50 mM, pH 7.5) as eluent. Protein concentration was assayed by spectrophotometry at 280 nm. The degree of conjugation was determined by SDS-PAGE (10%) and NMR analysis. The additional site-specific PAMAM conjugation was performed as mentioned above. Thiol quantification assay (Measure-IT™ Thiol Assay Kit, Life Technologies) was performed to prove complete site-specific PAMAM conjugation. 1H NMR spectroscopy: A known amount of MX–polymer conjugates was dissolved in D2O and a defined amount of DMSO was added. 1H NMR spectroscopy of this solution was performed (D2O, 500 MHz, Bruker DRX-500). The ratio of the integrals of the PEG5 backbone peak (3.6 ppm) and the DMSO yielded the concentration of the PEG5 component in the solution. With the known protein concentration (based on absorbance at 280 nm), the grafting density of PEG5 per MX can be calculated. In vivo activity: Animal experiments were approved by the Cantonal Veterinary Office Zurich (226/2012). Female Sprague-Dawley rats (7–21 weeks old, 250–350 g) on glutenfree food were shaved in their abdominal region and fasted for 4 h with access to water unless stated otherwise. For each animal, a fluorescence image was recorded prior to any procedure. The rats were orally gavaged with the fluorescence-quenched peptide alone (negative control) or with the pre-cleaved peptide (positive control). MX or MX–polymer conjugates (1 µg in 200 µL 10 mM sodium phosphate buffer, 5 µg/mL, pH 7.5) were mixed with gliadin (2 mg/mL, 10 µL) and orally gavaged to rats. The fluorescence-quenched peptide substrate [(HiLyte Fluor647)–LPYPQPK(QXL670)] (2.5 µM in 200 µL sodium cholate 0.5 wt%) was administered 5 min later. To determine stability in the GI tract, the protocol above was modified to introduce a 1 h or 2 h delay between the administration of the MX–polymer conjugate and the fluorescence-quenched peptide. For imaging, rats were anaesthetized (2–2.5% isoflurane, 0.5 mL/min oxygen) and placed on a heated platform (37 °C) in an in vivo imaging system (IVIS Spectrum, Caliper, Mainz, Germany). Fluorescence images were recorded at specific time points at λex/em = 745/800 nm, binning 8, f-stop 2, exposure time 2 s. Between time points, rats were returned to their cages. Images were analyzed with Living Image software (Caliper Life Science, Waltham, MA). Images 67 Chapter 4: MX bioconjugates, in vitro and in vivo were smoothed by 7 × 7 pixels to reduce background noise. At each time point, the average fluorescence intensity was normalized to the pre-gavage value. Auto-fluorescence not related to the experiment and outside the abdominal area was removed from all displayed images. In vivo pH measurements: Rats (n = 4) were fasted for 4 h with access to water and sacrificed. The stomach and intestine were removed and the organs opened. The pH was measured three times on the opened tissues with pH indicator paper (pH gradation pH 3.8– 5.8 and 6.4–8.0, Macherey-Nagel, Düren, Germany). Analysis of Recorded Images: Images were analyzed with Living Image software (Caliper Life Science). A region of interest (ROI) was defined for the GI tract and stayed constant in size and location throughout the whole experiments (Figure 4.2). At each time point, the average fluorescent intensity was normalized to the pre-gavage status. Figure 4.2. A ROI (blue) was defined, constant in size and position, to measure the fluorescent signal of the cleaved peptide in the GI tract of rats. Statistical analysis: The data from in vivo experiments were analyzed using nonparametric Kruskal-Wallis one-way ANOVA followed by Dunn post hoc test. In vitro data were analyzed by parametric one-way ANOVA followed by a Dunnett`s post hoc or Tukey`s post hoc test. Differences were considered statistically significant at p < 0.05. 68 Chapter 4: MX bioconjugates, in vitro and in vivo 4.3. Results and Discussion The single, double and triple cysteine-mutated MXs (Table 3.2) were PEGylated with 5 and 40 kDa mPEG–maleimide (PEG5 and PEG40) to yield well-defined conjugates with 1–3 polymers attached (Figure 4.3a). The functionalized PEG was reacted via a Michaeladdition to the free thiol group(s) on the surface of MX and reduced conditions prevented disulfide bond formation. The first indication of a successful polymer coupling was obtained by SDS-PAGE gel analysis showing that no unconjugated MX was still available (Figure 4.4). When the mono-PEGylation of MX1.1–1.6 was performed, the SDS-gel proved that all single cysteines were reacted. In the case of doubly and triply mutated PEPs, this method could however not tell if possibly a heterogeneous mixture of singly, doubly (and triply) MX–PEGs was observed. Once MX is PEGylated, it migrates differently through a SDS-gel indicating that the size of the band does not correspond to the actual size of the conjugate (Figure 4.4). Therefore, other measures to demonstrate the successful coupling of the PEG chains to all free cysteines were required. A dye that turns fluorescent once coupled to a thiol group was used to detect unreacted cysteines. In all PEGylation reactions no free thiol groups were detected (Figure 4.5) proving that both PEG5 and PEG40 were successfully conjugated to the all cysteines of mutant MXs. Figure 4.3. Chemical reaction schemes of site-specific and random polymer conjugation. a) Sitespecific PEGylation of mPEG-maleimide (5 and 40 kDa) to thiol groups of engineered cysteines on MX. b) Chemical reaction of sulfo-GMBS to PAMAM G3. Subsequently the polymer-linker was mixed with MX–SH to form PAMAM–MX conjugates. c) Random PEGylation of mPEG–aldehyde (5 kDa) to lysine residues of MX. Depending on the initial feed ratio, different grafting densities of MX–ran–PEG5 linked via -NH2 groups were observed (Table 4.1). 69 Chapter 4: MX bioconjugates, in vitro and in vivo Figure 4.4. SDS-PAGE (10%) analysis of conjugation reactions. a) The gel was stained with coomassie blue for protein identification. b) Barium iodide staining (PEG staining) shows a brown color on the PEGylated protein bands (rows 3 and 4). The migration behavior depends on the nature of the bioconjugate. PEG has a higher hydrodynamic volume than proteins and therefore migrates slower in SDS gel electrophoresis compared to a protein of the same molecular weight. Thus, the 5 kDa PEGylated enzyme appears larger than it actually is and the 40 kDa PEGylated variant does almost not migrate at all. The dendrimeric PAMAM has a very compact structure leading to a very similar migration to a protein of the same size. Generally, the polydispersity of polymers in addition to the different migration behavior through SDS gels lead to smeared bands of the polymer conjugates. 7000 Normalized fluorescence Normalized fluorescence 8 6 4 MX3.1 MX3.1–PEG5 MX3.1–PEG40 MX3.1–PAMAM 6000 5000 4000 3000 2000 1000 0 -1000 500 2 520 540 560 580 600 620 640 660 Wavelength / nm 0 g Ne ve a ti n co tr o l MX 3 .1 MX –P 3 .1 EG 5 MX 3 .1 E –P G4 MX 0 3 .1 AM AM P – MX variant Figure 4.5. Proof of completed site-specific conjugation. A thiol-binding dye was used to detect free thiol groups. The negative control consists of the dye only, whereas the positive control is represented by MX3.1 carrying three free cysteines. Data were divided by the negative control and plotted in a histogram at 523 nm. The inset presents the fluorescent signal with wavelength showing again that no free thiols were detected in none of the reactions. Mean + SD (n = 3). Only the positive control MX3.1 was performed with n = 1. 70 Chapter 4: MX bioconjugates, in vitro and in vivo Once the PEGylated MXs were purified, in vitro activity measurements were performed. In Figure 4.6a the activity of the six mono-PEGylated MX conjugates are illustrated and typically the PEG5 conjugates retained ~100% MX WT activity. This indicates that the short polymer did not interfere with the catalytic process of MX. One exception, MX1.1–PEG5, possessed a slightly higher activity than the native enzyme. Increased activity upon PEGylation has been reported previously,225,231,232 and might result from subtle conformational changes in the protein induced by the PEG chain. Others have suggested that polymers may favor accumulation of substrate near the active site.231 Site-specific mono-PEGylation of PEG5 to MX had no negative effects on the enzymatic activity, whereas the longer mPEG (PEG40) showed discrimination between the attachment sites. Most conjugates with the longer PEG40 possessed ~50% of the activity of MX WT, except MX1.1–PEG40 that was as active as the native protein, and MX1.2– PEG40 that maintained ~70% MX WT activity (Figure 4.6a), indicating that the conjugation site is important when full activity of the conjugates should be preserved. It should be noted that PEG40 has a hydrodynamic diameter of ~13 nm,233 which is ~2 to 3 times larger than MX itself (based on PDB 2BKL). Thus, in addition to PEG40 sterically hindering the approach of the substrate, the polymer may also mask substrate binding sites on the protein associated with the catalytic mechanism. To address this point, three double-PEGylated MXs were created and analyzed (Figures 3.7a, 4.6b). MX2.1–PEG5 possesses two PEG5 chains on the β-barrel propeller domain, and MX2.2–PEG5 and MX2.3–PEG5 have one PEG5 chain on the catalytic domain and another on the β-barrel propeller domain. As seen in Figure 4.6b, the PEG5– conjugate MX2.1 retained ~80% MX WT activity, whereas MX2.2–PEG5 and MX2.3– PEG5 are ~55% active. The partial loss of activity suggests that the collective interactions between PEG and the protein are influenced by the total amount of PEG added (i.e., either the molecular weight of a single chain, or the combined molecular weight of several chains).234 Because both PEG5 chains are on the same domain of the protein in MX2.1– PEG5, it is conceivable that the approach of the substrate to its binding site at the interdomain interface as well as the conformational reorganization of the protein are less adversely affected than when the polymers are present on both domains (MX2.2–PEG5 and MX2.3–PEG5). It is notable that increasing the PEG length from 5 to 40 kDa on the 71 Chapter 4: MX bioconjugates, in vitro and in vivo doubly mutated MXs did not significantly reduce activity. This suggests that the steric hindrance associated with PEG eventually saturates when the amount (as overall molecular weight) reaches a threshold value (vide infra). Indeed, Chiu et al. reported similar results with PEGylated trypsin where conjugates carrying multiple PEG chains of different sizes (2, 5 and 10 kDa) showed identical activity.232 Figure 4.6. In vitro activity of MX WT, mutated and polymer conjugated MXs. a) Singly mutated and PEGylated MXs, b) doubly mutated and PEGylated MXs, c) triply mutated, PEGylated and PAMAM conjugated MXs. d) Random PEG5 conjugates of MX3.1 and the latter with additional site-specifically attached PAMAMs. Activity was assessed by post-proline cleavage of Z-Gly-Pro-pNA at 37 °C. *p < 0.05 vs. MX WT. Mean + SD (n = 3). MX WT activity bar is identical in a), b) and c). 72 Chapter 4: MX bioconjugates, in vitro and in vivo To probe this phenomenon further, two triply PEGylated forms of MX were created by attaching polymers simultaneously in regions “A”, “B” and “C” so that both variants carry two cysteine mutations on the β-barrel propeller domain and one on the catalytic domain (Figure 4.7). The first variant, MX3.1 (i.e., S123C, S338C, K461C), was based on MX2.1 and did not show any loss in activity upon the attachment of three PEG5 chains compared to the corresponding di-PEGylated enzyme (MX2.1–PEG5, Figure 4.6c, b). The second, MX3.2 (i.e., A25C, A328C, T417C) was constructed from MX2.3, and its threefold PEGylated form (MX3.2–PEG5) showed less activity than its di-PEGylated counterpart MX2.3–PEG5 (~55% vs. ~35%, respectively; Figures 4.6b, c). Furthermore, as for the doubly-PEGylated conjugates, activity was independent of PEG molecular weight. These results support the idea that the detrimental effect of PEGylation on activity of MX eventually plateaus when the overall molecular weight of PEG per conjugate increases above a threshold value in the 15–40 kDa range. Moreover, the analysis of the library of conjugates suggests that the difference between the activity of PEGylated MX3.1 and MX3.2 (~70% vs. ~35%, Figure 4.6c) reflects the importance of the conjugation sites rather than PEG length on the overall catalytic process of the protein (substrate binding and conformational reorganization). Figure 4.7. 3D structure of MX with highlighted residues chosen for polymer attachment (MX3.1 residues in red and MX3.2 in blue). The catalytic triad (Ser, Asp, His) is depicted in yellow, and the two linear strands covalently connecting the catalytic and β-barrel propeller domain of MX are shown in light black and indicated by an arrow. The three different regions of MX (A, B and C) where surface-exposed cysteines were introduced are circled.82 73 Chapter 4: MX bioconjugates, in vitro and in vivo Figure 4.8. SDS-PAGE (10%) visualizing unconjugated MX3.1 and MX3.1 reacted with different molar equivalents of PEG5. Row identification: 1 molecular weight marker, 2 MX3.1, 3 MX3.1–ran – PEG5 1, 4 MX3.1–ran –PEG5 3, 5 MX3.1–ran –PEG5 5, 6 MX3.1– ran –PEG5 8, 7 MX3.1–ran –PEG5 14. Higher molecular weight for the MX conjugates is produced when the molar amount of PEG5 is increasing (Table 4.1). A smear is obtained for the PEG5 conjugated samples on the gel, hinting towards heterogeneous mixtures of the bioconjugates. This conclusion was tested by randomly conjugating mPEG propionaldehyde (5 kDa) to solvent-exposed lysine residues of MX3.1 to different extents (MX3.1–ran – PEG5; Figures 4.3c, 4.8). The multi-PEGylated conjugates displayed decreasing activity with increasing grafting density of PEG5 from 1 to 14 chains per enzyme (Figure 4.6d, 4.9). These results support the notion that conjugates prepared by appending polymers site-specifically to appropriate attachment sites are generally superior to randomly modified proteins. Prior in silico analyses of PEG–protein conjugates performed by other groups have suggested that PEG can interact with hydrophobic areas on proteins and by doing so has a large “footprint” on the solvent-exposed surface.235 To examine this point, MX3.1 and MX3.2 were site-specifically modified with a G3 PAMAM (6.5 kDa) dendrimer with terminal amino groups, which adopts a compact spherical structure (hydrodynamic diameter of 3.1 nm; Figure 4.1b).125,236 Thereby, a two-step reaction was performed, whereas a bi-functional linker was first reacted with an amino group of PAMAM and then coupled to MXs’ thiol(s) (Figure 4.3b). The site-specific coupling of three dendrimers to MX3.1 and MX3.2 succeeded as shown in Figures 4.4 and 4.5. PAMAM is not expected to significantly interact with the protein except in the immediate vicinity of the conjugation site due to its charge and rigid structure giving it little flexibility. Interestingly, MX3.1– PAMAM maintained 100% of the activity of MX WT, while MX3.2–PAMAM possessed 74 Chapter 4: MX bioconjugates, in vitro and in vivo the same low activity as its PEGylated analogs (Figure 4.6c), again underscoring the importance of the conjugation sites. It was also possible to modify MX3.1–ran –PEG5 conjugates with three PAMAM units without further loss of activity (Figures 4.10, 4.11). These results indicate that attachment of large PAMAM units on the surface of MX is possible in combination with random PEGylation, suggesting that the surface of the protein remains fairly exposed despite the presence of multiple PEG5 chains. a PEG backbone DMSO MX3.1–PEG5 b MX3.1–ran–PEG5 3 c MX3.1–ran–PEG5 8 d MX3.1–ran–PEG5 14 Figure 4.9. 1H NMR spectra of a) MX3.1–PEG5 site-specifically attached, and b)–d) three random PEG5 conjugates: b) MX3.1–ran –PEG5 3, c) MX3.1–ran –PEG5 8, d) MX3.1–ran –PEG5 14 (D2O, 500 MHz, Bruker DRX-500). A known mass of the MX3.1–PEG5 conjugate was dissolved in D2O containing 1 µl DMSO that served as an internal standard. The quantification of the PEG backbone signal resulted in the following number of PEG chains attached per MX: a) 3, b) 3, c) 8, d) 14. The grafting density of all conjugates is presented in Table 4.1. 75 Chapter 4: MX bioconjugates, in vitro and in vivo Figure 4.10. 3D structure of MX highlighting all lysine residues (blue), engineered cysteine residues (red) and the active site (yellow) as spheres. a) MX3.1 carries 44 lysine residues. The crystal structure shows that most of the lysines are located on the surface of the enzyme and thus a high number should be available for random PEGylation. However, some are closely located to the active site leading to one explanation of loss of activity upon random PEGylation. b) The three cysteine residues of MX3.1 are not closely located to any lysine residue which gives an explanation why the thiols are still available for PAMAM conjugation upon random PEGylation. Normalized fluorescence 10 8 6 4 2 M X3 .1 M –ra MX 3. X3 n– .1 PE 1 – r M G 5 X 3 an –P 1 .1 E – ra M G 5 X3 n– .1 PE 3 M – M X3 X3 ran G5 .1 .1 –P 5 – –r r M an E G X 3 an –P –P 5 8 .1 EG M –ra EG 5 X3 n– 5 1 .1 PE –P 14 – AM r M G 5 X 3 an AM –P 3– .1 P E – M X3 ran G5 AM AM .1 –P 5– –r an E G P A –P 5 8 MA M E G –P AM 5 14 –P AM AM AM 0 MX variant Figure 4.11. Proof of completed site-specific conjugation after random PEG5 attachment to MX3.1. A thiol-binding dye was used to detect free thiol groups. The positive control is represented by MX3.1 carrying three free cysteines. Data were divided by the negative control (dye only, Figure 4.5) and plotted in a histogram at 523 nm. Free thiols were detected in the positive control and in the random conjugated MXs with no statistical difference upon them. Mean + SD (n = 3). Only when PAMAM was site-specifically added to the engineered cysteines no free thiols were detected. Herein, n = 1 was performed because previous experiments showed that the standard deviation was very low and therefore the measurement is precise when the thiols are reacted (Figure 4.5). 76 Chapter 4: MX bioconjugates, in vitro and in vivo Based on these findings, MX3.1 and MX3.1–polymer conjugates were selected for analysis in vivo, as they displayed the highest activity. A model peptide substrate mimicking an immunogenic sequence of gluten peptide was designed. The intact substrate bears a fluorophore/quencher pair allowing in vivo activity to be monitored because digestion of the peptide releases the fluorophore, which recovers its fluorescence (Figure 4.12a).216 Rats were orally gavaged with MX or MX–polymer conjugates on an equal mass basis (very close to equal activity basis), together with gliadin (sacrificial substrate), followed by the administration of the fluorescence-quenched substrate. This protocol is consistent with the envisaged therapy, in which celiac patients would ingest the enzyme–conjugate prior to ingesting gluten-containing products. Enzyme activity was monitored using a whole animal imaging system (Figure 4.12b). For better reproducibility, a single large region of interest was defined that encompassed the entire abdomen of the rats (Figure 4.2). Moreover, in order to avoid a high background signal with the negative MX WT control, the dose of enzyme administered was set at 1 µg/rat. The in vivo activity of MX WT and MX3.1 was found to be equivalent to that of the negative control (peptide alone) under these conditions (Figures 4.12b, c). Even though MX3.1–PEG5 showed higher in vivo activity, no statistical differences to the negative control were observed (Figure 4.12b). These results reinforce the idea that the three PEG5 chains poorly cover the surface of the protein, leaving it accessible to proteases and susceptible to pH-induced deactivation. Increasing PEG length to 40 kDa significantly improved stability, as shown by an increase of the fluorescence signal in the GI tract (Figures 4.12c, d). Interestingly, PAMAM had an equivalent effect to PEG40, despite the fact that PAMAM is smaller than PEG5 (hydrodynamic diameter of 3.6 vs. ~5 nm, respectively, Figures 4.12c, d). The cationic charge of the polymer may play a role in stabilizing MX against proteases, possibly by complexing endogenous negatively charged macromolecules, such as mucin. Alternatively, PAMAM could complex negativelycharged proteases such as pepsin (isoelectric point 1.0) or even repel positively-charged proteases such as chymotrypsin or trypsin (isoelectric points of 8.5 and 10.5, respectively; see Figure 4.13 for pH values along the GI tract).237 77 Chapter 4: MX bioconjugates, in vitro and in vivo Figure 4.12. Enzymatic activity of MX3.1–polymer conjugates in the GI tract of rats. a) Scheme of the cleavage of the fluorescence-quenched peptide. The model peptide (HiLyte Fluor647)– LPYPQPK(QXL670) was orally gavaged to rats after the administration of MX WT, MX3.1 or MX3.1– polymer conjugates. After the cleavage of the peptide, fluorescence emission was detected by live imaging of the GI tract. b) Schematic illustration of the in vivo experimental set-up. 5 min, 1 or 2 h prior to the substrate, MX and MX–polymers were orally applied. At specific time points (1–4 h after peptide application) in vivo imagining was performed. c) Normalized fluorescent signal of the cleaved peptide vs. time. MX or MX–polymer conjugates were orally administered to rats 5 min prior to the peptide application. Fluorescent signal was measured at specific time points (1–4 h). *p < 0.05 vs. MX WT. Mean + SD (n = 8– 10). Data are also partially presented in Figure 4.14. d) Images show peptide cleavage over time in the GI tract when the peptide was administered 5 min after the enzyme/conjugate. The positive control is presented by the pre-cleaved peptide. All conjugates were active over time and the PEG40 and PAMAM conjugates showed highest fluorescent signals. 78 Chapter 4: MX bioconjugates, in vitro and in vivo 9 8 pH 7 6 5 4 3 ac om St h Du e od nu m ju Je nu m u Ille m up pe r u Ille m low er Tissue Figure 4.13. In vivo pH of GI tract content. Mean + SD (n = 4). No standard deviation was obtained when measuring the stomach pH with pH paper. Although it is difficult to pin down the precise origins of this effect, conjugation of another high-molecular weight polycation to MX has previously been shown to promote stability and retention in the stomach of rats, suggesting that the underlying mechanism is general.93 It is also worth noting that the fluorescence intensity observed for MX3.1– PAMAM and MX3.1–PEG40 was statistically indistinguishable from the positive control, confirming that these constructs retain high activity. Indeed, in vitro analysis of the stability of MX and its polymer conjugates in simulated intestinal fluid (pH 6.8, containing pancreatin) reflects the trends observed in vivo (significant stabilization with MX3.1–PEG40 and MX3.1–PAMAM, Table 4.1). This model fluid has been shown to be a good predictor of in vivo stability in previous work with this type of enzyme.93 Thereby, most of the conjugates of MX3.2 and the random PEG5 conjugates of MX3.1 showed low stabilization success even though the latter are carrying a high number of polymers (≤ 14) which could have possibly led to more efficient enzyme protection. This indicates that high activity as only obtained for the site-specific MX3.1 conjugates and which is mainly caused by the specific conjugation sites is an essential factor for the effective stabilization under physiological conditions. 79 Chapter 4: MX bioconjugates, in vitro and in vivo Table 4.1. Half-life of enzymatic activity in simulated intestinal fluid. MX or MX–polymer was exposed to simulated intestinal conditions (pancreatin, pH 6.8, 37 °C) and activity was assessed at different time points. The table presents the time needed to inactivate the enzymes by 50% (T50). *p < 0.05 vs. MX WT. Mean (n = 3). The location of the cysteine modifications (color code as in Figure 4.7) is presented with the labeling of the different MX variants. Regarding the random conjugation, the initial ratios of PEG are presented with the grafting densities of PEG chains to MX3.1. Cysteine mutation MX variant t50 [min] ± SD None MX WT 6.8 ± 1.0 S123C + S338C + K461C MX3.1 5.5 ± 1.4 “ MX3.1–PEG5 9.8 ± 1.2 “ MX3.1–PEG40 13.9 ± 1.8* “ MX3.1–PAMAM 11.7 ± 1.9* A25C + A328C + T417C MX3.2 2.9 ± 0.3* “ MX3.2–PEG5 5.7 ± 0.6 “ MX3.2–PEG40 10.6 ± 0.2* “ MX3.2–PAMAM PEG5 (eq.) 1.9 ± 0.4 # PEGs attached 100 1 2.1 ± 0.1 500 3 3.4 ± 0.8 1000 5 4.3 ± 1.4 2000 8 5.5 ± 1.1 5000 14 13.6 ± 7.9 80 Chapter 4: MX bioconjugates, in vitro and in vivo To further investigate the stability of the conjugates of MX3.1 in the GI tract, they were orally applied to rats and allowed to “incubate” in this environment for 1 or 2 h before the fluorescence-quenched substrate was administered (Figure 4.12b). As illustrated in Figure 4.14, the conjugates maintained full activity, even after prolonged exposure to the harsh environment of the GI tract which is underlining the ability of the polymers to protect MX in the digestive tract. Figure 4.14. In vivo activity of MX–polymer conjugates. a)–b) Normalized fluorescent signal of the cleaved peptide vs. time. MX, (a) MX3.1–PEG40 and (b) MX3.1–PAMAM were gavaged to rats 5 min, 1 h or 2 h prior to the peptide. Fluorescent signal was measured at specific time points (1–4 h on x-axis) after peptide administration. *p < 0.05 vs. peptide only; †p < 0.05 vs. positive control (pre-cleaved peptide). Mean + SD (n = 8–10). The pre-cleaved peptide, peptide only and MX WT curves are identical in c) and d) and the data is also presented in Figure 4.12. c) In vivo images present the fluorescent signal when MX3.1– PEG40 or MX3.1–PAMAM was orally administered 2 h prior to the peptide. 81 Chapter 4: MX bioconjugates, in vitro and in vivo It should also be mentioned that, while the objective of this work was not to investigate the innocuousness of the conjugates, no signs of animal distress were observed, despite repeated dosing of the conjugates, or PAMAM alone (Figure 4.15). Indeed, PAMAM G3 was found to be safe in other studies when orally administered.129,238 a b Figure 4.15. Analysis of body weight changes of rats. a) Evaluating the body weight of rats which were fed with MX and MX-polymer. Arrow indicates the time point where the fastening was changed from 4 h to overnight which caused a temporary drop of body weight. The blue highlighted region indicates the time frame of the in vivo activity experiments (Figure 4.12). The green frame shows the time period when the in vivo kinetic studies were performed (Figure 4.14). Mean ± SD (n = 4). b) After three months, three rats were orally administered with PAMAM for two weeks. The body weight is illustrated over these specific two weeks. No loss in body weight was obtained. 82 Chapter 4: MX bioconjugates, in vitro and in vivo 4.4. Conclusion In summary, when analyzing the in vitro results of the bioconjugates created in this work, three major findings can be concluded. The site of polymer attachment importantly influences enzymatic activity, whereas the impact of polymer length of PEG is negligible upon a threshold value, but polymeric architecture matters. Thereby, these findings became most evident with the triple conjugated MXs as MX3.1 showed higher activity upon PEGlyation than MX3.2, underlining the importance of conjugation sites and in both cases no difference between attached PEG5 and PEG40 was observed. Additionally, the relevance of polymeric architecture was evaluated by attaching the dendrimer PAMAM to MX3.1. The bioconjugate with the compact polymeric structure retained full WT activity, whereas the linear PEGs attached to MX3.1 caused a drop in activity. When orally applied to rats, the results also demonstrated that judiciously chosen attachment sites and polymer types were crucial to the success of the modified enzymes in vivo. MX3.1–PEG40 showed higher activity in the GI tract of rats compared to the corresponding PEG5 conjugated, indicating that the shorter polymer did not efficiently cover the enzyme’s surface. PAMAM with a size comparable to PEG5 stabilized MX similar to PEG40 though. This reveals that a compact polymeric architecture as well as functional groups can enhance the stability in vivo. Moreover, the two bioconjugates of MX3.1 coupled to PEG40 and PAMAM showed high activity even when they were incubated in the GI tract 1 or 2 h before the application of the substrate. Thus, the strategy of triple site-specific conjugation of PEG40 or PAMAM efficiently stabilized MX3.1 without compromising its catalytic activity. As potential adjuvant therapy for celiac disease and other gluten-related disorders such as non-celiac-gluten-sensitivity,239 less of our conjugate may therefore be needed to achieve a desired activity level in the body. Lower doses are favorable for reducing the risk of potential side-effects from the synthetic polymer. 83 Chapter 5 General Conclusion & Outlook Chapter 5: Conclusion &Outlook T HE work presented in this thesis describes a strategy to successfully stabilize enzymes in the GI tract without compromising their catalytic activity. Celiac disease served as an ideal platform to test the developed approach in view of the lack of available pharmaceutical treatments and of the benefits that the oral administration of enzymes would bring to patients suffering from this pathology and possibly also from NCGS. With a prevalence of ~1%, celiac disease is an autoimmune disorder of the small intestine triggered by gluten, a mixture of proteins found in a variety of grains.13 A GFD is so far the only option available for celiac patients. Notwithstanding, staying on a safe GFD is rather difficult because even small amounts of (hidden) gluten can often lead to intestinal damage. An enzymatic therapy would offer an approach to help digest hidden or accidentally consumed gluten. It was reported that PEPs can break down the immunogenic peptides which prevents the inflammation in the intestine.79 However, PEPs themselves are prone to get degraded or denatured under the harsh conditions in the GI tract, especially in the acidic environment of the stomach. A common strategy to overcome this problem is to encapsulate the enzymes in stomach-resistant material in order to deliver them safely to the intestine. This approach is unfortunately not suitable for celiac disease treatment because in order to prevent the inflammation in the small intestine the gluten peptides need to be degraded in the upper part of the GI tract, for which the enzyme needs to retain its activity in the stomach. In light of this, celiac disease constitutes a challenging platform for which to develop an oral adjuvant therapy. The attachment of polymers to proteins is a very common approach to improve the physicochemical and biological properties of biomacromolecular drugs used in the treatment of a variety of pathological conditions (Figure 5.1). For example, the subcutaneous injection of a phenylalanine-degrading enzyme could potentially treat phenylketonuria, a disease caused by impaired activity of phenylalanine hydroxylase leading to neurocognitive dysfunction.240 In order to reduce its immunogenicity the enzyme was PEGylated, reaching clinical trial Phase II as rAvPAL–PEG.241 Moreover, the PEGylation of interferon α-2a in the formulation PEGASYS® increased the protein’s half-life upon subcutaneous administration, enabling it to reach the market as an effective treatment for chronic hepatitis C in adults.242 Most biomacromolecular drugs so far described consist of 85 Chapter 5: Conclusion &Outlook injectable formulations of therapeutic proteins on which random polymer conjugation has been performed. However, introducing random modifications in therapeutic proteins can wane their biological activity and also compromise the formulation’s homogeneity. Although other conjugation and protection strategies exist, they have received substantially less attention.210 In this regard the site-specific attachment of polymeric molecules to engineered residues of proteins offers a very promising alternative strategy. Despite being considerably more laborious, this strategy preserves the proteins’ catalytic activity upon modification and was therefore selected to stabilize the gluten-degrading PEPs enzymes in the GI tract.243,244 Figure 5.1. Positive effects of polymer conjugation on therapeutic proteins. 86 Chapter 5: Conclusion &Outlook In Chapter 3 two PEPs, MX and SC, were engineered to strategically place cysteine residues on the surface of the enzymes.245 In both cases a library of singly, doubly and triply mutated variants was designed and expressed. Thereby, this protein engineering had different impacts on the two PEP variants. In the case of SC, all three rounds of mutagenesis resulted in activity loss. It was therefore not possible to create a catalytically active SC mutant with three available cysteines on different sites of the surface (which would have allowed covering most of the enzyme’s surface by polymer conjugation). The causes for the activity loss upon mutagenesis remain unclear, but the data indicated that the activity drop was not related to the modification of a specific amino acid or to one particular site of SC. However, the unique catalytic processes of PEPs involve immense motions that could be partially driven by surface residues. On the contrary, the mutagenesis of MX was very successful and two threefold cysteine-mutants that retained the activity of MX WT were produced. These two constructs (MX3.1 and MX3.2) offered three conjugation sites each that enabled full coverage of the enzymes’ surfaces upon polymer attachment, maximizing the degree of shielding from the harsh conditions in the GI tract (Figure 5.2a). To this end, only MX mutants were coupled to polymers and analyzed in terms of enzymatic activity and stability under physiological conditions. In Chapter 4, the single cysteine-mutated MXs were first conjugated to linear PEG of two different molecular weights (5 and 40 kDa). Whereas the mono-conjugation of PEG5 did not affect the activity of the mutant MXs, the single attachment of PEG40 partially decreased their activity. To better understand the effect of PEGylation conjugation on MX’s functionality, the PEGs were coupled to the doubly mutated variants. The constructs were less active than MX WT, but interestingly no difference was observed between the PEG5 or PEG40 conjugates. This indicated that the amount of conjugated PEG (determined by polymer length or number of polymer chains attached) plateaued above a certain threshold. Similarly, the conjugation of the PEGs to the three-fold cysteine-mutated MXs followed the same trend, showing no difference in activity between the PEG5 and PEG40 bioconjugates (Figure 5.2a). 87 Chapter 5: Conclusion &Outlook Figure 5.2. Summary of main findings of this doctoral thesis. a) MX was engineered and two variants (MX3.1 (red) and MX3.2 (blue)) with three cysteine residues on the surface were produced and analyzed for their catalytic activity. b) The two variants were conjugated to linear PEG (5 and 40 kDa) and PAMAM (G3) with terminal amino groups, and tested for their activity in comparison to that of MX WT. c) The polymer conjugates of MX3.1 were analyzed in vivo. The bioconjugates were orally administered to rats together with a quenched substrate. The fluorescent signal generated upon substrate cleavage was measured during 4 h; the images show the fluorescence 2 h after treatment administration. However, given that the catalytic activity of the triply PEGylated MX3.1 was substantially superior to that of MX3.2 conjugates, the importance of the conjugation sites was demonstrated (Figure 5.2a, b). Thereafter, the polycationic dendrimer PAMAM (6.9 kDa) was attached to MX3.1 and MX3.2. Dendrimers offer advantages over “traditional” polymers in terms of their precise structure and size, biocompatibility, aqueous solubility and versatility given by adaptable terminal functional groups. PAMAM can thus generally serve as a stability, solubility and/or cellular uptake enhancer.226 Although PAMAM–drug conjugates have been tested for a variety of applications,246 the use of this dendrimer on enzyme stabilization, especially when orally applied, has been barely investigated. Herein, the triple PAMAM conjugation to MX3.1 led to full WT activity whereas MX3.2 showed 88 Chapter 5: Conclusion &Outlook considerable activity loss, similarly to the PEGylated counterparts (Figure 5.2a, b). The fact that full WT activity was retained with MX3.1–PAMAM (in contrast to some activity loss with the PEGylated mutant) indicated that the dendrimer had no impact on the dynamics and catalytic processes of MX when attached at these specific conjugation sites, which could be attributed to the dendrimer’s rigidity. To further understand the impact of polymer conjugation, the best mutant MX3.1 was randomly conjugated to PEG5 via surface-exposed lysine residues. Thereby, it was found that higher grafting densities of the polymer further aggravated activity loss, which emphasized the importance of controlling the conjugation site for enzymatic activity preservation. Thereafter, the randomly PEG5-conjugated MX3.1s were successfully sitespecifically conjugated to three additional PAMAM dendrimers, indicating that the PEG5 chains only poorly covered the surface of the enzyme. No additional activity loss was observed upon PAMAM addition, highlighting once more the great value of the three conjugation sites of MX3.1 and the importance of polymer structure. The best candidates, namely the site-specifically polymer-conjugated MX3.1, were then tested in vivo. The enzyme and conjugates were orally applied to rats by gavage, followed by a model substrate consisting of a cleavable gluten-specific sequence and a dyequencher system. Upon enzymatic cleavage the substrate’s dye is de-quenched, emitting a fluorescent signal that can be detected through the rats’ abdomens. As expected, for control MX WT and MX3.1, no signal was detected due to the fast deactivation of the unprotected enzymes in the GI tract. MX3.1–PEG5 gave a small signal but was not statistically significant compared to MX WT (Figure 5.2c). In contrast, the administration of MX3.1– PEG40 increased the fluorescence signal significantly, showing that the longer PEG chains better shielded MX from the harsh conditions in the GI tract. In the case of PAMAM, its conjugate stabilized the enzyme to an extent comparable to that of PEG40 despite having a hydrodynamic volume smaller than that of PEG5. To further confirm that the attached PEG40 and PAMAM durably stabilized the enzymes, the corresponding MX3.1 conjugates were orally applied and incubated in the digestive tract for 1 or 2 h before administering the substrate. In both cases full in vivo activity was observed, demonstrating that PEG40 as well as PAMAM protected MX efficiently in the GI tract over longer periods of time. 89 Chapter 5: Conclusion &Outlook As described in Chapter 1, some enzymatic formulations for the oral treatment of celiac disease have successfully reached clinical trials.86,90 Such studies will determine whether any of these formulations are safe and efficient enough to reach the market. Because insufficient in vivo stability leading to poor efficacy is a common pitfall at which many promising formulations fail, strategies like polymer conjugation to enhance in vivo activity need to be developed. To this end, our conjugates offer a promising approach and may be considered as therapeutic candidates for celiac disease. Tremendous effort has so far been put into the characterization of the MX conjugates and a crucial next step to demonstrate their clinical relevance will be to test their ability to prevent intestinal inflammation upon gluten ingestion. Celiac disease rodent models have been established247 and could be used to test the efficacy of the bioconjugates and further evaluate the potential of the protected vs. unprotected delivery of MX. Moreover, costs and scale-up challenges need to be determined, which might be best estimated after comparison with similar methods such as the random polymer conjugation of proteins. Finding a suitable bioconjugate for each individual disease with the presented approach is more costly and time-consuming as it implies engineering the enzyme, producing the respective conjugates and then screening the generated library. The production of the enzyme itself will be equally required for the modified and the native variant. The conjugation reaction can be very similar in the two strategies; although in some cases a two-step reaction might be necessary if the polymer is coupled to thiol groups for instance (like the PAMAM conjugation presented in this work), which would ultimately increase production costs. However, once a potent candidate is identified, the advantage of site-specific conjugation over randomly attached polymers is conclusive. When polymers are randomly attached to proteins a heterogeneous mixture is generally produced due to the accessibility of numerous residues of the same kind. This not only leads to poor reproducibility and difficult characterization of the conjugate but also complicates the purification of the bioconjugates into a single defined product. In contrast, site-specific polymer attachment enables to produce a much more homogenous product and only the excess of polymer in the reaction mixture needs to be removed in order to produce a pure product. Moreover, another advantage of the site-specific strategy is that it usually renders bioconjugates with higher activity. Thereby, less material would need to be administered to patients to achieve the same effect, leading 90 Chapter 5: Conclusion &Outlook to reduced production costs and an improved formulation’s safety profile which would be vastly preferable in view of a potential translation to the clinic. The strategy presented herein may be also applicable to the protection of other orally applied therapeutic enzymes. Lactose intolerance is a very prominent example, currently treated with an orally administered enzyme. In spite of the enzymatic drug’s widespread use, its deactivation in the GI tract leads to reduced efficiency.248 To address this issue random PEGylation was performed on the enzyme, which despite leading to enhanced stability at acidic pH in vitro, it did not reach clinical relevance.249 Based on what was shown in this work, the site-specific polymer conjugation of the enzyme could offer a more efficient approach to tackle the deactivation in vivo. Moreover, attaching polymers sitespecifically might also help to develop therapeutics for other diseases treatable with orally applied enzymes, such as other food intolerances, exocrine pancreatic insufficiency or phenylketonuria.203 Given that protein-based medicines have become increasingly important in pharmaceutical research and that oral administration is largely preferred among patients, the site-specific polymer conjugation to proteins could be of interest to many medical areas. Polymer conjugation has been previously performed on various biomolecules not only to increase the stability in the GI tract but also to enhance drug bioavailability (Figure 5.1).226 However, when the therapeutic target of the orally applied protein is not in the GI tract itself but is located systemically, the challenges become even more complex. The multiple barriers faced by this approach include the administration of a sufficiently stable biomolecule to the intestine, its effective absorption through the mucosa, the first-pass effect, and in some cases also the release of the drug at the desired location in an active form. Increasing the bioavailability of orally administered biologics is particularly difficult as the absorption mechanisms need to be altered and this can in turn be associated with side effects such as damage of the mucosa, chronic disruption of junctions and intestinal inflammation.95,250 The great effort to tackle the hurdles of orally applied drugs with a systemic target is shown on the intense research performed on the oral delivery of insulin, which despite episodical preclinical and clinical encouraging data is still not available as an oral therapeutic treatment.251 The formulation of PEGylated insulin reached even clinical trial Phase III (IN-105) but failed due to insufficient efficacy.251 Thus, oral drug formulations may not be suitable or available for some diseases, but in the cases where it is, polymer conjugation can contribute effectively to the improvement of 91 Chapter 5: Conclusion &Outlook biopharmaceuticals.226 Additionally, other application routes could benefit from this strategy because therapeutic proteins need to be stabilized in most biological environments. Thereby, polymer conjugation does not only serve to protect proteins from degradation, but offers also other positive effects such as preventing the drug’s aggregation, decreasing its immunogenicity, enhancing its solubility or increasing its hydrodynamic volume to prolong the plasma half-life due to reduced kidney clearance (Figure 5.1).252 Due to the simplicity of random conjugation, this strategy has prevailed and has led to the approval of some therapeutic bioconjugates (PEG-conjugated mainly).223 Thus, old formulations could be optimized and new potential therapeutic proteins developed by attaching polymers sitespecifically. The strategy developed in this work could help to overcome the drawbacks presented by established methods, giving rise to a new generation of therapeutic bioconjugates. 92 Chapter 6 Appendix Chapter 6: Appendix a MX WT: ATGGGCAGCA ATGTCCTACC GCGGACCCGT GCGCAGAACG GCGCGCTTCA CGCTTCTTCT GGGGAGAGCG GTGTCCCTGG CCCAACGCCG AAGGTGGACG GGCTTCTATT TACACCACCA GAGCGCACCG CTGTTCGTCT GAGAAGGACT AAGGACCGCT GATCCGGCGA TCCCTGCTGT ACGTCCGAGG GGCGTGGGCG TTCACGTCCT GAGCTCTGGG TTCTACGCGT AAGCGTGACG GAGGCCAACT GCCAACCTGC AAGAAGCAGA TACACGCAGC GCGGCCATGA GACATGGTGC GCGGAGAAGC CCGGACGTGC CCCATGCACG GCCCTGCTGC ATTGAGTCCA CAGGGTGGGG CACCAC GCCATCATCA CGGCGACCCG ATCGCTGGCT CGCACGCCCG AGGAGCTGTT ACGTCCGCAC GGCAGGAGAA GGACGTGGGC CGGATGAGGC TCATCGAGGG ACGAGTGGCT TCCGCTACCA GCGACCCGAC ACATCCTCCG TCCGCCTGCT TCTACGTCCT AGCCGGCCCG CCGTCAGCAT TGCGCGTGGC CGGCGTCCAA TCACCACGCC CCAAGGTGGA CCAAGGACGG GCAACGCGCC TCCGCTCGAG GCGGCGGCGG ACGTCTTCGA CCAAGCGGCT CGCAGCGGCC GCTACCACCT CCGAGGACTT GCTACCCCGC CCCGCAAGTT GCATCGAGGC GCGTGGACCT TGGCGGCGCA TCATCATCAC GGCGGAGCAG CGAGGACGAG CGAAGCGCTG CTACACCGAC CCACAAGGAC GGTGCTGTTG CGTGTCCTGG GGTGCTGCAC CGGCAAGTAC GCCCACGGAC CACGCTGGGC GACGTTCCTC CGGCTGGAGC GGTGAAGGGC CACCGACGAG CGCGTCGTGG CGTCGGCGGG CACGCTGAAG CCTGATGGGG CCGTCAAATC CGTGCCCATG GACGAAGGTG CACGCTGCTC CATCCTGCCC CGAGTACGGC CGACTTCCAC GGCCATCTAC GGAGCTGTAC CTTCGGCAGC CAAGACGCTG GCTGCTGATG CGTGGCGGCG CAACGCGGGC GTATTCGTTC GGGCCGCAAG AGCAGCGGCC GTTGTCGACA AAGGCCCCCG GCGAAGTTCC TCCGTCTCCA AAGGAGAAGG GATCCGAACG GACGGCAAGA GTCATCGACG GCCACGCCCA CCGTCCATCA ACGGAGCCGT CAGAGCGACC GAGAACGACG GTGGGCGCCA GGCGCCCCGC AAGGAGATTG CACCTGTCGC GGCAAGCCGG CTGGAGGACC TACAAGACGT AACCCGGAGC CCCATGTTCG TACGGCTACG TGGCTGGACG AAGGCCTGGC GCGGCGGCCG GGCGGCAGCA GGCGCGGTGG GGCCGGACCT CACGCCTACT ATGGCGGCGG GTGCAGAACT CACGGTGGCG CTGTTCCAAG CTTGCGGCCG TGGTGCCGCG CGTTGCACGG AGGTCCAGAC CCGGCCGTGA CCCCGTCGCG CCATCCTCTA GCTGGAGCAA AGGTGGCCTT TGGACTCTGG AGTGGACGCC AGGTGGACGA CGAAGGACAC TGAGCCGCGA TCTACTGGAA AGTACGAGGT GCCAGCGCGT TCCCCGAGGA TGGAGTACCT TGCGCACGGT TGGATGACGC CCGTCAGCAC AGTACCAGGT TGGTGCACCG GCGGCTTCAA CGGGCGGCGT ACGACGCCGG AGTACTTGGT ACGGCGGCCT TGTGCGCGGT GGATTCCGGA CGCCCTACCA ACCACGACGA CGCCCGGAAA CGGATCAGGT TCCTGGATGT CACTCGAGCA Figure A1a. Deoxyribonucleic acid (DNA) sequence of MX WT. 95 CGGCAGCCAT CGTCCAGGTA GTGGATGACG GGCCCTGGCC CCGCAACGGG CTGGCGCCAG GGACGGCACC CGCCCAGAAG CGAGTGGTCC CGACAGCAAG GCGCCCCGGC CGTGGTGCAC CGGCAAGTAC GCGGCCGGGT GCACGCCTGG CTTCGAGGTG CTCGTCCGCG CAAGGACGCG GCAGCTGCCG CTACTACGTC CGGGAAGTCT CGAGCAGGTC CAAGGACCTG CGTGAACATG GTACGCGGTG CCGCCTGGAC CCAGCAGAAG GCTGGTGGGC GCCCCTGCTG GTACGGCACG CCACGTGCGG CCGGGTGGAC CCCGGCGACG GGCCAAGGCC CCAGGGGGCA CCACCACCAC Chapter 6: Appendix b MX3.1: S123C, S338C, K461C ATGGGCAGCA ATGTCCTACC GCGGACCCGT GCGCAGAACG GCGCGCTTCA CGCTTCTTCT GGGGAGTGTG GTGTCCCTGG CCCAACGCCG AAGGTGGACG GGCTTCTATT TACACCACCA GAGCGCACCG CTGTTCGTCT GAGAAGGACT AAGGACCGCT GATCCGGCGA TCCCTGCTGT ACGTCCGAGG GGCGTGGGCG TTCACGTCCT GAGCTCTGGG TTCTACGCGT TGTCGTGACG GAGGCCAACT GCCAACCTGC AAGAAGCAGA TACACGCAGC GCGGCCATGA GACATGGTGC GCGGAGAAGC CCGGACGTGC CCCATGCACG GCCCTGCTGC ATTGAGTCCA CAGGGTGGGG CACCAC GCCATCATCA CGGCGACCCG ATCGCTGGCT CGCACGCCCG AGGAGCTGTT ACGTCCGCAC GGCAGGAGAA GGACGTGGGC CGGATGAGGC TCATCGAGGG ACGAGTGGCT TCCGCTACCA GCGACCCGAC ACATCCTCCG TCCGCCTGCT TCTACGTCCT AGCCGGCCCG CCGTCAGCAT TGCGCGTGGC CGGCGTCCAA TCACCACGCC CCAAGGTGGA CCAAGGACGG GCAACGCGCC TCCGCTCGAG GCGGCGGCGG ACGTCTTCGA CCAAGCGGCT CGCAGCGGCC GCTACCACCT CCGAGGACTT GCTACCCCGC CCCGCAAGTT GCATCGAGGC GCGTGGACCT TGGCGGCGCA TCATCATCAC GGCGGAGCAG CGAGGACGAG CGAAGCGCTG CTACACCGAC CCACAAGGAC GGTGCTGTTG CGTGTCCTGG GGTGCTGCAC CGGCAAGTAC GCCCACGGAC CACGCTGGGC GACGTTCCTC CGGCTGGAGC GGTGAAGGGC CACCGACGAG CGCGTCGTGG CGTCGGCGGG CACGCTGAAG CCTGATGGGG CCGTCAAATC CGTGCCCATG GACGAAGGTG CACGCTGCTC CATCCTGCCC CGAGTACGGC CGACTTCCAC GGCCATCTAC GGAGCTGTAC CTTCGGCAGC CAAGACGCTG GCTGCTGATG CGTGGCGGCG CAACGCGGGC GTATTCGTTC GGGCCGCAAG AGCAGCGGCC GTTGTCGACA AAGGCCCCCG GCGAAGTTCC TCCGTCTCCA AAGGAGAAGG GATCCGAACG GACGGCAAGA GTCATCGACG GCCACGCCCA CCGTCCATCA ACGGAGCCGT CAGAGCGACC GAGAACGACG GTGGGCGCCA GGCGCCCCGC AAGGAGATTG CACCTGTCGC GGCAAGCCGG CTGGAGGACC TACAAGACGT AACCCGGAGC CCCATGTTCG TACGGCTACG TGGCTGGACG AAGGCCTGGC GCGGCGGCCG GGCGGCAGCA GGCGCGGTGG GGCCGGACCT CACGCCTACT ATGGCGGCGG GTGCAGAACT CACGGTGGCG CTGTTCCAAG CTTGCGGCCG TGGTGCCGCG CGTTGCACGG AGGTCCAGAC CCGGCCGTGA CCCCGTCGCG CCATCCTCTA GCTGGAGCAA AGGTGGCCTT TGGACTCTGG AGTGGACGCC AGGTGGACGA CGAAGGACAC TGAGCCGCGA TCTACTGGAA AGTACGAGGT GCCAGCGCGT TCCCCGAGGA TGGAGTACCT TGCGCACGGT TGGATGACGC CCGTCAGCAC AGTACCAGGT TGGTGCACCG GCGGCTTCAA CGGGCGGCGT ACGACGCCGG AGTACTTGGT ACGGCGGCCT TGTGCGCGGT GGATTCCGGA CGCCCTACCA ACCACGACGA CGCCCGGAAA CGGATCAGGT TCCTGGATGT CACTCGAGCA CGGCAGCCAT CGTCCAGGTA GTGGATGACG GGCCCTGGCC CCGCAACGGG CTGGCGCCAG GGACGGCACC CGCCCAGAAG CGAGTGGTCC CGACAGCAAG GCGCCCCGGC CGTGGTGCAC CGGCAAGTAC GCGGCCGGGT GCACGCCTGG CTTCGAGGTG CTGTTCCGCG CAAGGACGCG GCAGCTGCCG CTACTACGTC CGGGAAGTCT CGAGCAGGTC CAAGGACCTG CGTGAACATG GTACGCGGTG CCGCCTGGAC CCAGCAGAAG GCTGGTGGGC GCCCCTGCTG GTACGGCACG CCACGTGCGG CCGGGTGGAC CCCGGCGACG GGCCAAGGCC CCAGGGGGCA CCACCACCAC Figure A1b. DNA sequence of MX3.1 containing three cysteine mutations. Mutations are highlighted in color. The labeling of the mutations includes the original amino acid, the location in the amino acid sequence and the mutated residue. 96 Chapter 6: Appendix c MX3.2: A25C, A328C, T417C ATGGGCAGCA ATGTCCTACC GCGGACCCGT GCGCAGAACG GCGCGCTTCA CGCTTCTTCT GGGGAGAGCG GTGTCCCTGG CCCAACGCCG AAGGTGGACG GGCTTCTATT TACACCACCA GAGCGCACCG CTGTTCGTCT GAGAAGGACT AAGGACCGCT GATCCGTGTA TCCCTGCTGT ACGTCCGAGG GGCGTGGGCG TTCACGTCCT GAGCTCTGGG TTCTACGCGT AAGCGTGACG GAGGCCAACT GCCAACCTGC AAGAAGCAGA TACACGCAGC GCGGCCATGA GACATGGTGC GCGGAGAAGC CCGGACGTGC CCCATGCACG GCCCTGCTGC ATTGAGTCCA CAGGGTGGGG CACCAC GCCATCATCA CGTGTACCCG ATCGCTGGCT CGCACGCCCG AGGAGCTGTT ACGTCCGCAC GGCAGGAGAA GGACGTGGGC CGGATGAGGC TCATCGAGGG ACGAGTGGCT TCCGCTACCA GCGACCCGAC ACATCCTCCG TCCGCCTGCT TCTACGTCCT AGCCGGCCCG CCGTCAGCAT TGCGCGTGGC CGGCGTCCAA TCACCACGCC CCAAGGTGGA CCAAGGACGG GCAACGCGCC TCCGCTCGAG GCGGCGGCGG ACGTCTTCGA CCAAGCGGCT CGCAGCGGCC GCTACCACCT CCGAGGACTT GCTACCCCGC CCCGCAAGTT GCATCGAGGC GCGTGGACCT TGGCGGCGCA TCATCATCAC GGCGGAGCAG CGAGGACGAG CGAAGCGCTG CTACACCGAC CCACAAGGAC GGTGCTGTTG CGTGTCCTGG GGTGCTGCAC CGGCAAGTAC GCCCACGGAC CACGCTGGGC GACGTTCCTC CGGCTGGAGC GGTGAAGGGC CACCGACGAG CGCGTCGTGG CGTCGGCGGG CACGCTGAAG CCTGATGGGG CCGTCAAATC CGTGCCCATG GACGAAGGTG CACGCTGCTC CATCCTGCCC CGAGTACGGC CGACTTCCAC GGCCATCTAC GGAGCTGTAC CTTCGGCAGC CAAGACGCTG GCTGCTGATG CGTGGCGGCG CAACGCGGGC GTATTCGTTC GGGCCGCAAG AGCAGCGGCC GTTGTCGACA AAGGCCCCCG GCGAAGTTCC TCCGTCTCCA AAGGAGAAGG GATCCGAACG GACGGCAAGA GTCATCGACG GCCACGCCCA CCGTCCATCA ACGGAGCCGT CAGAGCGACC GAGAACGACG GTGGGCGCCA GGCGCCCCGC AAGGAGATTG CACCTGTCGC GGCAAGCCGG CTGGAGGACC TACAAGACGT AACCCGGAGC CCCATGTTCG TACGGCTACG TGGCTGGACG AAGGCCTGGC GCGGCGGCCG GGCGGCAGCA GGCGCGGTGG GGCCGGACCT CACGCCTACT ATGGCGGCGG GTGCAGAACT CACGGTGGCG CTGTTCCAAG CTTGCGGCCG TGGTGCCGCG CGTTGCACGG AGGTCCAGAC CCGGCCGTGA CCCCGTCGCG CCATCCTCTA GCTGGAGCAA AGGTGGCCTT TGGACTCTGG AGTGGACGCC AGGTGGACGA CGAAGGACAC TGAGCCGCGA TCTACTGGAA AGTACGAGGT GCCAGCGCGT TCCCCGAGGA TGGAGTACCT TGCGCACGGT TGGATGACGC CCGTCAGCTG AGTACCAGGT TGGTGCACCG GCGGCTTCAA CGGGCGGCGT ACGACGCCGG AGTACTTGGT ACGGCGGCCT TGTGCGCGGT GGATTCCGGA CGCCCTACCA ACCACGACGA CGCCCGGAAA CGGATCAGGT TCCTGGATGT CACTCGAGCA CGGCAGCCAT CGTCCAGGTA GTGGATGACG GGCCCTGGCC CCGCAACGGG CTGGCGCCAG GGACGGCACC CGCCCAGAAG CGAGTGGTCC CGACAGCAAG GCGCCCCGGC CGTGGTGCAC CGGCAAGTAC GCGGCCGGGT GCACGCCTGG CTTCGAGGTG CTCGTCCGCG CAAGGACGCG GCAGCTGCCG CTACTACGTC TGGGAAGTCT CGAGCAGGTC CAAGGACCTG CGTGAACATG GTACGCGGTG CCGCCTGGAC CCAGCAGAAG GCTGGTGGGC GCCCCTGCTG GTACGGCACG CCACGTGCGG CCGGGTGGAC CCCGGCGACG GGCCAAGGCC CCAGGGGGCA CCACCACCAC Figure A1c. DNA sequence of MX3.2 containing three cysteine mutations. Mutations are highlighted in color. 97 Chapter 6: Appendix a MX WT: MGSSHHHHHH AQNAHAREAL GESGQEKVLL KVDVIEGGKY ERTGDPTTFL KDRFYVLTDE TSEVRVATLK ELWAKVDVPM EANFRSSILP YTQPKRLAIY AEKPEDFKTL ALLRIEANAG HH SSGLVPRGSH AKFPGREALA DPNGWSKDGT ATPKWTPDSK QSDLSRDGKY GAPRQRVFEV GKPVRTVQLP NPEQYQVEQV WLDAGGVYAV GGSNGGLLVG HAYSPYHHVR HGGADQVAKA MSYPATRAEQ ARFKELFYTD VSLGTWAVSW GFYYEWLPTD LFVYILRGWS DPAKPARASW GVGAASNLMG FYASKDGTKV ANLRGGGEYG AAMTQRPELY PDVRYPALLM IESSVDLYSF VVDTLHGVQV SVSTPSRRNG DGKKVAFAQK PSIKVDERPG ENDVYWKRPG KEIVPEDSSA LEDLDDAYYV PMFVVHRKDL KAWHDAGRLD GAVVCAVPLL MAADHDDRVD LFQVLDVQGA ADPYRWLEDE RFFYVRTHKD PNAADEAVLH YTTIRYHTLG EKDFRLLVKG SLLSVSIVGG FTSFTTPRQI KRDGNAPTLL KKQNVFDDFH DMVRYHLFGS PMHARKFVAA QGGVAAQGRK KAPEVQTWMT KEKAILYWRQ VIDVDSGEWS TEPSKDTVVH VGAKYEVHAW HLSLEYLKDA YKTSVSTGKS YGYGGFNVNM AAAEYLVQQK GRTWIPEYGT VQNSPGNPAT LAAALEHHHH VVDTLHGVQV SVSTPSRRNG DGKKVAFAQK PSIKVDERPG ENDVYWKRPG KEIVPEDCSA LEDLDDAYYV PMFVVHRKDL KAWHDAGRLD GAVVCAVPLL MAADHDDRVD LFQVLDVQGA ADPYRWLEDE RFFYVRTHKD PNAADEAVLH YTTIRYHTLG EKDFRLLVKG SLLSVSIVGG FTSFTTPRQI CRDGNAPTLL KKQNVFDDFH DMVRYHLFGS PMHARKFVAA QGGVAAQGRK KAPEVQTWMT KEKAILYWRQ VIDVDSGEWS TEPSKDTVVH VGAKYEVHAW HLSLEYLKDA YKTSVSTGKS YGYGGFNVNM AAAEYLVQQK GRTWIPEYGT VQNSPGNPAT LAAALEHHHH VVDTLHGVQV SVSTPSRRNG DGKKVAFAQK PSIKVDERPG ENDVYWKRPG KEIVPEDSSA LEDLDDAYYV PMFVVHRKDL KAWHDAGRLD GAVVCAVPLL MAADHDDRVD LFQVLDVQGA ADPYRWLEDE RFFYVRTHKD PNAADEAVLH YTTIRYHTLG EKDFRLLVKG SLLSVSIVGG FTSFTTPRQI KRDGNAPTLL KKQNVFDDFH DMVRYHLFGS PMHARKFVAA QGGVAAQGRK KAPEVQTWMT KEKAILYWRQ VIDVDSGEWS TEPSKDTVVH VGAKYEVHAW HLSLEYLKDA YKTSVSCGKS YGYGGFNVNM AAAEYLVQQK GRTWIPEYGT VQNSPGNPAT LAAALEHHHH b MX3.1: S123C, S338C, K461C MGSSHHHHHH AQNAHAREAL GECGQEKVLL KVDVIEGGKY ERTGDPTTFL KDRFYVLTDE TSEVRVATLK ELWAKVDVPM EANFRSSILP YTQPKRLAIY AEKPEDFKTL ALLRIEANAG HH SSGLVPRGSH AKFPGREALA DPNGWSKDGT ATPKWTPDSK QSDLSRDGKY GAPRQRVFEV GKPVRTVQLP NPEQYQVEQV WLDAGGVYAV GGSNGGLLVG HAYSPYHHVR HGGADQVAKA MSYPATRAEQ ARFKELFYTD VSLGTWAVSW GFYYEWLPTD LFVYILRGWS DPAKPARASW GVGAASNLMG FYASKDGTKV ANLRGGGEYG AAMTQRPELY PDVRYPALLM IESSVDLYSF c MX3.2: A25C, A328C, T417C MGSSHHHHHH AQNAHAREAL GESGQEKVLL KVDVIEGGKY ERTGDPTTFL KDRFYVLTDE TSEVRVATLK ELWAKVDVPM EANFRSSILP YTQPKRLAIY AEKPEDFKTL ALLRIEANAG HH SSGLVPRGSH AKFPGREALA DPNGWSKDGT ATPKWTPDSK QSDLSRDGKY GAPRQRVFEV GKPVRTVQLP NPEQYQVEQV WLDAGGVYAV GGSNGGLLVG HAYSPYHHVR HGGADQVAKA MSYPCTRAEQ ARFKELFYTD VSLGTWAVSW GFYYEWLPTD LFVYILRGWS DPCKPARASW GVGAASNLMG FYASKDGTKV ANLRGGGEYG AAMTQRPELY PDVRYPALLM IESSVDLYSF Figure A2. Amino acid sequence of a) MX WT and the two variants, b) MX3.1 and c) MX3.2 containing three cysteine mutations. Mutations are highlighted in color. 98 Chapter 6: Appendix a SC WT: ATGAAGAACC TTTGCCCAGA CCCGCCAGCC TGGCGCTGGC CAAAGCGCCT CGGATGAAGG GTCTTCTACA GATGCGCCGG GGCGCCACTG GTGCAGGATG CCGCTGGCCG GCGCTGCTCT TATAACCAGA TTCGCGACGC TGGGTGGTGA GTCACCAACG GATTTCGTCG AAGAAGATCG GAAAGCAAGG ATCCACGATG GTCAGCCTGC GCCTATCTCT ACGGCGAAAA GTGGAGCAGG CGCAAGGATG GCGCTTACCC GCCCTGGCAA CGCGACAAGA AATGGCGTGA ATCGGCGCGG GTGATGGACA GGCTATCCCG GTGCGTTCGG GTCGTGCCGG AAGCCGCACC AAGCAGATCG CCGCGCCCCC GCTTGTGGCT CGCCGCCCAC CGCAAGTGCC TGGAAGCCGA ATACCGCAGC CGCTGATCGA GCTGGAACAG TGGGCACCAA CGCTCGATGC GCGGTTCGGA ACGAACTCAA ATTCCCGCTT CGGTGTGGCT CCGAGCTGCC TCACCAGCAG GCAAGATTGG ATGGCGTGGG TGCGGGTCGA ACAACCTCGA CCAAGAGCCA CCGGCATCGG CGTTCAGCAG CCACCCCGTG TGTTCTATCC CCAAGGGCCC CATGGTTTTC ACCTACGCGG AGCAGAACGT CGCCGCGCCA TGACCAACCA TGCTGCGCTT AAAAGGAAGC GCGTGGACTA GGCACAGCTT TGATCCGCAT AGGAAACCGC TCGAGCACCA GGCCATGGCC CCTTGCCAAG GCTGGTGGAG NGTGCGCACC CTATCTCAAG TTACGAACGG CNGCTTGATG GGGACGGGTA CTGGGCGGCA TTGGCGGACG NTGGGTGAAG TGCCGAGCCA CCACCGCCTG CAAGCGCGGC CGAGGGCACC GCCGGTTACC CGATCAGCTG TCTGTCGGGC ATCCGTCGGC GGTCCTGGCG CAGCGCCTCG CTTTACCCAG GGAGCCGGTG CAGCAANGAC GCTGCCCACG CGCCGGTTTC CGGCGGCGAA CTTCGACGAT CGGCCTGGCG GCGGCCCGAT CGACCAGTTC CGATTGGCGC TCCGGCCATC CAAATATACT CGAGACGCGC CGATGTGCAG CCACCACCAC GCCCCGCTTG GACCAGGCCA GACCATTTCG GATGCCAAGG CAGTTGCCCG TTTGGCCTGC AACCAGTCGC CTGCTCGATC TCNGATGACG GTGAAGTTTG TTTTCCGGCC AAGGAAGGCC GGCACGCCGC CACGGCGCCA GATCCGGTCA GCACTGATCC TGGTTCGTGT TGTACGCCGC ATTGCCGGCA TTCGATCTTG GGCCTGAGCG CCTGCCACGG CACCTGACGT GGCACCAAGG CTGCTCTATG ATGACCTGGA TATGGCGATG TTCATTGCCG ATCGAGGGTG CTGTTTGCGG ACCGCCGGGC GTGCTGCGCC CTGNTGACCA GCGGCGCTGC GCCGGCCATG GCGTTTCTGG CAC CGCTTGCCAC TGCCGTCACT GTGAAAAGGT TGGCGGCCTG AGCGTTGTGC CGCAGCGCCG AGCTGCTGGT CCAATACCTG GGCGCCTGCT TCGGCGTGGC TGGCCTGGCT AGGCCTTCCA AAAGCGCCGA GCGTTTCGAG ACACCGTGCA CCGATCTCAA CGGGCGATGG GCTTCGATAC ACCGCCTGTT ATGGCAAGCC GCCGGCCCGG TGCTGGCGCT TCGATCCGGC TGCCGATGTT GCTATGGCGG TCGACAGCGG CGTGGCACGA CGGGCGAATG GCTCCAACGG CGGCCAGCCC GCTATTGGGT GCTATTCGCC CGGCCGACAC AGACCGCCGC GTTCGGGCAA CCCATTTCAC CCCGGTTGCG GCCGCCCTAT GTCCGATCCC GGTCCAGGCG GCTGGAAAAG TGGCGCTTCG GCGCCCTGCC GGCCAAGGAT GGCCTATTCG CGACGGCAAG GGGCAACGAT GGCGCTGAAC TCAGCCGGTG CGATGGGCGC CGTTGCGCGC GGCGCAATGG CGCCCCGCTC CGTGGTGCCC CGCCAGCTAT GGCCGGTGCG CGATCGCCAT CGATCCCGCC CGATTTCCGG CATCGTGCGC CTTCAATGTG CGGCGCCTTT TGCCGGCCGG GCTGATCTGT TGGCCTGCTG TGCCGTGGGC GGATGACTAT CTATCACAAC CGACGATCGC GATCGGGCCC GCCGATCGAC CGGGCTGACG Figure A3a. DNA sequence of SC WT. The two start codons are highlighted in blue. 99 Chapter 6: Appendix b SC3.1: A96C, S351C, A560C ATGAAGAACC TTTGCCCAGA CCCGCCAGCC TGGCGCTGGC CAAAGCGCCT CGGATGAAGG GTCTTCTACA GATGCGCCGG GGCGCCACTG GTGCAGGATG CCGCTGGCCG GCGCTGCTCT TATAACCAGA TTCGCGACGC TGGGTGGTGA GTCACCAACG GATTTCGTCG AAGAAGATCG GAAAGCAAGG ATCCACGATG GTCAGCCTGC GCCTATCTCT ACGGCGAAAA GTGGAGCAGG CGCAAGGATG GCGCTTACCC GCCCTGGCAA CGCGACAAGA AATGGCGTGA ATCGGCGCGG GTGATGGACA GGCTATCCCG GTGCGTTCGG GTCGTGCCGG AAGCCGCACC AAGCAGATCG CCGCGCCCCC GCTTGTGGCT CGCCGCCCAC CGCAAGTGCC TGGAAGCCGA ATACCGCAGC CGCTGATCGA GCTGGAACAG TGGGCACCAA CGCTCGATGC GCGGTTCGGA ACGAACTCAA ATTCCCGCTT CGGTGTGGCT CCGAGCTGCC TCACCAGCAG GCAAGATTGG ATGGCGTGGG TGCGGGTCGA ACAACCTCGA CCAAGAGCCA CCGGCATCGG CGTTCAGCAG CCACCCCGTG TGTTCTATCC CCAAGGGCCC CATGGTTTTC ACCTACGCGG AGCAGAACGT CGCCGCGCCA TGACCAACCA TGCTGCGCTT AAAAGGAAGC GCGTGGACTA GGCACAGCTT TGATCCGCAT AGGAAACCGC TCGAGCACCA GGCCATGGCC CCTTGCCAAG GCTGGTGGAG CGTGCGCACC CTATCTCAAG TTACGAACGG CGGCTTGATG GGGACGGGTA CTGGGCGGCA TTGGCGGACG GTGGGTGAAG TGCCGAGCCA CCACCGCCTG CAAGCGCGGC CGAGGGCACC GCCGGTTACC CGATCAGCTG TCTGTCGGGC ATCCGTCGGC GGTCCTGGCG CAGCGCCTCG CTTTACCCAG GGAGCCGGTG CAGCAAGGAC GCTGCCCACG CGCCGGTTTC CGGCGGCGAA CTTCGACGAT CGGCCTGGCG GCGGCCCGAT CGACCAGTTC CGATTGGCGC TCCGGCCATC CAAATATACT CGAGACGCGC CGATGTGCAG CCACCACCAC GCCCCGCTTG GACCAGGCCA GACCATTTCG GATGCCAAGG CAGTTGCCCG TTTGGCCTGC AACCAGTCGC CTGCTCGATC TCGGATGACG GTGAAGTTTG TTTTCCGGCC AAGGAAGGCC GGCACGCCGC CACGGCGCCA GATCCGGTCA GCACTGATCC TGGTTCGTGT TGTACGCCGC ATTGCCGGCA TTCGATCTTG GGCCTGAGCG CCTGCCACGG CACCTGACGT GGCACCAAGG CTGCTCTATG ATGACCTGGA TATGGCGATG TTCATTGCCG ATCGAGGGTG CTGTTTGCGG ACCGCCGGGC GTGCTGCGCC CTGGTGACCA GCGGCGCTGC GCCGGCCATG GCGTTTCTGG CAC CGCTTGCCAC TGCCGTCACT GTGAAAAGGT TGGCGGCCTG AGCGTTGTGC CGCAGCGCCG AGCTGCTGGT CCAATACCTG GGCGCCTGCT TCGGCGTGGC TGGCCTGGCT AGGCCTTCCA AAAGCGCCGA GCGTTTCGAG ACACCGTGCA CCGATCTCAA CGGGCGATGG GCTTCGATAC ACCGCCTGTT ATGGCAAGCC GCCGGCCCGG TGCTGGCGCT TCGATCCGGC TGCCGATGTT GCTATGGCGG TCGACAGCGG CGTGGCACGA CGGGCGAATG GCTCCAACGG CGGCCAGCCC GCTATTGGGT GCTATTCGCC CGGCCGACAC AGACCGCCGC GTTCGGGCAA CCCATTTCAC CCCGGTTGCG GCCGCCCTAT GTCCGATCCC GGTCCAGGCG GCTGGAAAAG TGGCGCTTCG GCGCCCTGCC GGCCAAGGAT GGCCTATTCG CGACGGCAAG GGGCAACGAT GGCGCTGAAC TCAGCCGGTG CGATGGGCGC CGTTGCGCGC GGCGCAATGG CGCCCCGCTC CGTGGTGCCC CGCCAGCTAT GGCCGGTGCG CGATCGCCAT CGATCCCGCC CGATTTCCGG CATCGTGCGC CTTCAATGTG CGGCGCCTTT TGCCGGCCGG GCTGATCTGT TGGCCTGCTG TGCCGTGGGC GGATGACTAT CTATCACAAC CGACGATCGC GATCGGGCCC GCCGATCGAC CGGGCTGACG Figure A3b. DNA sequence of SC3.1 containing three cysteine mutations. Mutations are highlighted in color. 100 Chapter 6: Appendix c SC3.2: A351C, T441C, A560C ATGAAGAACC TTTGCCCAGA CCCGCCAGCC TGGCGCTGGC CAAAGCGCCT CGGATGAAGG GTCTTCTACA GATGCGCCGG GGCGCCACTG GTGCAGGATG CCGCTGGCCG GCGCTGCTCT TATAACCAGA TTCGCGACGC TGGGTGGTGA GTCACCAACG GATTTCGTCG AAGAAGATCG GAAAGCAAGG ATCCACGATG GTCAGCCTGC GCCTATCTCT TGTGCGAAAA GTGGAGCAGG CGCAAGGATG GCGCTTACCC GCCCTGGCAA CGCGACAAGA AATGGCGTGA ATCGGCGCGG GTGATGGACA GGCTATCCCG GTGCGTTCGG GTCGTGCCGG AAGCCGCACC AAGCAGATCG CCGCGCCCCC GCTTGTGGCT CGCCGCCCAC CGCAAGTGCC TGGAAGCCGA ATACCGCAGC CGCTGATCGA GCTGGAACAG TGGGCACCAA CGCTCGATGC GCGGTTCGGA ACGAACTCAA ATTCCCGCTT CGGTGTGGCT CCGAGCTGCC TCACCAGCAG GCAAGATTGG ATGGCGTGGG TGCGGGTCGA ACAACCTCGA CCAAGAGCCA CCGGCATCGG CGTTCAGCAG CCACCCCGTG TGTTCTATCC CCAAGGGCCC CATGGTTTTC ACCTACGCGG AGCAGAACGT CGCCGCGCCA TGACCAACCA TGCTGCGCTT AAAAGGAAGC GCGTGGACTA GGCACAGCTT TGATCCGCAT AGGAAACCGC TCGAGCACCA GGCCATGGCC CCTTGCCAAG GCTGGTGGAG CGTGCGCACC CTATCTCAAG TTACGAACGG CGGCTTGATG GGGACGGGTA CTGGGCGGCA TTGGCGGACG GTGGGTGAAG TGCCGAGCCA CCACCGCCTG CAAGCGCGGC CGAGGGCACC GCCGGTTACC CGATCAGCTG TCTGTCGGGC ATCCGTCGGC GGTCCTGGCG CAGCGCCTCG CTTTACCCAG GGAGCCGGTG CAGCAAGGAC GCTGCCCACG CGCCGGTTTC CGGCGGCGAA CTTCGACGAT CGGCCTGGCG GCGGCCCGAT CGACCAGTTC CGATTGGCGC TCCGGCCATC CAAATATACT CGAGACGCGC CGATGTGCAG CCACCACCAC GCCCCGCTTG GACCAGGCCA GACCATTTCG GATGCCAAGG CAGTTGCCCG TTTGGCCTGC AACCAGTCGC CTGCTCGATC TCGGATGACG GTGAAGTTTG TTTTCCGGCC AAGGAAGGCC GGCACGCCGC CACGGCGCCA GATCCGGTCA GCACTGATCC TGGTTCGTGT TGTACGCCGC ATTGCCGGCA TTCGATCTTG GGCCTGAGCG CCTGCCACGG CACCTGACGT GGCACCAAGG CTGCTCTATG ATGACCTGGA TATGGCGATG TTCATTGCCG ATCGAGGGTG CTGTTTGCGG ACCGCCGGGC GTGCTGCGCC CTGGTGACCA GCGGCGCTGC GCCGGCCATG GCGTTTCTGG CAC CGCTTGCCAC TGCCGTCACT GTGAAAAGGT TGGCGGCCTG AGCGTGCCGC CGCAGCGCCG AGCTGCTGGT CCAATACCTG GGCGCCTGCT TCGGCGTGGC TGGCCTGGCT AGGCCTTCCA AAAGCGCCGA GCGTTTCGAG ACACCGTGCA CCGATCTCAA CGGGCGATGG GCTTCGATAC ACCGCCTGTT ATGGCAAGCC GCCGGCCCGG TGCTGGCGCT TCGATCCGGC TGCCGATGTT GCTATGGCGG TCGACAGCGG CGTGGCACGA CGGGCGAATG GCTCCAACGG CGGCCAGCCC GCTATTGGGT GCTATTCGCC CGGCCGACAC AGACCGCCGC GTTCGGGCAA CCCATTTCAC CCCGGTTGCG GCCGCCCTAT GTCCGATCCC GGTCCAGGCG GCTGGAAAAG TGGCGCTTCG GCGCCCTGCC GGCCAAGGAT GGCCTATTCG CGACGGCAAG GGGCAACGAT GGCGCTGAAC TCAGCCGGTG CGATGGGCGC CGTTGCGCGC GGCGCAATGG CGCCCCGCTC CGTGGTGCCC CGCCAGCTAT GGCCGGTGCG CGATCGCCAT CGATCCCGCC CGATTTCCGG CATCGTGCGC CTTCAATGTG CGGCGCCTTT TGCCGGCCGG GCTGATCTGT TGGCCTGCTG TGCCGTGGGC GGATGACTAT CTATCACAAC CGACGATCGC GATCGGGCCC GCCGATCGAC CGGGCTGACG Figure A3c. DNA sequence of SC3.2 containing three cysteine mutations. Mutations are highlighted in color. 101 Chapter 6: Appendix a SC WT: MKNRLWLAMA WRWLEADVRT VFYSWNSGLM VQDGGSDWRT YNQTVWLHRL VTNGKIGPVT ESKDNLESVG AYLSFSSFTQ RKDAKGPLPT RDKKQNVFDD VMDMLRFDQF VVPGHSFKYT PRPLEHHHHH APLALATPVA DAKVAAWVQA NQSQLLVRPA VKFVGVADGK GTPQSADQPV ALIPDLKAQW IAGNRLFASY PATVLALDPA LLYGYGGFNV FIAAGEWLIA TAGRYWVDDY AALQTAAIGP H FAQTPPTLAK QSAYTAAYLK DAPVGTKGRV PLADELKWVK FATPELPKRG DFVDGVGDQL IHDAKSQVLA TAKTTPWEPV ALTPWFSAGF NGVTPRHGLA GYPEKEADWR KPHLIRIETR DQAMPSLPPY QLPERAALEK LLDPNTWAKD FSGLAWLGND HGASVSSDGR WFVSGDGAPL FDLDGKPAGA HLTFDPADFR MTWIDSGGAF IEGGSNGGLL VLRRYSPYHN AGHGSGKPID PASPQVPLVE RMKALIDYER GATALDAWAA ALLYSRFAEP WVVITSSEGT KKIVRVDLSG VSLPGIGSAS VEQVFYPSKD ALANLRGGGE IGAVTNQRPD VRSGVDYPAI KQIEETADVQ DHFGEKVSDP FGLPQRRGAS SDDGRLLAYS KEGQAFQALN DPVNTVHVAR STPRFDTVVP GLSGRPGDRH GTKVPMFIVR YGDAWHDAGR LFAAASPAVG LVTTADTDDR AFLAHFTGLT DQAMPSLPPY QLPERCALEK LLDPNTWAKD FSGLAWLGND HGASVSSDGR WFVSGDGAPL FDLDGKPAGA HLTFDPADFR MTWIDSGGAF IEGGSNGGLL VLRRYSPYHN AGHGSGKPID PASPQVPLVE RMKALIDYER GATALDAWAA ALLYSRFAEP WVVITSSEGT KKIVRVDLSG VSLPGIGSAS VEQVFYPSKD ALANLRGGGE IGAVTNQRPD VRSGVDYPAI KQIEETADVQ DHFGEKVSDP FGLPQRRGAS SDDGRLLAYS KEGQAFQALN DPVNTVHVAR CTPRFDTVVP GLSGRPGDRH GTKVPMFIVR YGDAWHDAGR LFAAASPAVG LVTTADTDDR AFLAHFTGLT DQAMPSLPPY QLPERAALEK LLDPNTWAKD FSGLAWLGND HGASVSSDGR WFVSGDGAPL FDLDGKPAGA HLTFDPADFR MTWIDSGGAF IEGGSNGGLL VLRRYSPYHN AGHGSGKPID PASPQVPLVE RMKALIDYER GATALDAWAA ALLYSRFAEP WVVITSSEGT KKIVRVDLSG VSLPGIGSAS VEQVFYPSKD ALANLRGGGE IGAVTNQRPD VRSGVDYPAI KQIEETADVQ DHFGEKVSDP FGLPQRRGAS SDDGRLLAYS KEGQAFQALN DPVNTVHVAR CTPRFDTVVP GLSGRPGDRH GTKVPMFIVR YGDAWHDAGR LFAAASPAVG LVTTADTDDR AFLAHFTGLT b SC3.1: A96C, S351C, A560C MKNRLWLAMA WRWLEADVRT VFYSWNSGLM VQDGGSDWRT YNQTVWLHRL VTNGKIGPVT ESKDNLESVG AYLSFSSFTQ RKDAKGPLPT RDKKQNVFDD VMDMLRFDQF VVPGHSFKYT PRPLEHHHHH APLALATPVA DAKVAAWVQA NQSQLLVRPA VKFVGVADGK GTPQSADQPV ALIPDLKAQW IAGNRLFASY PATVLALDPA LLYGYGGFNV FIAAGEWLIC TAGRYWVDDY AALQTAAIGP H FAQTPPTLAK QSAYTAAYLK DAPVGTKGRV PLADELKWVK FATPELPKRG DFVDGVGDQL IHDAKSQVLA TAKTTPWEPV ALTPWFSAGF NGVTPRHGLA GYPEKEADWR KPHLIRIETR c SC3.2: A351C, T441C, A560C MKNRLWLAMA WRWLEADVRT VFYSWNSGLM VQDGGSDWRT YNQTVWLHRL VTNGKIGPVT ESKDNLESVG AYLSFSSFTQ RKDAKGPLPT RDKKQNVFDD VMDMLRFDQF VVPGHSFKYT PRPLEHHHHH APLALATPVA DAKVAAWVQA NQSQLLVRPA VKFVGVADGK GTPQSADQPV ALIPDLKAQW IAGNRLFASY PATVLALDPA LLYGYGGFNV FIAAGEWLIC TAGRYWVDDY AALQTAAIGP H FAQTPPTLAK QSAYTAAYLK DAPVGTKGRV PLADELKWVK FATPELPKRG DFVDGVGDQL IHDAKSQVLA CAKTTPWEPV ALTPWFSAGF NGVTPRHGLA GYPEKEADWR KPHLIRIETR Figure A4. Amino acid sequence of a) SC WT and the two variants, b) SC3.1 and c) SC3.2 containing three cysteine mutations. Mutations are highlighted in color. 102 Chapter 6: Appendix 8 MX WT MX3.1 MX3.2 6 CD (mdeg) 4 2 0 -2 -4 -6 -8 200 220 240 Wavelength (nm) Figure A5. Circular dichroism (CD) spectra of MX WT, MX3.1 and MX3.2. Mean (n = 3). 103 Chapter 6: Appendix a b c Figure A6. 1H NMR spectra of a) sulfo-GMBS, b) GMBS-modified PAMAM G3, and c) PAMAM G3 (D2O, 400 MHz, Bruker Av-400). One intact maleimide per dendrimer was quantified. 104 Chapter 6: Appendix a b Figure A7. Analytical HPLC analysis of a) MX WT, PEG5 and MX3.1–PEG5 and b) MX WT, PEG40 and MX3.1–PEG40. 105 Chapter 6: Appendix a b Figure A8. Analytical HPLC analysis of a) GMBS, PAMAM and PAMAM–GMBS and b) MX WT, PAMAM and MX3.1–PAMAM. 106 Chapter 6: Appendix Figure A9. Enzymatic stability in simulated intestinal fluid: a) MX3.1 and MX3.1–polymer, b) MX3.2 and MX3.2–polymer, c) MX3.1–ran –PEG5–PAMAMs. While incubated with pancreases at pH 6.8, activity was assed at specific time point. The graphs show the fitting of the deactivation over time. Mean (n = 3). 107 Chapter 7 References Chapter 7: References 1. Creegan, R., Hunt, W., McManus, A. & Rainey-Smith, S. R. Diet, nutrients and metabolism: cogs in the wheel driving Alzheimer’s disease pathology? Br. J. Nutr. 113, 1499–517 (2015). 2. Wicki, A. & Hagmann, J. Diet and cancer. Swiss Med. Wkly. 141, w13250 (2011). 3. Newmark, H. L. et al. A Western-style diet induces benign and malignant neoplasms in the colon of normal C57Bl/6 mice. Carcinogenesis 22, 1871–75 (2001). 4. Anand, P. et al. Cancer is a preventable disease that requires major lifestyle changes. Pharm. Res. 25, 2097–116 (2008). 5. Nwaru, B. I. et al. Prevalence of common food allergies in Europe: A systematic review and meta-analysis. Eur. J. Allergy Clin. Immunol. 69, 992–1007 (2014). 6. De Filippo, C. et al. Impact of diet in shaping gut microbiota revealed by a comparative study in children from Europe and rural Africa. Proc. Natl. Acad. Sci. 107, 14691–96 (2010). 7. Turnbaugh, P. J. et al. The effect of Diet on the Human Gut Microbiom: A Metagenomic Analysis in Humanized Gnotobiotic Mice. Sci. Transl. Med. 1, 1–19 (2009). 8. Maslowski, K. M. & Mackay, C. R. Diet, gut microbiota and immune responses. Nat. Immunol. 12, 5–9 (2011). 9. Jandhyala, S. M. et al. Role of the normal gut microbiota. World J. Gastroenterol. 21, 8787– 803 (2015). 10. Turnbull, J. L., Adams, H. N. & Gorard, D. A. Review article: the diagnosis and management of food allergy and food intolerances. Aliment. Pharmacol. Ther. 41, 3–25 (2015). 11. World Health Organization. Global strategy for infant and young child feeding: The optimal duration of exclusive breastfeeding. Fifty-Fourth World Health Assembly (2001). 12. Umetsu, D. T., Rachid, R. & Schneider, L. C. Oral immunotherapy and anti-IgE antibody treatment for food allergy. World Allergy Organ. J. 8, 20 (2015). 13. Gujral, N., Freeman, H. J. & Thomson, A. B. R. Celiac disease: Prevalence, diagnosis, pathogenesis and treatment. World J. Gastroenterol. 18, 6036–59 (2012). 14. Molina-Infante, J., Santolaria, S., Sanders, D. S. & Fernández-Bañares, F. Systematic review: noncoeliac gluten sensitivity. Aliment. Pharmacol. Ther. 41, 807–20 (2015). 109 Chapter 7: References 15. Vesa, T. H., Marteau, P. & Korpela, R. Lactose Intolerance. J. Am. Coll. Nutr. 19, 165S– 75S (2000). 16. Maintz, L. & Novak, N. Histamine and histamine intolerance. Am. J. Clin. Nutr. 85, 1185– 96 (2007). 17. Ortolani, C. & Pastorello, E. A. Food allergies and food intolerances. Best Pract. Res. Clin. Gastroenterol. 20, 467–83 (2006). 18. Dørum, S., Qiao, S., Sollid, L. M. & Fleckenstein, B. A Quantitative Analysis of Transglutaminase 2-Mediated Deamidation of Gluten Peptides: Implications for the T-cell Response in Celiac Disease. J. Proteome Res. 8, 1748–55 (2009). 19. Fleckenstein, B. et al. Molecular characterization of covalent complexes between tissue transglutaminase and gliadin peptides. J. Biol. Chem. 279, 17607–16 (2004). 20. Tack, G. J., Verbeek, W. H. M., Schreurs, M. W. J. & Mulder, C. J. J. The spectrum of celiac disease: epidemiology, clinical aspects and treatment. Nat. Rev. Gastroenterol. Hepatol. 7, 204–13 (2010). 21. Koning, F., Schuppan, D., Cerf-Bensussan, N. & Sollid, L. M. Pathomechanisms in celiac disease. Best Pract. Res. Clin. Gastroenterol. 19, 373–87 (2005). 22. Elli, L. et al. Diagnosis of gluten related disorders: Celiac disease, wheat allergy and nonceliac gluten sensitivity. World J. Gastroenterol. 21, 7110–19 (2015). 23. Czaja-Bulsa, G. Non coeliac gluten sensitivity – A new disease with gluten intolerance. Clin. Nutr. 34, 189–94 (2015). 24. Kabbani, T. A. et al. Celiac disease or non-celiac gluten sensitivity? An approach to clinical differential diagnosis. Am. J. Gastroenterol. 109, 741–6 (2014). 25. Petersen, J. et al. Determinants of Gliadin-Specific T Cell Selection in Celiac Disease. J. Immunol. 194, 6112–22 (2015). 26. Petersen, J. et al. T-cell receptor recognition of HLA-DQ2-gliadin complexes associated with celiac disease. Nat. Struct. Mol. Biol. 21, 480–8 (2014). 27. Lionetti, E., Gatti, S., Pulvirenti, A. & Catassi, C. Celiac disease from a global perspective. Best Pract. Res. Clin. Gastroenterol. 29, 365–79 (2015). 110 Chapter 7: References 28. Norris, J. M. et al. Risk of celiac disease autoimmunity and timing of gluten introduction in the diet of infants at increased risk of disease. J. Am. Med. Assoc. 293, 2343–51 (2005). 29. Mearin, M. L. The prevention of coeliac disease. Best Pract. Res. Clin. Gastroenterol. 29, 493– 501 (2015). 30. Vriezinga, S. L. et al. Randomized Feeding Intervention in Infants at High Risk for Celiac Disease. N. Engl. J. Med. 371, 1304–15 (2014). 31. Lionetti, E. et al. Introduction of Gluten, HLA Status, and the Risk of Celiac Disease in Children. N. Engl. J. Med. 371, 1295–303 (2014). 32. Størdal, K., White, R. A. & Eggesbø, M. Early feeding and risk of celiac disease in a prospective birth cohort. Pediatrics 132, 1202–9 (2013). 33. Greenhill, C. Coeliac disease: Does age at introduction to gluten affect risk of coeliac disease? Nat. Rev. Gastroenterol. Hepatol. (2014). doi:10.1038/nrgastro.2014.176 34. Pinier, M., Fuhrmann, G., Verdu, E. F., Verdu, E. & Leroux, J.-C. Prevention measures and exploratory pharmacological treatments of celiac disease. Am. J. Gastroenterol. 105, 2551–61 (2010). 35. Lee, A. & Newman, J. M. Celiac diet: Its impact on quality of life. J. Am. Diet. Assoc. 103, 1533–5 (2003). 36. Chang, M. S. et al. Double-Blind Randomized Controlled Trial of Rifaximin for Persistent Symptoms in Patients with Celiac Disease. Dig. Dis. Sci. 56, 2939–46 (2011). 37. Evans, K. E., Leeds, J. S., Morley, S. & Sanders, D. S. Pancreatic Insufficiency in Adult Celiac Disease: Do Patients Require Long-Term Enzyme Supplementation? Dig. Dis. Sci. 55, 2999–3004 (2010). 38. Kaukinen, K., Lindfors, K. & Mäki, M. Advances in the treatment of coeliac disease: an immunopathogenic perspective. Nat. Rev. Gastroenterol. Hepatol. 11, 36–44 (2014). 39. Plugis, N. M. & Khosla, C. Therapeutic approaches for celiac disease. Best Pract. Res. Clin. Gastroenterol. 29, 503–21 (2015). 40. Lammers, K. M. et al. Gliadin Induces an Increase in Intestinal Permeability and Zonulin Release by Binding to the Chemokine Receptor CXCR3. Gastroenterology 135, 194–204 (2008). 111 Chapter 7: References 41. Drago, S. et al. Gliadin, zonulin and gut permeability: Effects on celiac and non-celiac intestinal mucosa and intestinal cell lines. Scand. J. Gastroenterol. 41, 408–19 (2006). 42. Clemente, M. G. et al. Early effects of gliadin on enterocyte intracellular signalling involved in intestinal barrier function. Gut 52, 218–23 (2003). 43. Paterson, B. M., Lammers, K. M., Arrieta, M. C., Fasano, A. & Meddings, J. B. The safety, tolerance, pharmacokinetic and pharmacodynamic effects of single doses of AT-1001 in coeliac disease subjects: a proof of concept study. Aliment. Pharmacol. Ther. 26, 757–66 (2007). 44. Leffler, D. A. et al. A Randomized, Double-Blind Study of Larazotide Acetate to Prevent the Activation of Celiac Disease During Gluten Challenge. Am. J. Gastroenterol. 107, 1554– 62 (2012). 45. Kelly, C. P. et al. Larazotide acetate in patients with coeliac disease undergoing a gluten challenge: A randomised placebo-controlled study. Aliment. Pharmacol. Ther. 37, 252–62 (2013). 46. Leffler, D. A. et al. Larazotide acetate for persistent symptoms of celiac disease despite a gluten-free diet: a randomized controlled trial. Gastroenterology 148, 1311–9 (2015). 47. Matysiak-Budnik, T. et al. Secretory IgA mediates retrotranscytosis of intact gliadin peptides via the transferrin receptor in celiac disease. J. Exp. Med. 205, 143–54 (2008). 48. Rauhavirta, T. et al. Epithelial transport and deamidation of gliadin peptides: a role for coeliac disease patient immunoglobulin A. Clin. Exp. Immunol. 164, 127–36 (2011). 49. Maiuri, L. et al. Association between innate response to gliadin and activation of pathogenic T cells in coeliac disease. Lancet 362, 30–7 (2003). 50. Yokoyama, S. et al. Antibody-mediated blockade of IL-15 reverses the autoimmune intestinal damage in transgenic mice that overexpress IL-15 in enterocytes. Proc. Natl. Acad. Sci. 106, 15849–54 (2009). 51. Sarra, M. et al. IL-15 positively regulates IL-21 production in celiac disease mucosa. Mucosal Immunol. 6, 244–55 (2013). 52. Xia, J. et al. Cyclic and dimeric gluten peptide analogues inhibiting DQ2-mediated antigen presentation in celiac disease. Bioorganic Med. Chem. 15, 6565–73 (2007). 53. Kapoerchan, V. V. et al. Design of azidoproline containing gluten peptides to suppress CD4+ T-cell responses associated with Celiac disease. Bioorganic Med. Chem. 16, 2053–62 112 Chapter 7: References (2008). 54. Salvati, V. M. et al. Recombinant human interleukin 10 suppresses gliadin dependent T cell activation in ex vivo cultured coeliac intestinal mucosa. Gut 54, 46–53 (2005). 55. Mulder, C. J., Wahab, P. J., Meijer, J. W. R. & Metselaar, E. A pilot study of recombinant human interleukin-10 in adults with refractory coeliac disease. Eur. J. Gastroenterol. Hepatol. 13, 1183–8 (2001). 56. Sollid, L. M. & Khosla, C. Novel Therapies for Coeliac Disease. J. Intern. Med. 296, 604–13 (2011). 57. Edwards, J. C. W. et al. Efficacy of B-cell-targeted therapy with rituximab in patients with rheumatoid arthritis. N. Engl. J. Med. 350, 2572–81 (2004). 58. Hauser, S. L. et al. B-cell depletion with rituximab in relapsing-remitting multiple sclerosis. N. Engl. J. Med. 358, 676–88 (2008). 59. Sollid, L. M., Molberg, Ø., McAdam, S. & Lundin, K. E. A. Autoantibodies in coeliac disease: tissue transglutaminase - guilt by association? Gut 41, 851–52 (1997). 60. Walters, M. J. et al. Characterization of CCX282-B, an orally bioavailable antagonist of the CCR9 chemokine receptor, for treatment of inflammatory bowel disease. J. Pharmacol. Exp. Ther. 335, 61–9 (2010). 61. Feagan, B. G. et al. Randomised clinical trial: vercirnon, an oral CCR9 antagonist, vs. placebo as induction therapy in active Crohn’s disease. Aliment. Pharmacol. Ther. 42, 1170– 81 (2015). 62. Keshav, S. et al. A Randomized Controlled Trial of the Efficacy and Safety of CCX282-B, an Orally-Administered Blocker of Chemokine Receptor CCR9, for Patients with Crohn’s Disease. PLoS One 8, 1–12 (2013). 63. Daveson, A. J. et al. Effect of hookworm infection on wheat challenge in celiac disease - a randomised double-blinded placebo controlled trial. PLoS One 6, e17366 (2011). 64. Croese, J. et al. Experimental hookworm infection and gluten microchallenge promote tolerance in celiac disease. J. Allergy Clin. Immunol. 135, 508–16 (2015). 65. Brown, G. J. et al. A Phase I Study to Determine Safety, Tolerability and Bioactivity of Nexvax2® in HLA DQ2+ Volunteers With Celiac Disease Following a Long-Term, Strict Gluten-Free Diet. AGA Abstr. S–437–S–438 (2011). doi:10.1016/S0016-5085(11)61794-0 113 Chapter 7: References 66. Pizzuti, D. et al. Lack of intestinal mucosal toxicity of Triticum monococcum in celiac disease patients. Scand. J. Gastroenterol. 41, 1305–11 (2006). 67. Zanini, B. et al. Search for atoxic cereals: a single blind, cross-over study on the safety of a single dose of Triticum monococcum, in patients with celiac disease. BMC Gastroenterol. 13, 92 (2013). 68. Zanini, B., Villanacci, V., De Leo, L. & Lanzini, A. Triticum monococcum in patients with celiac disease: a phase II open study on safety of prolonged daily administration. Eur. J. Nutr. 54, 1027–9 (2015). 69. Pinier, M. et al. Polymeric binders suppress gliadin-induced toxicity in the intestinal epithelium. Gastroenterology 136, 288–98 (2009). 70. McCarville, J. L. et al. BL-7010 Demonstrates Specific Binding to Gliadin and Reduces Gluten-Associated Pathology in a Chronic Mouse Model of Gliadin Sensitivity. PLoS One 9, e109972 (2014). 71. Pinier, M. et al. The copolymer P(HEMA-co-SS) binds gluten and reduces immune response in gluten-sensitized mice and human tissues. Gastroenterology 142, 316–25 (2012). 72. Gujral, N., Suh, J. W. & Sunwoo, H. H. Effect of anti-gliadin IgY antibody on epithelial intestinal integrity and inflammatory response induced by gliadin. BMC Immunol. 16, 41 (2015). 73. Verdu, E. F., Galipeau, H. J. & Jabri, B. Novel players in coeliac disease pathogenesis: role of the gut microbiota. Nat. Rev. Gastroenterol. Hepatol. 12, 497–506 (2015). 74. Cenit, M. C., Olivares, M., Codoñer-Franch, P. & Sanz, Y. Intestinal Microbiota and Celiac Disease: Cause, Consequence or Co-Evolution? Nutrients 7, 6900–23 (2015). 75. Laparra, J. M. & Sanz, Y. Bifidobacteria inhibit the inflammatory response induced by gliadins in intestinal epithelial cells via modifications of toxic peptide generation during digestion. J. Cell. Biochem. 109, 801–7 (2010). 76. Lindfors, K. et al. Live probiotic Bifidobacterium lactis bacteria inhibit the toxic effects induced by wheat gliadin in epithelial cell culture. Clin. Exp. Immunol. 152, 552–8 (2008). 77. Smecuol, E. et al. Exploratory, randomized, double-blind, placebo-controlled study on the effects of Bifidobacterium infantis natren life start strain super strain in active celiac disease. J. Clin. Gastroenterol. 47, 139–47 (2013). 78. Stepniak, D. et al. Highly efficient gluten degradation with a newly identified prolyl 114 Chapter 7: References endoprotease: implications for celiac disease. Am. J. Physiol. Gastrointest. Liver Physiol. 291, G621–9 (2006). 79. Gass, J., Ehren, J., Strohmeier, G., Isaacs, I. & Khosla, C. Fermentation, purification, formulation, and pharmacological evaluation of a prolyl endopeptidase from Myxococcus xanthus: implications for Celiac Sprue therapy. Biotechnol. Bioeng. 92, 674–84 (2005). 80. Gass, J. & Khosla, C. Prolyl endopeptidases. Cell. Mol. life Sci. 64, 345–55 (2007). 81. Shan, L., Marti, T., Sollid, L. M., Gray, G. M. & Khosla, C. Comparative biochemical analysis of three bacterial prolyl endopeptidases: implications for coeliac sprue. Biochem. J. 383, 311–8 (2004). 82. Shan, L., Mathews, I. I. & Khosla, C. Structural and mechanistic analysis of two prolyl endopeptidases: role of interdomain dynamics in catalysis and specificity. Proc. Natl. Acad. Sci. 102, 3599–604 (2005). 83. Bethune, M. T., Strop, P., Tang, Y., Sollid, L. M. & Khosla, C. Heterologous Expression, Purification, Refolding, and Structural-Functional Characterization of EP-B2, a SelfActivating Barley Cysteine Endoprotease. Chem. Biol. 13, 637–47 (2006). 84. Gass, J., Vora, H., Bethune, M. T., Gray, G. M. & Khosla, C. Effect of barley endoprotease EP-B2 on gluten digestion in the intact rat. J. Pharmacol. Exp. Ther. 318, 1178–86 (2006). 85. Tye-Din, J. A. et al. The effects of ALV003 pre-digestion of gluten on immune response and symptoms in celiac disease in vivo. Clin. Immunol. 134, 289–95 (2010). 86. Siegel, M. et al. Safety, Tolerability, and Activity of ALV003: Results from Two Phase 1 Single, Escalating-Dose Clinical Trials. Dig. Dis. Sci. 57, 440–50 (2012). 87. Lähdeaho, M.-L. et al. Glutenase ALV003 attenuates gluten-induced mucosal injury in patients with celiac disease. Gastroenterology 146, 1649–58 (2014). 88. Ehren, J. et al. A Food-Grade Enzyme Preparation with Modest Gluten Detoxification Properties. PLoS One 4, e6313 (2009). 89. Mitea, C. et al. Efficient degradation of gluten by a prolyl endoprotease in a gastrointestinal model: implications for coeliac disease. Gut 57, 25–32 (2008). 90. Salden, B. N. et al. Randomised clinical study: Aspergillus niger -derived enzyme digests gluten in the stomach of healthy volunteers. Aliment. Pharmacol. Ther. 42, 273–85 (2015). 115 Chapter 7: References 91. Wolf, C. et al. Engineering of Kuma030: A Gliadin Peptidase That Rapidly Degrades Immunogenic Gliadin Peptides in Gastric Conditions. J. Am. Chem. Soc. 137, 13106–13 (2015). 92. Gordon, S. R. et al. Computational Design of an α-Gliadin Peptidase. J. Am. Chem. Soc. 134, 20513–20 (2012). 93. Fuhrmann, G. et al. Sustained gastrointestinal activity of dendronized polymer-enzyme conjugates. Nat. Chem. 5, 582–9 (2013). 94. Choonara, B. F. et al. A review of advanced oral drug delivery technologies facilitating the protection and absorption of protein and peptide molecules. Biotechnol. Adv. 32, 1269–82 (2014). 95. Park, K., Kwon, I. C. & Park, K. Oral protein delivery: Current status and future prospect. React. Funct. Polym. 71, 280–7 (2011). 96. Deacon, M. P. et al. Atomic force microscopy of gastric mucin and chitosan mucoadhesive systems. Biochem. J. 348, 557–63 (2000). 97. Lehr, C.-M., Bouwstra, J. A., Schacht, E. H. & Junginger, H. E. In vitro evaluation of mucoadhesive properties of chitosan and some other natural polymers. Int. J. Pharm. 78, 43–8 (1992). 98. Lv, H., Zhang, S., Wang, B., Cui, S. & Yan, J. Toxicity of cationic lipids and cationic polymers in gene delivery. J. Control. Release 114, 100–9 (2006). 99. Kircheis, R. et al. Polycation-Based DNA Complexes for Tumor-Targeted Gene Delivery in vivo. J. Gene Med. 1, 111–20 (1999). 100. Xu, J., Strandman, S., Zhu, J. X. X., Barralet, J. & Cerruti, M. Genipin-crosslinked catechol-chitosan mucoadhesive hydrogels for buccal drug delivery. Biomaterials 37, 395– 404 (2014). 101. Luo, Y. & Wang, Q. Recent development of chitosan-based polyelectrolyte complexes with natural polysaccharides for drug delivery. Int. J. Biol. Macromol. 64, 353–67 (2014). 102. Khunawattanakul, W., Puttipipatkhachorn, S., Rades, T. & Pongjanyakul, T. Novel chitosan-magnesium aluminum silicate nanocomposite film coatings for modified-release tablets. Int. J. Pharm. 407, 132–41 (2011). 103. Sogias, I. A., Williams, A. C. & Khutoryanskiy, V. V. Chitosan-based mucoadhesive tablets for oral delivery of ibuprofen. Int. J. Pharm. 436, 602–10 (2012). 116 Chapter 7: References 104. Imperiale, J. C., Nejamkin, P., Del Sole, M. J., E Lanusse, C. & Sosnik, A. Novel protease inhibitor-loaded Nanoparticle-in-Microparticle Delivery System leads to a dramatic improvement of the oral pharmacokinetics in dogs. Biomaterials 37C, 383–94 (2014). 105. Song, L., Zhi, Z. & Pickup, J. C. Nanolayer encapsulation of insulin- chitosan complexes improves efficiency of oral insulin delivery. Int. J. Nanomedicine 9, 2127–36 (2014). 106. Rinaudo, M. Chitin and chitosan: Properties and applications. Prog. Polym. Sci. 31, 603–32 (2006). 107. Varum, K. M., Ottoy, M. H. & Smidsrod, O. Water-solubility of partially N-acetylated chitosans as a function of pH: effect of chemical composition and depolymerisation. Carbohydr. Polym. 25, 65–70 (1994). 108. Schipper, N. G. M., Vårum, K. M. & Artursson, P. Chitosans as Absorption Enhancers for Poorly Absorbable Drugs. 1: Influence of Molecular Weight and Degree of Acetylation on Drug Transport Across Human Intestinal Epithelial (Caco-2) Cells. Pharm. Res. 13, 1686–92 (1996). 109. Kim, S.-K., Park, P.-J., Yang, H.-P. & Han, S.-S. Subacute Toxicity of Chitosan Oligosaccharide in Sprague-Dawley Rats. Arzneimittelforschung 51, 769– 74 (2001). 110. Chen, M.-C. et al. Recent advances in chitosan-based nanoparticles for oral delivery of macromolecules. Adv. Drug Deliv. Rev. 65, 865–79 (2013). 111. Thanou, M., Verhoef, J. C. & Junginger, H. E. Oral drug absorption enhancement by chitosan and its derivatives. Adv. Drug Deliv. Rev. 52, 117–26 (2001). 112. Artursson, P., Lindmark, T., Davis, S. S. & Illum, L. Effect of Chitosan on the Permeability of Monolayers of Intestinal Epithelial Cells (Caco-2). Pharm. Res. 11, 1358–61 (1994). 113. Kotzé, A. F. et al. Comparison of the effect of different chitosan salts and N-trimethyl chitosan chloride on the permeability of intestinal epithelial cells (Caco-2). J. Control. Release 51, 35–46 (1998). 114. Schipper, N. G. M. et al. Chitosans as absorption enhancers of poorly absorbable drugs. 3: Influence of mucus on absorption enhancement. Eur. J. Pharm. Sci. 8, 335–43 (1999). 115. Schipper, N. G. M. et al. Chitosans as Absorption Enhancers for Poorly Absorbable Drugs 2: Mechanism of Absorption Enhancement. Pharm. Res. 14, 923–9 (1997). 117 Chapter 7: References 116. Dodane, V., Khan, A. M. & Merwin, J. R. Effect of chitosan on epithelial permeability and structure. Int. J. Pharm. 182, 21–32 (1999). 117. Kotzé, A. F. et al. Chitosans for enhanced delivery of therapeutic peptides across intestinal epithelia: in vitro evaluation in Caco-2 cell monolayers. Int. J. Pharm. 159, 243–53 (1997). 118. Lueβen, H. L. et al. Mucoadhesive polymers in peroral peptide drug delivery. I. Influence of mucoadhesive excipients on the proteolytic activity of intestinal enzymes. Eur. J. Pharm. Sci. 4, 117–28 (1996). 119. Lueβen, H. L. et al. Mucoadhesive polymers in peroral peptide drug delivery. IV. Polycarbophil and chitosan are potent enhancers of peptide transport across intestinal mucosae in vitro. J. Control. Release 45, 15–23 (1997). 120. Kotzé, A. F. et al. N-Trimethyl Chitosan Chloride as a Potential Absorption Enhancer Across Mucosal Surfaces: In Vitro Evaluation in Intestinal Epithelial Cells (Caco-2). Pharm. Res. 14, 1197–202 (1997). 121. Biswas, S., Chattopadhyay, M., Sen, K. K., Saha, M. K. & Maji, H. S. Structure-Toxicity Relationship of Chemically Modified Chitosan as an Oral Protein Drug Delivery Carrier. J. Pharm. Sci. Pharmacol. 1, 131–40 (2014). 122. Thanou, M. M. et al. Effect of degree of quaternization of N-trimethyl chitosan chloride for enhanced transport of hydrophilic compounds across intestinal Caco-2 cell monolayers. J. Control. Release 64, 15–25 (2000). 123. Thanou, M., Florea, B. I., Langemeÿer, M. W., Verhoef, J. C. & Junginger, H. E. Ntrimethylated chitosan chloride (TMC) improves the intestinal permeation of the peptide drug buserelin in vitro (Caco-2 cells) and in vivo (rats). Pharm. Res. 17, 27–31 (2000). 124. Tomalia, D. A. et al. A New Class of Polymers: Starburst-Dendritic Macromolecules. Polym. J. 17, 117–32 (1984). 125. Tomalia, D. A., Naylor, A. M. & Goddard, W. A. Starburst Dendrimers: Molecular-Level Control of Size, Shape, Surface Chemistry, Topology, and Flexibility from Atoms to Macroscopic Matter. Angew. Chemie 29, 138–75 (1990). 126. Wiwattanapatapee, R., Carreno-Gomez, B., Malik, N. & Duncan, R. PAMAM dendrimers as a potential oral drug delivery system: uptake by everted rat intestinal sacs in-vitro. J. Pharmacol. Pharmacother. 50, 99 (1998). 127. Kitchens, K. M., Foraker, A. B., Kolhatkar, R. B., Swaan, P. W. & Ghandehari, H. Endocytosis and Interaction of Poly (Amidoamine) Dendrimers with Caco-2 Cells. Pharm. Res. 24, 2138–45 (2007). 118 Chapter 7: References 128. Greish, K. et al. Size and surface charge significantly influence the toxicity of silica and dendritic nanoparticles. Nanotoxicology 6, 713–23 (2012). 129. Thiagarajan, G., Greish, K. & Ghandehari, H. Charge affects the oral toxicity of poly(amidoamine) dendrimers. Eur. J. Pharm. Biopharm. 84, 330–4 (2013). 130. El-Sayed, M., Rhodes, C. A., Ginski, M. & Ghandehari, H. Transport mechanism(s) of poly (amidoamine) dendrimers across Caco-2 cell monolayers. Int. J. Pharm. 265, 151–7 (2003). 131. Kitchens, K. M., Kolhatkar, R. B., Swaan, P. W., Eddington, N. D. & Ghandehari, H. Transport of Poly(Amidoamine) Dendrimers across Caco-2 Cell Monolayers: Influence of Size, Charge and Fluorescent Labeling. Pharm. Res. 23, 2818–26 (2006). 132. Jevprasesphant, R., Penny, J., Attwood, D., McKeown, N. B. & D`Emanuele, A. Engineering of Dendrimer Surfaces to Enhance Transepithelial Transport and Reduce Cytotoxicity. Pharm. Res. 20, 1543–50 (2003). 133. Lin, Y. et al. Polyamidoamine dendrimers as novel potential absorption enhancers for improving the small intestinal absorption of poorly absorbable drugs in rats. J. Control. Release 149, 21–8 (2011). 134. Shukla, S. C., Singh, A., Pandey, A. K. & Mishra, A. Review on production and medical applications of ɛ -polylysine. Biochem. Eng. J. 65, 70–81 (2012). 135. Ekrami, H. M. & Shen, W.-C. Carbamylation Decreases the Cytotoxicity but not the Drug-Carrier Properties of Polylysines. J. Drug Target. 2, 469–75 (1995). 136. Ranaldi, G., Marigliano, I., Vespignani, I., Perozzi, G. & Sambuy, Y. The effect of chitosan and other polycations on tight junction permeability in the human intestinal Caco-2 cell line. J. Nutr. Biochem. 13, 157–67 (2002). 137. McEwan, G. T. A., Jepson, M. A., Hirst, B. H. & Simmons, N. L. Polycation-induced enhancement of epithelial paracellular permeability is independent of tight junctional characteristics. Biochim. Biophys. Acta 1148, 51–60 (1993). 138. Peterson, M. W. & Gruenhaupt, D. Protamine increases the permeability of cultured epithelial monolayers. J. Appl. Physiol. 68, 220–7 (1990). 139. Kim, G. M., Bae, Y. H. & Jo, W. H. pH-induced micelle formation of poly(histidine-cophenylalanine)-block-poly(ethylene glycol) in aqueous media. Macromol. Biosci. 5, 1118–24 (2005). 119 Chapter 7: References 140. Köping-Höggård, M. et al. Chitosan as a nonviral gene delivery system. Structure-property relationships and characteristics compared with polyethylenimine in vitro and after lung administration in vivo. Gene Ther. 8, 1108–21 (2001). 141. Nielsen, E. J. B. et al. In vivo proof of concept of oral insulin delivery based on a coadministration strategy with the cell-penetrating peptide penetratin. J. Control. Release 189, 19–24 (2014). 142. Ma, Z., Lim, T. M. & Lim, L.-Y. Pharmacological activity of peroral chitosan-insulin nanoparticles in diabetic rats. Int. J. Pharm. 293, 271–80 (2005). 143. Pan, Y. et al. Bioadhesive polysaccharide in protein delivery system: chitosan nanoparticles improve the intestinal absorption of insulin in vivo. Int. J. Pharm. 249, 139–47 (2002). 144. Soliman, G. M., Zhang, Y. L., Merle, G., Cerruti, M. & Barralet, J. Hydrocaffeic acidchitosan nanoparticles with enhanced stability, mucoadhesion and permeation properties. Eur. J. Pharm. Biopharm. 88, 1026–37 (2014). 145. Vijayanathan, V., Thomas, T. & Thomas, T. J. DNA Nanoparticles and Development of DNA Delivery Vehicles for Gene Therapy. Biochemistry 41, 14085–94 (2002). 146. Albrecht, K. & Bernkop-Schnürch, A. Thiomers: forms, functions and applications to nanomedicine. Nanomedicine 2, 41–50 (2007). 147. van der Lubben, I. M., Verhoef, J. C., van Aelst, A. C., Borchard, G. & Junginger, H. E. Chitosan microparticles for oral vaccination: preparation, characterization and preliminary in vivo uptake studies in murine Peyer’s patches. Biomaterials 22, 687–94 (2001). 148. Koppolu, B. P. et al. Controlling chitosan-based encapsulation for protein and vaccine delivery. Biomaterials 35, 4382–9 (2014). 149. Clark, M. A., Jepson, M. A. & Hirst, B. H. Exploiting M cells for drug and vaccine delivery. Adv. Drug Deliv. Rev. 50, 81–106 (2001). 150. Maclaughlin, F. C. et al. Chitosan and depolymerized chitosan oligomers as condensing carriers for in vivo plasmid delivery. J. Control. Release 56, 259–72 (1998). 151. Yin, L. et al. Drug permeability and mucoadhesion properties of thiolated trimethyl chitosan nanoparticles in oral insulin delivery. Biomaterials 30, 5691–700 (2009). 152. Makhlof, A., Tozuka, Y. & Takeuchi, H. Design and evaluation of novel pH-sensitive 120 Chapter 7: References chitosan nanoparticles for oral insulin delivery. Eur. J. Pharm. Sci. 42, 445–51 (2011). 153. Sonia, T. A., Rekha, M. R. & Sharma, C. P. Bioadhesive Hydrophobic Chitosan Microparticles for Oral Delivery of Insulin: In Vitro Characterization and In Vivo Uptake Studies. J. Appl. Polym. Sci. 119, 2902–10 (2010). 154. Bonengel, S. & Bernkop-Schnürch, A. Thiomers - From bench to market. J. Control. Release 195, 120–9 (2014). 155. Bernkop-Schnürch, A., Hornof, M. & Guggi, D. Thiolated chitosans. Eur. J. Pharm. Biopharm. 57, 9–17 (2004). 156. Föger, F., Schmitz, T. & Bernkop-Schnürch, A. In vivo evaluation of an oral delivery system for P-gp substrates based on thiolated chitosan. Biomaterials 27, 4250–5 (2006). 157. Perera, G., Zipser, M., Bonengel, S., Salvenmoser, W. & Bernkop-Schnürch, A. Development of phosphorylated nanoparticles as zeta potential inverting systems. Eur. J. Pharm. Biopharm. 97, 250–6 (2015). 158. Neutra, M. R., Mantis, N. J. & Kraehenbuhl, J.-P. Collaboration of epithelial cells with organized mucosal lymphoid tissues. Nat. Immunol. 2, 1004–9 (2001). 159. Eldridge, J. H. et al. Controlled Vaccine Release In The Gut-Associated Lymphoid Tissues. I. Orally Administered Biodegradable Microspheres Target The Peyer’s Patches. J. Control. Release 11, 205–14 (1990). 160. van der Lubben, I. M., Konings, F. A. J., Borchard, G., Verhoef, J. C. & Junginger, H. E. In Vivo Uptake of Chitosan Microparticles by Murine Peyer’s Patches: Visualization Studies using Confocal Laser Scanning Microscopy and Immunohistochemistry. J. Drug Target. 9, 39–47 (2001). 161. Roy, K., Mao, H.-Q., Huang, S.-K. & Leong, K. W. Oral gene delivery with chitosanDNA nanoparticles generates immunologic protection in a murine model of peanut allergy. Nat. Med. 5, 387–91 (1999). 162. Agnihotri, S. A., Mallikarjuna, N. N. & Aminabhavi, T. M. Recent advances on chitosanbased micro- and nanoparticles in drug delivery. J. Control. Release 100, 5–28 (2004). 163. Chen, J. et al. Transfection of mEpo gene to intestinal epithelium in vivo mediated by oral delivery of chitosan-DNA nanoparticles. World J. Gastroenterol. 10, 112–6 (2004). 164. Bohl, B. D., Salvetti, A., Moullier, P. & Heard, J. M. Control of Erythropoietin Delivery by Doxycycline in Mice After Intramuscular Injection of Adeno-Associated Vector. Blood 92, 121 Chapter 7: References 1512–7 (2015). 165. Bowman, K., Sarkar, R., Raut, S. & Leong, K. W. Gene transfer to hemophilia A mice via oral delivery of FVIII-chitosan nanoparticles. J. Control. Release 132, 252–9 (2008). 166. Chew, J. L., Wolfowicz, C. B., Mao, H.-Q., Leong, K. W. & Chua, K. Y. Chitosan nanoparticles containing plasmid DNA encoding house dust mite allergen, Der p 1 for oral vaccination in mice. Vaccine 21, 2720–9 (2003). 167. Bivas-Benita, M. et al. Generation of Toxoplasma gondii GRA1 protein and DNA vaccine loaded chitosan particles: preparation, characterization, and preliminary in vivo studies. Int. J. Pharm. 266, 17–27 (2003). 168. Negash, T., Liman, M. & Rautenschlein, S. Mucosal application of cationic poly(D,Llactide-co-glycolide) microparticles as carriers of DNA vaccine and adjuvants to protect chickens against infectious bursal disease. Vaccine 31, 3656–62 (2013). 169. Danhier, F. et al. PLGA-based nanoparticles: an overview of biomedical applications. J. Control. Release 161, 505–22 (2012). 170. Boussif, O. et al. A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: Polyethylenimine. Proc. Natl. Acad. Sci. 92, 7297–301 (1995). 171. Forbes, D. C. & Peppas, N. A. Oral delivery of small RNA and DNA. J. Control. Release 162, 438–45 (2012). 172. Scholz, C. & Wagner, E. Therapeutic plasmid DNA versus siRNA delivery: common and different tasks for synthetic carriers. J. Control. Release 161, 554–65 (2012). 173. He, C., Yin, L., Tang, C. & Yin, C. Trimethyl chitosan-cysteine nanoparticles for systemic delivery of TNF-α siRNA via oral and intraperitoneal routes. Pharm. Res. 30, 2596–606 (2013). 174. Laroui, H. et al. Functional TNFα gene silencing mediated by polyethyleneimine/TNFα siRNA nanocomplexes in inflamed colon. Biomaterials 32, 1218–28 (2011). 175. Laroui, H. et al. Targeting intestinal inflammation with CD98 siRNA/PEI-loaded nanoparticles. Mol. Ther. 22, 69–80 (2014). 176. Landry, F. B., Bazile, D. V., Spenlehauer, G., Veillard, M. & Kreuter, J. Degradation of poly (D,L-lactic acid) nanoparticles coated with albumin in model digestive fluids (USP XXII). Biomaterials 17, 715–23 (1996). 122 Chapter 7: References 177. Yan, Y., Dalmasso, G., Sitaraman, S. & Merlin, D. Characterization of the human intestinal CD98 promoter and its regulation by interferon-gamma. Am. J. Physiol. Gastrointest. Liver Physiol. 292, G535–45 (2007). 178. Han, L., Tang, C. & Yin, C. Oral delivery of shRNA and siRNA via multifunctional polymeric nanoparticles for synergistic cancer therapy. Biomaterials 35, 4589–600 (2014). 179. Duncan, R. Polymer conjugates as anticancer nanomedicines. Nat. Rev. Cancer 6, 688–701 (2006). 180. Harde, H., Agrawal, A. K. & Jain, S. Tetanus toxoids loaded glucomannosylated chitosan based nanohoming vaccine adjuvant with improved oral stability and immunostimulatory response. Pharm. Res. 32, 122–34 (2015). 181. van der Lubben, I. M. et al. Chitosan microparticles for mucosal vaccination against diphtheria: oral and nasal efficacy studies in mice. Vaccine 21, 1400–8 (2003). 182. Mukhopadhyay, P., Sarkar, K., Bhattacharya, S., Mishra, R. & Kundu, P. P. Efficient oral insulin delivery by dendronized chitosan: in vitro and in vivo studies. RSC Adv. 4, 43890– 902 (2014). 183. Damgé, C., Michel, C., Aprahamian, M. & Couvreur, P. New Approach for Oral Administration of Insulin With Polyalkylcyanoacrylate Nanocapsules as Drug Carrier. Diabetes 37, 246–51 (1988). 184. Heinemann, L. & Jacques, Y. Oral insulin and buccal insulin: a critical reappraisal. J. Diabetes Sci. Technol. 3, 568–84 (2009). 185. Jain, N. K. & Gupta, U. Application of dendrimer-drug complexation in the enhancement of drug solubility and bioavailability. Expert Opin. Drug Metab. Toxicol. 4, 1035–52 (2008). 186. Ke, W., Zhao, Y., Huang, R., Jiang, C. & Pei, Y. Enhanced Oral Bioavailability of Doxorubicin in a Dendrimer Drug Delivery System. J. Pharm. Sci. 97, 2208–16 (2008). 187. Na, M. et al. Dendrimers as potential drug carriers. Part II. Prolonged delivery of ketoprofen by in vitro and in vivo studies. Eur. J. Med. Chem. 41, 670–4 (2006). 188. Kolharkar, R. B., Swaan, P. & Ghandehari, H. Potential Oral Delivery of 7-Ethyl-10Hydroxy-Camptothecin (SN-38) using Poly (amidoamine) Dendrimers. Pharm. Res. 25, 1723–9 (2009). 189. Prego, C. et al. Chitosan-PEG nanocapsules as new carriers for oral peptide delivery: Effect of chitosan pegylation degree. J. Control. Release 111, 299–308 (2006). 123 Chapter 7: References 190. Prego, C., García, M., Torres, D. & Alonso, M. J. Transmucosal macromolecular drug delivery. J. Control. Release 101, 151–62 (2005). 191. Ma, Q. et al. Oral Absorption Enhancement of Probucol by PEGylated G5 PAMAM Dendrimer Modi fi ed Nanoliposomes. Mol. Pharm. 12, 665–74 (2015). 192. Wiwattanapatapee, R., Lomlim, L. & Saramunee, K. Dendrimers conjugates for colonic delivery of 5-aminosalicylic acid. J. Control. Release 88, 1–9 (2003). 193. Najlah, M., Freeman, S., Attwood, D. & D’Emanuele, A. Synthesis, characterization and stability of dendrimer prodrugs. Int. J. Pharm. 308, 175–82 (2006). 194. Najlah, M., Freeman, S., Attwood, D. & D’Emanuele, A. In vitro evaluation of dendrimer prodrugs for oral drug delivery. Int. J. Pharm. 336, 183–90 (2007). 195. Najlah, M., Freeman, S., Attwood, D. & D’Emanuele, A. Synthesis and Assessment of First-Generation Polyamidoamine Dendrimer Prodrugs to Enhance the Cellular Permeability of P-gp Substrates. Bioconjug. Chem. 18, 937–46 (2007). 196. D’Emanuele, A., Jevprasesphant, R., Penny, J. & Attwood, D. The use of a dendrimerpropranolol prodrug to bypass efflux transporters and enhance oral bioavailability. J. Control. Release 95, 447–53 (2004). 197. Jevprasesphant, R. et al. The influence of surface modification on the cytotoxicity of PAMAM dendrimers. Int. J. Pharm. 252, 263–6 (2003). 198. Svenson, S. Dendrimers as versatile platform in drug delivery applications. Eur. J. Pharm. Biopharm. 71, 445–62 (2009). 199. Lee, E. et al. Conjugated chitosan as a novel platform for oral delivery of paclitaxel. J. Med. Chem. 51, 6442–9 (2008). 200. Lee, E., Kim, H., Lee, I.-H. & Jon, S. In vivo antitumor effects of chitosan-conjugated docetaxel after oral administration. J. Control. Release 140, 79–85 (2009). 201. Ahn, S. et al. Oral delivery of an anti-diabetic peptide drug via conjugation and complexation with low molecular weight chitosan. J. Control. Release 170, 226–32 (2013). 202. Lee, E., Lee, J. & Jon, S. A novel approach to oral delivery of insulin by conjugating with low molecular weight chitosan. Bioconjug. Chem. 21, 1720–3 (2010). 124 Chapter 7: References 203. Fuhrmann, G. & Leroux, J.-C. Improving the stability and activity of oral therapeutic enzymes-recent advances and perspectives. Pharm. Res. 31, 1099–105 (2014). 204. Matoori, S., Fuhrmann, G. & Leroux, J.-C. Celiac disease: a challenging disease for pharmaceutical scientists. Pharm. Res. 30, 619–26 (2013). 205. Kourist, R., Brundiek, H. & Bornscheuer, U. T. Protein engineering and discovery of lipases. Eur. J. Lipid Sci. Technol. 112, 64–74 (2010). 206. Leisola, M. & Turunen, O. Protein engineering: opportunities and challenges. Appl. Microbiol. Biotechnol. 75, 1225–32 (2007). 207. Preiswerk, N. et al. Impact of scaffold rigidity on the design and evolution of an artificial Diels-Alderase. Proc. Natl. Acad. Sci. 111, 8013–8 (2014). 208. Jiang, L. et al. De novo computational design of retro-aldol enzymes. Science 319, 1387–91 (2008). 209. Siegel, J. B. et al. Computational Design of an Enzyme Catalyst for a Stereoselective Bimolecular Diels-Alder Reaction. Science. 329, 309–13 (2010). 210. Rosendahl, M. S. et al. A long-acting, highly potent interferon alpha-2 conjugate created using site-specific PEGylation. Bioconjug. Chem. 16, 200–7 (2005). 211. Doherty, D. H. et al. Site-specific PEGylation of engineered cysteine analogues of recombinant human granulocyte-macrophage colony-stimulating factor. Bioconjug. Chem. 16, 1291–8 (2005). 212. Uchio, T., Baudyš, M., Liu, F., Song, S. C. & Kim, S. W. Site-specific insulin conjugates with enhanced stability and extended action profile. Adv. Drug Deliv. Rev. 35, 289–306 (1999). 213. de Graaf, A. J., Kooijman, M., Hennink, W. E. & Mastrobattista, E. Nonnatural amino acids for site-specific protein conjugation. Bioconjug. Chem. 20, 1281–95 (2009). 214. Zimmerman, E. S. et al. Production of site-specific antibody-drug conjugates using optimized non-natural amino acids in a cell-free expression system. Bioconjug. Chem. 25, 351–61 (2014). 215. Stevenazzi, A., Marchini, M., Sandrone, G., Vergani, B. & Lattanzio, M. Amino acidic scaffolds bearing unnatural side chains: An old idea generates new and versatile tools for the life sciences. Bioorg. Med. Chem. Lett. 24, 5349–56 (2014). 125 Chapter 7: References 216. Fuhrmann, G. & Leroux, J.-C. In vivo fluorescence imaging of exogenous enzyme activity in the gastrointestinal tract. Proc. Natl. Acad. Sci. 108, 9032–7 (2011). 217. Ehren, J., Govindarajan, S., Morón, B., Minshull, J. & Khosla, C. Protein engineering of improved prolyl endopeptidases for celiac sprue therapy. Protein Eng. Des. Sel. 21, 699–707 (2008). 218. Shen, B.-Q. et al. Conjugation site modulates the in vivo stability and therapeutic activity of antibody-drug conjugates. Nat. Biotechnol. 30, 184–9 (2012). 219. Gandhi, M., Jangi, M. & Goode, B. L. Functional Surfaces on the Actin-binding Protein Coronin Revealed by Systematic Mutagenesis. J. Biol. Chem. 285, 34899–908 (2010). 220. Leader, B., Baca, Q. J. & Golan, D. E. Protein therapeutics: a summary and pharmacological classification. Nat. Rev. Drug Discov. 7, 21–39 (2008). 221. Kontermann, R. E. Strategies for extended serum half-life of protein therapeutics. Curr. Opin. Biotechnol. 22, 868–76 (2011). 222. Liu, M., Johansen, P., Zabel, F., Leroux, J.-C. & Gauthier, M. A. Semi-permeable coatings fabricated from comb-polymers efficiently protect proteins in vivo. Nat. Commun. 5, 5526 (2014). 223. Alconcel, S. N. S., Baas, A. S. & Maynard, H. D. FDA-approved poly(ethylene glycol)– protein conjugate drugs. Polym. Chem. 2, 1442–8 (2011). 224. Robic, S. Pegylated glutenase polypeptides. Pat. Appl. WO2007047303 A2 (2009). 225. Gauthier, M. A. & Klok, H.-A. Polymer–protein conjugates: an enzymatic activity perspective. Polym. Chem. 1, 1352–73 (2010). 226. Schulz, J. D., Gauthier, M. A. & Leroux, J. Improving oral drug bioavailability with polycations? Eur. J. Pharm. Biopharm. 97, 427–37 (2015). 227. MacDonald, J. I., Munch, H. K., Moore, T. & Francis, M. B. One-step site-specific modification of native proteins with 2-pyridinecarboxyaldehydes. Nat. Chem. Biol. 11, 326– 31 (2015). 228. Shaunak, S. et al. Site-specific PEGylation of native disulfide bonds in therapeutic proteins. Nat. Chem. Biol. 2, 312–3 (2006). 229. Liu, M. et al. Molecular sieving on the surface of a protein provides protection without loss 126 Chapter 7: References of activity. Adv. Funct. Mater. 23, 2007–15 (2013). 230. Duncan, R. The dawning era of polymer therapeutics. Nat. Rev. Drug Discov. 2, 347–60 (2003). 231. Ding, Z., Chen, G. & Hoffman, A. S. Unusual properties of thermally sensitive oligomer – enzyme conjugates of poly(N-isopropylacrylamide)– trypsin. J. Biomed. Mater. Res. 39, 498– 505 (1998). 232. Chiu, K. et al. Effects of polymer molecular weight on the size, activity, and stability of PEG-functionalized trypsin. Biomacromolecules 11, 3688–92 (2010). 233. Armstrong, J. K., Wenby, R. B., Meiselman, H. J. & Fisher, T. C. The hydrodynamic radii of macromolecules and their effect on red blood cell aggregation. Biophys. J. 87, 4259–70 (2004). 234. Yang, C., Lu, D. & Liu, Z. How PEGylation enhances the stability and potency of insulin: A molecular dynamics simulation. Biochemistry 50, 2585–93 (2011). 235. Arakawa, T. & Timasheff, S. N. Mechanism of poly(ethylene glycol) interaction with proteins. Biochemistry 24, 6756–62 (1985). 236. Hartmann, L. & Börner, H. G. Precision polymers: monodisperse, monomer-sequencedefined segments to target future demands of polymers in medicine. Adv. Mater. 21, 3425– 31 (2009). 237. Ciolkowski, M., Rozanek, M., Bryszewska, M. & Klajnert, B. The influence of PAMAM dendrimers surface groups on their interaction with porcine pepsin. Biochim. Biophys. Acta 1834, 1982–7 (2013). 238. Sadekar, S. & Ghandehari, H. Transepithelial transport and toxicity of PAMAM dendrimers: implications for oral drug delivery. Adv. Drug Deliv. Rev. 64, 571–88 (2012). 239. Aziz, I., Hadjivassiliou, M. & Sanders, D. S. The spectrum of noncoeliac gluten sensitivity. Nat. Rev. Gastroenterol. Hepatol. 12, 516–26 (2015). 240. Levy, H. L. Phenylketonuria: old disease, new approach to treatment. Proc. Natl. Acad. Sci. 96, 1811–3 (1999). 241. Longo, N. et al. Single-dose, subcutaneous recombinant phenylalanine ammonia lyase conjugated with polyethylene glycol in adult patients with phenylketonuria: an open-label, multicentre, phase 1 dose-escalation trial. Lancet 384, 37–44 (2014). 127 Chapter 7: References 242. Rajender Reddy, K., Modi, M. W. & Pedder, S. Use of peginterferon alfa-2a (40 KD) (Pegasys®) for the treatment of hepatitis C. Adv. Drug Deliv. Rev. 54, 571–86 (2002). 243. Maleki, A. et al. Design, modeling, and expression of erythropoietin cysteine analogs in Pichia pastoris: improvement of mean residence times and in vivo activities through cysteine-specific PEGylation. Eur. J. Pharm. Biopharm. 80, 499–507 (2012). 244. Pettit, D. K. et al. Structure-function studies of interleukin 15 using site-specific mutagenesis, polyethylene glycol conjugation, and homology modeling. J. Biol. Chem. 272, 2312–8 (1997). 245. Schulz, J. D. et al. Site-Specifi c Polymer Conjugation Stabilizes Therapeutic Enzymes in the Gastrointestinal Tract. Adv. Mater. (2015). doi:10.1002/adma.201504797 246. Menjoge, A. R., Kannan, R. M. & Tomalia, D. A. Dendrimer-based drug and imaging conjugates: design considerations for nanomedical applications. Drug Discov. Today 15, 171– 85 (2010). 247. Korneychuk, N., Meresse, B. & Cerf-Bensussan, N. Lessons from rodent models in celiac disease. Mucosal Immunol. 8, 18–28 (2015). 248. Suarez, F. L., Savaiano, D. A. & Levitt, M. D. Review article: the treatment of lactose intolerance. Aliment. Pharmacol. Ther. 9, 589–97 (1995). 249. Turner, K. M., Pasut, G., Veronese, F. M., Boyce, A. & Walsh, G. Stabilization of a supplemental digestive enzyme by post-translational engineering using chemicallyactivated polyethylene glycol. Biotechnol. Lett. 33, 617–21 (2011). 250. Aungst, B. J. Absorption Enhancers: Applications and Advances. AAPS J. 14, 10–8 (2012). 251. Zijlstra, E., Heinemann, L. & Plum-Mörschel, L. Oral Insulin Reloaded: A Structured Approach. J. Diabetes Sci. Technol. 8, 458–65 (2014). 252. Haag, R. & Kratz, F. Polymer therapeutics: concepts and applications. Angew. Chemie 45, 1198–215 (2006). 128 List of Abbreviations List of Abbreviations 3D three-dimensional AN (PEP from) Aspergillus niger CCR9 C-C chemokine receptor type 9 CD cluster of differentiation GFD gluten-free diet GI tract gastro-intestinal tract DA degree of deacetylation DQ degree of quaternization FVIII factor VIII G generation HLA human leukocyte antigen IFN interferon Ig immunoglobin IL interleukin MICA MHC class I polypeptide-related sequence A mPEG methoxy poly(ethylene glycole) M cells microfold cells MX (PEP from) Myxococcus xanthus NCGS non-celiac gluten sensitivity NK natural killer cells PAA poly(acrylic acid) PAMAM poly(amido amine) PEI poly(ethylenimine) PEP prolyl endopeptidase P-gp P-glycoprotein PG1 poly-(3,5-bis(3-aminopropoxy)benzyl)-methacrylate 131 List of Abbreviations PLA poly(D,L lactide) SC (PEP from) Sphingomonas capsulate sIg secretory immunoglobulin siRNA small interfering RNA TEER transepithelial electric resistance TM Triticum monococcum TMC N-trimethyl chitosan TNF tumor necrosis factors tTG2 tissue transglutaminase 2 WT wild-type 132 Scientific Contributions Scientific Contributions Publications Schulz, J. D., Patt, M., Basler, S., Kries, H., Hilvert, D., Gauthier, M. A., Leroux, J.-C. Site-Specific Polymer Conjugation Stabilizes Therapeutic Enzymes in the Gastro-Intestinal Tract. Adv. Mater. 2015; DOI: 10.1002/adma.201504797. Schulz, J. D., Gauthier, M. A., Leroux, J.-C. Improving oral drug bioavailability with polycations? Eur. J. Pharm. Biopharm. 2015; 97:427-37. Preiswerk, N., Beck, T., Schulz, J. D., Milovník, P., Mayer, C., Siegel, J. B., Bakeb, D., Hilvert, D. Impact of scaffold rigidity on the design and evolution of an artificial Diels-Alderase. Proc. Natl. Acad. Sci. 2014; 111:8013-18. Galipeau, H. J., Wiepjes, M., Motta, J.-P., Schulz, J. D. et al. Novel role of the serine protease inhibitor elafin in gluten-related disorders. Am. J. Gastroenterol. 2014; 109:748-56. Fuhrmann, K., Schulz, J. D., Gauthier, M. A., Leroux, J.-C. PEG Nanocages as Non-sheddable Stabilizers for Drug Nanocrystals. ACS Nano 2012; 6:1667-76. Matoori S., Fuhrmann G., Schulz J. D., Leroux J.-C. Gluten Binden und Spalten – neue adjuvante Therapieansätze für die Zöliakie. Swiss Medical Forum 2012; 12:716-7. 135 Scientific Contributions Oral Presentations Schulz, J. D. 160th ETH day, Zurich, Switzerland. November 21, 2015. Schulz, J. D., Patt, M., Kries, H., Hilvert, D., Leroux, J.-C. Improving Enzymatic Oral Therapies via Polymer Conjugation. Zurich-Basel-Geneva Joint Seminar Series in Drug Formulation & Delivery; University of Basel, Switzerland. January 22–23, 2015. Schulz, J. D., Patt, M., Kries, H., Hilvert, D., Leroux, J.-C. Improving Enzymatic Oral Therapies via Polymer Conjugation. Germany local chapter meeting CRS; Muttenz, Switzerland. January 12– 13, 2015. Schulz, J. D., Patt, M., Kries, H., Hilvert, D., Leroux, J.-C. Celiac Disease: Improving Enzymatic Oral Therapies via Polymer Conjugation. Doktorandentag (doctoral students’ day); Institute of Pharmaceutical Sciences, ETH Zurich, Switzerland. September 10, 2014. Poster Presentations Schulz, J. D., Patt, M., Kries, H., Hilvert, D., Leroux, J.-C. Improvement of Prolylendopeptidase Stability by Site-Specific Polymer Conjugation; 16th International Celiac Disease Symposium (ICDS); Prague, Czech Republic. June 21–24, 2014. Schulz, J. D., Patt, M., Kries, H., Hilvert, D., Leroux, J.-C. Improving Enzymatic Oral Therapies via Polymer Conjugation; 15th ICDS; Chicago, USA. September 22–25, 2013. 136 Acknowledgments Acknowledgments The work in this doctoral thesis was supported by many individuals who contributed differently to the success of this project and to whom I want to express my gratitude. I am grateful to Prof. Jean-Christophe Leroux for giving me the chance to work in his unique research group and on this interesting, challenging and interdisciplinary project. I am thankful for his scientific input and availability for discussions. The research project presented in this work was financially supported by the Swiss National Science Foundation (310030_135732). I also thank Katharina Holzinger and Dennis Mollenhauser, who helped performing the in vivo experiments presented in Chapter 4 with great patience and supporting advice. I am also grateful to Dr. Franziska Bootz and Dr. Sinem Karaman for their technical support with the ex vivo studies. I thank Dr. Max Pillong, Dr. Steven Proulx, Dr. Giovanni Pellegrini and Dr. Bernhard Pfeiffer for their technical support, Dr. Davide Brambilla for his support in the graphical design of figures and Dr. Gregor Fuhrmann for helpful discussions. I thank Prof. Marc Gauthier from the Institut National de la Recherche Scientifique in Canada for his collaboration, availability and expert advice. Thanks go also to Prof. Donald Hilvert and Dr. Hajo Kries from the Laboratory of Organic Chemistry at ETH Zurich for their collaboration and helpful support of the work presented in Chapter 3. I am grateful to my Master’s students Melanie Patt, Sophie Basler, Valerija Kostadinova and Rydvikha Govender for their motivation and contribution to my research. Thanks go also to Prof. Donald Hilvert and Prof. Michael Detmar and their respective group members for the use of their instruments and to Monica Langfritz for IT support. Many thanks go to Prof. Laura Nyström for agreeing to be my co-examiner and to Dr. Jong Ah Kim, Dr. Giovanna Giacalone and Matthias Westphal for proofreading my thesis. I also thank all current and former members of PSA and WiNS for the fruitful discussions, hand-in-hand work and friendships. I want to express great gratitude to all members of the Drug & Deliver group. The strong support for group members is extraordinary and served as an important motivation 139 Acknowledgments throughout the years. I am grateful for the time inside and outside the lab, the unique experiences that would not have been possible without the multi-cultural friendships that have developed over time. I want to thank former group members who supported and helped me integrate well at the start of this project, namely Dr. Arnaud Felber, Dr. Mattias Ivarsson, Dr. Vincent Forster, Dr. Lorine Brülisauer, Dr. Kathrin Fuhrmann and Dr. Soo Hyeon Lee. I especially thank Athanasia Dasargyri and Diana Andina for the everyday support, discussions and the good atmosphere in our office. Special thanks go also to Anna Polomska, Elena Moroz, Maurizio Roveri, Xiangang Huan, Peter Tiefenböck, Sandhya Ananta, Prof. Paula Luciani, Prof. Bastien Castagner, Dr. Giovanna Giacalone, Dr. Ander Estella, Dr. Jong Ah Kim, Anna Pratsinis, Virginie Rusca, Dr. Valentina Agostoni and Dr. Davide Brambilla for the good time, help and friendships. Finally, I want to thank my friends outside of the research group who have always been an important and stable part in my life. I am grateful to my family, especially to my parents and my brother who have supported me throughout my life. A big thank you goes to my boyfriend, Stephan, for his motivation, positive spirit, and also for helpful scientific discussions. 140
© Copyright 2026 ExpyDoc