PDF - Journal - American College of Chest Physicians

Matrix Metalloproteinases Activity in
COPD Associated With Wood Smoke*
Martha Montan˜o, MSc; Carina Beccerril, MSc; Victor Ruiz, MSc;
Carlos Ramos, PhD; Raul H. Sansores, MD; and
Georgina Gonza´lez-Avila, MD, PhD
Background: Wood smoke (WS) exposure causes COPD with respiratory alterations that are
similar to those described for COPD associated with tobacco smoke (TS). The aim of the present
study was to analyze the effects of WS on matrix metalloproteinase (MMP) activity and expression.
Design: BAL fluid and macrophages were obtained from patients exposed to WS and TS, and from
control subjects. Macrophage elastolytic activity was assayed by radiolabeled elastin degradation.
Gelatinolytic activity was measured by zymography in BAL fluid samples. MMP-2, MMP-9, and
MMP-12 expression were analyzed by reverse transcription polymerase chain reaction in
macrophages from each group.
Results: Macrophage elastolytic activity was increased significantly in WS and TS cells in
comparison to control subjects with no differences between WS and TS samples. MMP-2 was
identified in all groups as a 72-Kd band (proMMP-2), with the highest activity in the WS samples.
MMP-9 was present in its latent and active forms with the highest gelatinolytic activity in the WS
group. MMP-2 expression was increased in both groups as well as MMP-12 compared with the
control. Two of three subjects studied in each COPD group had a significant increase in MMP-9
expression.
Conclusion: These findings demonstrate that WS increases MMP activity and expression that
might produce lung damage similar to that observed in COPD associated with TS.
(CHEST 2004; 125:466 – 472)
Key words: COPD; elastolytic activity; gelatinase A; gelatinase B; matrix metalloproteinases; metalloelastase; wood
smoke
Abbreviations: bp ⫽ base pair; cGAPDH ⫽ competitor glyceraldehyde-3-phosphate dehydrogenase; EDTA ⫽ ethylenediaminetetraacetic acid; GAPDH ⫽ glyceraldehyde-3-phosphate dehydrogenase; IL ⫽ interleukin; MMP ⫽ matrix
metalloproteinase; PCR ⫽ polymerase chain reaction; PMSF ⫽ phenylmethylsulphonyl fluoride; RT ⫽ reverse transcription; TS ⫽ tobacco smoke; WS ⫽ wood smoke
OPD is a condition that encompasses chronic
C bronchitis,
small airway disease, and emphysema.1 It is characterized by a progressive chronic
obstruction to airflow with a persistent inflammatory
process.2,3 Among the cells involved in the inflammation reaction, alveolar macrophages are the predominant cell population identified by BAL.4,5 These
*From the Department of Molecular Biology (Drs. Montan˜o,
Beccerril, Ruiz, and Ramos) and the Extracellular Matrix Laboratory (Drs. Sansores and Gonza´lez-Avila), Department of Immunology, Instituto Nacional de Enfermedades Respiratorias,
Calzada de Tlalpan, Me´xico.
Manuscript received December 26, 2002; revision accepted
September 5, 2003.
Reproduction of this article is prohibited without written permission from the American College of Chest Physicians (e-mail:
[email protected]).
Correspondence to: Georgina Gonza´lez-Avila MD, PhD, Laboratorio de Matriz Extracelular, Departamento de Inmunologı´a,
Instituto Nacional de Enfermedades Respiratorias, Calzada de
Tlalpan 4502, CP 14080, Me´xico, D.F., Me´xico; e-mail:
[email protected]
466
Downloaded From: http://journal.publications.chestnet.org/ on 01/20/2015
cells play an important role in driving the inflammatory response with the secretion of chemotactic
factors such as interleukin (IL)-8, growth-related
oncogene-␣, and leukotriene B4.2,6,7 They also participate in the extracellular matrix degradation by
synthesizing and releasing several matrix metalloproteinases (MMPs), which contribute to lung injury
during COPD.
MMPs are a group of zinc-dependent and calciumdependent endopeptidases that can degrade most of
the components of the extracellular matrix.8 MMPs are
divided into interstitial collagenases, stromelysins,
gelatinases, and membrane-type MMPs.8,9 Alveolar
macrophages are capable of synthesizing MMP-1
(interstitial collagenase 1), MMP-2 (gelatinase A),
MMP-9 (gelatinase B), MMP-7 (matrilysin), membrane-type-1 MMP, and MMP-12 (macrophage
metalloelastase).10 The expression of macrophage
MMPs is regulated by matrix fragments and by
Clinical Investigations
cytokines such as IL-10, IL-13, and tumor necrosis
factor-␣, which keep a balance between the synthesis
of MMPs and their specific inhibitors, the tissue
inhibitors of metalloproteinases.11–14 An increase in
the activity and expression of macrophage MMPs has
been associated with tobacco smoke (TS).
TS has been considered the major cause of
COPD.15 Studies on COPD pathogenesis performed
in humans and animals point out that prolonged
exposure to cigarette smoke induces airway inflammation with an increase in macrophage MMP expression, which can lead to lung parenchyma destruction.16 –18 However, TS may not be the only
factor involved in COPD pathology. In developing
countries, wood and other forms of biomasses have
been used as domestic heating and cooking fuels.
Domestic exposure to the smoke from firewood
increases the prevalence of respiratory diseases such
as chronic bronchitis and emphysema.19 –21 The molecular mechanisms involved in the onset of COPD
associated with wood smoke (WS) are unknown. The
aim of the present work was to analyze the effects of
WS in the enzymatic activity and expression of
MMPs.
Materials and Methods
Study Population
Twelve patients with COPD were examined. The diagnosis of
COPD was confirmed by medical history and the results of
pulmonary function tests. COPD was defined according to
American Thoracic Society criteria.22 A history of productive
daily cough for 3 consecutive months each year for the past 2
years, with an FEV1 of ⬍ 80% of the predicted value, an
FEV1/FVC ratio of ⬍ 70%, and a reversibility in FEV1 of ⬍ 10%
after inhalation of 400 ␮g salbutamol. Subjects with a history of
asthma, atopy, or allergy were excluded from the study. None of
the studied subjects had emphysema detected on a CT scan.
COPD patients were divided into the following two groups:
(1) the TS group, consisting of four women and two men who
were current smokers for ⬎ 10 years (mean [⫾ SD] smoking
history, 21.5 ⫾ 15.8 pack-years; range, 8.4 to 15.8 pack-years);
and (2) the WS group, consisting of six women who not tobacco
smokers, who had been exposed to domestic WS for a mean
duration of 22.7 ⫾ 9.7 years (249 ⫾ 210 h/yr; range, 96 to 500
h/yr). These patients reported the use of traditional “three stone”
stoves in their kitchens without a chimney. They also reported
seeing smoke and soot on the walls in the cooking area.
Three healthy nonsmoker volunteers with normal spirometry
values, no signs of infective respiratory disease during the past 3
weeks, without exposure to WS in the past 10 years, and with no
history of atopy, allergy, or asthma were used as control subjects.
Clinical data for each group are given in Table 1. Informed
consent was obtained from each subject before BAL, and the
protocol was approved by the local ethics and research committees.
BAL
Alveolar macrophages were obtained from all subjects by BAL.
BAL was performed, with slight modifications, as described
elsewhere.23 Seven 30-mL aliquots of sterile saline solution were
instilled with the bronchoscope to the subsegmental bronchi of
the middle lobe. The recovered fluid was strained through
surgical gauze to remove debris and mucus, and was centrifuged
at 400g for 10 min. The supernatant protein content was
measured by the Bradford method, and samples then were stored
at ⫺70°C until used.24 Cell pellets were resuspended in RPMI1640 medium (Sigma; St Louis, MO) containing 10% fetal calf
serum. An aliquot was counted in an hemocytometer, and cell
viability was analyzed by trypan blue exclusion. Total and differential cell counts in BAL fluid are shown in Table 2. Alveolar
macrophages were isolated by differential attachment to elastincoated 24-well plates (see below).
Elastolytic Activity
Tritium-labeled elastin was prepared by the reductive alkylation of bovine ligamentum nuchae elastin (Elastin Products
Company; Owensville, MO), using sodium boro-[3H-] hydride.25
Elastolytic activity was assayed by the method of Chapman and
Stone.26 Twenty-four well plates were coated with 16 ␮g 3Helastin (specific activity, 128.21 disintegrations per min [dpm]/
mg). Prior to use, cultured plates were washed three times with
phosphate-buffered saline solution. A total of 1 ⫻ 106 cells/mL
added to each well and incubated in RPMI-1640 medium
(Sigma) containing 10% fetal calf serum, and supplemented with
nonessential amino acids, 50 U/mL penicillin, and 50 ␮g/mL
streptomycin in an atmosphere with 5% CO2 for 2 h at 37°C.
Nonadherent cells were removed, and fresh medium was added
to the adhered cells (macrophages) and cultured for 48 h. Coated
wells with cell-free medium were used to determine the nonspecific release of radioactive elastin (negative control). Wells incubated with 20 ␮g pancreatic elastase (Sigma) were used as
positive controls. Incubations with 100 mmol/L phenylmethylsuphonyl fluoride (PMSF) or 50 mmol/L ethylenediaminetetraacetic acid (EDTA) also were included to determine the nature of
the elastolytic activity (elastase or metalloproteinase, respectively). All experiments were performed in triplicate. At the end
of the incubation period, the medium was collected from each
well and was centrifuged at 13,000g for 10 min, and an aliquot of
the supernatants was counted in a liquid scintillation spectrophotometer (model LS-100; Beckman Instruments; Fullerton CA).
Table 1—Clinical Characteristics of Control Subjects and COPD Patients*
Variables
Control Group
TS Group
WS Group
Age, yr
FEV1, % predicted
FEV1/FVC, %
FEV1 reversibility, %
51.7 ⫾ 3.1 (49–55)
94.7 ⫾ 7.5 (87–102)
74.3 ⫾ 3.1 (71–75)
ND
55.7 ⫾ 8.9 (48–71)
55.7 ⫾ 12.8 (45.9–74)
38.8 ⫾ 5.8 (33.8–47.4)
4.8 ⫾ 3.6 (2–9.5)
59.8 ⫾ 4.3 (56–68)
47.2 ⫾ 11.4 (32.5–57.4)
58.8 ⫾ 2.8 (56–62)
6.6 ⫾ 3.8 (1–9.6)
*Values given as mean ⫾ SD (range). ND ⫽ not done.
www.chestjournal.org
Downloaded From: http://journal.publications.chestnet.org/ on 01/20/2015
CHEST / 125 / 2 / FEBRUARY, 2004
467
Table 2—Cell Content in Control Subjects and COPD
Patients BAL Fluid*
Variables
Cells/mL, 1 ⫻
106 cells
Macrophages, %
Lymphocytes, %
Neutrophils, %
Eosinophils, %
Control
Group
TS Group
WS Group
51.4 ⫾ 14.3
70.6 ⫾ 33.3
105.8 ⫾ 27.1
92 ⫾ 10.6
7 ⫾ 1.2
0
0
80 ⫾ 25.4
10 ⫾ 1.5
6 ⫾ 0.8
0
75 ⫾ 26
15 ⫾ 2.8
4 ⫾ 0.4
0
*Values given as mean ⫾ SD.
Elastolytic activity related to metalloproteinase was inhibitable by
EDTA but not by PMSF. The results were calculated as follows:
cpm macrophage sample ⫺ cpm blank
specific activity of 3H-elastin
where cpm is counts per minute. Results were reported as
micrograms of elastin degraded per 1 ⫻ 106 cells in 48 h.
Zymogram Assay
Substrate gel electrophoresis was carried out by incorporating
0.1% pig skin gelatin (Sigma) into standard 8% sodium dodecyl
sulfate polyacrylamide gels, as described elsewhere.27 Three
micrograms of protein from the BAL fluid supernatants of three
COPD patients and two control subjects were added per lane
under nondenaturating conditions and were run under constant
current (10 mA). Prestained molecular weight markers (Sigma)
were included in each gel. After electrophoresis, the gels were
rinsed in 2.5% Triton X-100 and then incubated in TNC buffer
(ie, 50 mmol/L Tris-HCl, 0.15 mol/L NaCl, 20 mmol/L CaCl2,
and 0.02% sodium azide [pH 7.4]), with or without 20 mmol/L
EDTA, at 37°C overnight. Each gel was stained in 0.05%
Coomassie blue R-250 (Bio-Rad; Richmond, CA) and was
destained in 10% methanol-10% acetic acid. Gelatinolytic activity
was detected as clear bands on a blue background on the stained
sodium dodecyl sulfate gelatin gels. Lysis bands detected in the
zymography were analyzed by densitometry (Kodak Digital Science ID Image Analysis Software; Eastman Kodak; Rochester,
NY) that measures the surface and intensity of lysis bands.
Results were expressed as densitometry units.
Reverse Transcription Polymerase Chain Reaction of
Macrophages MMPs
Reverse transcription (RT) polymerase chain reaction (PCR)
amplification was used to analyze the gene expression of MMP-2
(gelatinase A), MMP-9 (gelatinase B), MMP-12 (macrophage
metalloelastase), and glyceraldehyde-3-phosphate dehydrogenase
(GAPDH), in three subjects in each group. Total RNA was
isolated from adherent macrophages with Trizol (GIBCO-BRL;
Rockville, MD). RNA quality was determined by resolving on
denatured 1% agarose gels, and by measuring absorbance on an
aliquot at 260 and 280 nm. RT-PCR was performed (ThermoScript; GIBCO-BRL) according to the manufacturer’s protocol.
Briefly, to obtain complementary DNA, 1 ␮g RNA was added to
a reverse transcription working mixture containing 15 U/␮L avian
ribonuclease H-reverse transcriptase, 10 mmol/L Tris-HCl (pH
8.3), 50 mmol/L KCl, 5 mmol/L MgCl2, 0.5 mmol/L deoxynucleoside triphosphates, 2.5 ␮mol/L random hexamers, 2.5
U/␮L RNase inhibitor in a 20-␮L final volume.
A GADPH competitor was used to perform a semiquantitative
analysis.28 A 155-base pair (bp) internal fragment was obtained by
cutting with NcoI, a GADPH-complementary DNA cloned from
an originally 1,233-bp DNA, cloned in a PBR 322 plasmid.
Modified GAPDH-complementary DNA was subsequently relegated. A competitor GAPDH (cGAPDH; 240 bp) sequence was
obtained by PCR amplification from the modified plasmid using
primers for GADPDH. Competitive PCR for the GAPDH
housekeeping gene was performed with a working mixture
containing 20 mmol/L Tris-HCl (pH 8.3), 50 mmol/L KCl, 2
mmol/L MgCl2, 200 ␮mol/L deoxynucleoside triphosphates, 1
␮mol/L specific 5⬘ and 3⬘ specific primers, and 1 U/␮L Taq DNA
polymerase (Perkin-Elmer; Branchburg, NJ) in a final volume of
25 ␮L. Serial dilutions of the standard competitor (ie, 5, 10, 15,
and 20 pg) were coamplified with a constant amount of cellular
complementary DNA (1 ␮L). Amplification was carried out
(model 9600; Perkin-Elmer). Primers and cycling conditions are
shown in Table 3.
PCR product aliquots of 5 ␮L were resolved in 1.5% agarose
gel/ethidium bromide. Band intensities were analyzed by scanning densitometry using digital science electrophoresis documentation (Eastman Kodak) and by an analysis system (system 120;
Table 3—Primers and Cycling Conditions for MMPs PCR Amplification
Primers
Sequence
Amplified Product
GAPDH
Sense
Antisense
MMP-2
5⬘CATCCATCCCGTGACCTTAT3⬘
5⬘GCATGACTCTCACAATG-CGA3⬘
Sense
Antisense
MMP-9
5⬘GTGCTGGGCTGCTGCTTTGCTG3⬘
5⬘GTCGCCCTCAAAGGTTTGGAAT3⬘
Sense
Antisense
MMP-12
5⬘TTCACCCGGTTGTGGAAACT3⬘
5⬘AAATGTGGGTGTACACAGGC3⬘
Sense
Antisense
5⬘ATATGTCGACATCAACACAT3⬘
5⬘ATAAGCAGCTTCAATGCCAG3⬘
468
Downloaded From: http://journal.publications.chestnet.org/ on 01/20/2015
Cycling Conditions
395 bp
95°C/10 min for 1 cycle; 95°C/30 s and 72°C/90 s for 35
cycles; and final incubation 72°C/7 min
180 bp
95°C/10 min for 1 cycle; 95°C/30 s, 60°C/30 s, and 58°C/90 s
for 33 cycles; and final incubation 72°C/7 min
303 bp
95°C/10 min for 1 cycle; 95°C/30 s, 60°C/30 s, and 60°C/90 s
for 35 cycles; and final incubation 72°C/7 min
200 bp
95°C/10 min for 1 cycle; 95°C/30 s, 60°C/30 s, and 72°C/90 s
for 35 cycles; and final incubation 72°C/7 min
Clinical Investigations
Eastman Kodak). The logarithm of the GAPDH/cGAPDH ratio
was plotted as a function of the logarithm of the known cGAPDH
amount. The point of equivalence represented the GAPDH
concentration in the unknown sample. Once the concentration of
GAPDH was obtained for all samples, dilutions were performed
to reach 5 pg/␮L GADPH. Complementary DNA was amplified
with specific primers for MMPs. The primers used for PCR
reactions were custom synthesized (GIBCO-BRL). PCR amplification products were resolved in 1.5% agarose/ethidium bromide gels. Band intensities were measured by scanning densitometry. The results were expressed as densitometry units.
Statistical Analysis
The results were analyzed with the Mann-Whitney U test and
were expressed as the mean ⫾ SD. A p value of ⱕ 0.05 was
considered to be significant.
Results
Elastolytic Activity
Elastolytic activity using 3H-elastin-precoated
wells was detected in all samples assayed (Fig 1). The
mean WS and TS elastolytic activity (4.5 ⫾ 1.27 and
3.0 ⫾ 0.9 ␮g degraded elastin per 106 cells per 48 h,
respectively) was significantly increased in comparison with the control group (1.42 ⫾ 0.81 ␮g degraded
elastin per 106 cells per 48 h; p ⬍ 0.05). Differences
between WS and TS samples were not significant.
Elastolytic activity was inhibited by EDTA but not by
PMSF.
samples from the control group (Fig 2, top). These
bands may correspond to proMMP-2 (gelatinase-A),
MMP-9 (gelatinase B), and proMMP-9. The enzymatic activity of these MMPs also was observed on
TS and WS samples.
ProMMP-2 (72-Kd band) densitometry analysis
demonstrated a mean net intensity that was significantly higher in the WS group (8,997.7 ⫾ 3,214.2
densitometry units) than the those of the TS and
control samples (1,849.1 ⫾ 631.2 and 3,594 ⫾ 1,742.3
densitometry units, respectively; p ⱕ 0.01) [Fig 2,
bottom].
A significant increase in the mean net intensity (ie,
gelatinolytic activity) of the 85-Kd band was observed (MMP-9) in the TS (4,119.3 ⫾ 1,762 densitometry units) and WS samples (11,092 ⫾ 3,040
densitometry units) in comparison with the control
(469 ⫾ 309.7 desitometry units; p ⱕ 0.01 for all values) [Fig 2, bottom].
The mean net intensity of the 92-Kd band
(proMMP-9) also was significantly increased in TS
subjects (1,167.9 ⫾ 548.2 densitometry units) and
WS subjects (2,502.8 ⫾ 265.4 densitometry units) in
comparison with the control subjects (181.4 ⫾ 31.9
densitometry units; p ⱕ 0.01 for all values) [Fig 2,
bottom].
Gelatinolytic Activity
Zymography analysis revealed lysis bands of estimated molecular weights of 72, 85, and 92 Kd in the
Figure 1. Macrophage elastolytic activity from COPD subjects.
Macrophages from the WS and TS group showed a significant
increase in elastolytic activity, with the highest activity present in
the WS group. Values are expressed as micrograms of degraded
elastin per 106 cells per 48 h. Bars represent the SD.
www.chestjournal.org
Downloaded From: http://journal.publications.chestnet.org/ on 01/20/2015
Figure 2. COPD BAL fluid gelatin zymography. Top:
proMMP-2 (72-Kd band) was detected with a higher activity in
WS samples. MMP-9 was observed in its active and latent forms
(85-Kd and 92-Kd bands, respectively). Sample distribution was
as follows: lanes 1 and 2, control group samples; lanes 3 to 5, TS
group samples; lanes 6 to 8, WS group samples. Molecular weight
markers are listed on the right. Bottom: densitometry analysis
showed an increase in proMMP-2, proMMP-9, and MMP-9
activity in the WS group in comparison with the TS and control
groups. Bars represent the SD.
CHEST / 125 / 2 / FEBRUARY, 2004
469
MMP Expression
Macrophage MMP expression was examined by
semiquantitative RT-PCR (Fig 3, top). Complementary DNA samples were adjusted to equal the quantified housekeeping gene GADPH before amplification. Densitometry analysis showed that there were
no significant differences among the net intensities
from the GADPH bands obtained from the three
groups (Fig 3, bottom), demonstrating that the DNA
used for MMP amplification was similar for all
groups. RT-PCR showed that the TS group samples
had the highest MMP-2 expression (21,847 ⫾ 6,501
densitometry units; p ⬍ 0.01) when compared to
those of the control group (3,565.1 ⫾ 345.5 densitometry units) and the WS group (7,324.9 ⫾ 3,215.8
densitometry units) [Fig 3, bottom). WS group
MMP-2 expression was significantly increased in comparison with that of the control group (p ⫽ 0.028).
MMP-9 expression appeared to be elevated in four
of six COPD subjects, although there were no significant group differences among the TS, WS, and control
groups (61,812.9 ⫾ 39,861.1, 67,946.2 ⫾ 52,679.9, and
16,719.6 ⫾ 1,842.7 densitometry units, respectively).
One subject in the TS group and one subject in the
WS group had MMP-9 expression similar to that of
the control group (15,807.8 and 14,084.2 densitometry units, respectively).
MMP-12 gene expression was significantly increased in both COPD groups. TS samples exhibited
the highest mean intensity (28,082.4 ⫾ 10,065.5
densitometry units) in comparison with the control
group (11,897.4 ⫾ 5,438.2 densitometry units;
p ⫽ 0.01). WS group MMP-12 expression also was
significantly higher than that of the control group
(21,393.7 ⫾ 5,684.3 densitometry units; p ⫽ 0.03).
The differences between the TS and WS samples
were not significant.
Discussion
Figure 3. Macrophage MMP expression from COPD patients.
Top: RT-PCR amplification was performed with macrophage
total RNA using specific primers (Table 3). GADPH (a housekeeping gene) expression was used to adjust all samples to the
same DNA quantity for MMP amplification. Molecular weights
(MW) are listed on the right. N ⫽ PCR negative control (ie, a
working mixture without complementary DNA). Bottom: densitometry analysis showed an increase in the expression of MMP-2
and MMP-12 in the TS and WS groups in comparison with that
in the control group. MMP-9 expression also was increased but
without significant differences with the control samples. Bars
represent the SD.
470
Downloaded From: http://journal.publications.chestnet.org/ on 01/20/2015
The use of wood and other biomasses for cooking
and heating is a very frequent practice worldwide,
especially in developing countries, but respiratory
alterations due to the exposure to WS scarcely have
been investigated.19 –21 The clinical respiratory alterations associated with long-term WS exposure are
the same as those for cigarette smoking. Moreover,
chronic bronchitis and emphysema have been observed in non-tobacco smokers exposed to WS.29 The
effects of TS on the inflammatory process and the
molecular mechanisms involved in lung damage have
been amply studied. In this context, a large amount
of elastolytic activity, due to an increase in the
expression of neutrophil elastase and/or MMP-12
from macrophages associated with TS, has been
observed.17,30 In this study, we tried to determine
whether WS has any effect in macrophage metalloelastase activity. We found that WS, as well as TS,
increased the elastolytic activity, and that this enzymatic activity corresponds to MMP-12 since PMSF
has no effect on it. This finding was confirmed by
RT-PCR analysis, which revealed an increase in
MMP-12 expression in subjects exposed to WS.
Other MMPs explored in this work were MMP2
and MMP-9. These enzymes have the capacity to
degrade type IV collagen, the main protein of basement membranes damaged in COPD. Increased
gelatinolytic activity associated with MMP-2 (gelatinase A) and MMP-9 (gelatinase B) has been identified in BAL fluid from COPD patients.18 In the
Clinical Investigations
present work, we found gelatinolytic activity corresponding to both gelatinases. MMP-2 activity in WS
group samples was elevated compared to that in
samples from the TS and control groups. In contrast,
MMP-9 activity was higher than that in control
subjects in both COPD groups, with the largest
activity in WS group samples. There is some evidence that MMP-9 is one of the main proteolytic
enzymes involved in emphysema pathology.31 This
enzyme has been identified as a 92-Kd (proenzyme)
and an 86-Kd band (active form), but also as highmolecular-weight bands (130 Kd) that correspond to
lipocalin-progelatinase-B complex in BAL fluid samples. This complex (neutrophil gelatinase-associated
lipocalin) is characteristic of neutrophils. In this
work, we were not able to detect these molecular
complexes, probably because the neutrophil count in
the BAL fluid samples was very low.
According to our MMP enzymatic activity results,
macrophage RNA was analyzed to see whether WS
and TS had any effect on MMP-2 and MMP-9
expression that could explain in part the increase in
gelatinolytic activity. MMP-2 expression was significantly increased in both groups. The increase in
MMP-2 expression correlates with the MMP-2 activity observed in the WS group. However, the
increase in MMP-2 expression in TS samples did not
correspond to the low MMP-2 gelatinolytic activity
found in BAL fluids from subjects in this group. It is
possible that the low enzymatic activity observed in
the TS group was due to a low translation rate and/or
to low enzyme activation.
In contrast, the results obtained in MMP-9 expression analysis were not homogenous, and this could
be due to the presence of polymorphism in the
promoter region of MMP-9 (⫺1,562 C/T [cytosine/
thymine]). It has been reported that the T allele has
a higher promoter activity than the C allele because
there is preferential binding of a repressor to the
C allelic promotor.32 Moreover, subjects with an
increase in MMP-9 expression (ie, the T allele) had
a high MMP-9 gelatinolytic activity. It is possible
that in our study the subjects with a high MMP-9
expression had the T allele that corresponds to an
increase in gelatinolytic activity.
In conclusion, although the analyzed population
was small, this study demonstrates that chronic
exposure to WS has similar effects to that of TS in
MMPs enzymatic activity and expression. The presence of these enzymes in the respiratory tract might
degrade the interstitial extracellular matrix and basement membrane components, and cause lung damage similar to that observed in COPD associated with
tobacco smoking.
www.chestjournal.org
Downloaded From: http://journal.publications.chestnet.org/ on 01/20/2015
References
1 Fletcher CM, Pride NB. Definitions of emphysema, chronic
bronchitis, asthma, and airflow obstruction: 25 years on from
the Ciba symposium. Thorax 1984; 39:81– 85
2 Barnes PJ. Mechanisms in COPD: differences from asthma.
Chest 2000; 117(suppl):10S–14S
3 Saetta M. Airway inflammation in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 1999; 160:517–520
4 Cosio MG, Guerassimov A. Chronic obstructive pulmonary
disease: inflammation of small airways and lung parenchyma.
Am J Respir Crit Care Med 1999; 160:S21–S25
5 Merchant RK, Schwartz DA, Helmers RA, et al. Bronchoalveolar lavage cellularity: the distribution in normal volunteers.
Am Rev Respir Dis 1992; 146:448 – 453
6 Yamamoto C, Yoneda T, Yoshikawa M, et al. Airway inflammation in COPD assessed by sputum levels of interleukin-8.
Chest 1997; 112:505–510
7 Zakrzewski JT, Barnes NC, Costello JF, et al. Lipid mediators
in cystic fibrosis and chronic obstructive pulmonary disease.
Am Rev Respir Dis 1987; 136:779 –782
8 Vu TH, Werb Z. Matrix metalloproteinases: effectors of
development and normal physiology. Genes Dev 2000; 14:
2123–2133
9 Stetler-Stevenson WG. Dynamics of matrix turnover during
pathologic remodeling of the extracellular matrix. Am J Pathol
1996; 148:1345–1350
10 Shapiro SD. The macrophage in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 1999; 160:529 –532
11 Gomez DE, Alonso DF, Yoshiji H, et al. Tissue inhibitors of
metalloproteinases: structure, regulation and biological functions. Eur J Cell Biol 1997; 74:111–122
12 Lim S, Roche N, Oliver BG, et al. Balance of matrix
metalloprotease-9 and tissue inhibitor of metalloprotease-1
from alveolar macrophages in cigarette smokers: regulation
by interleukin-10. Am J Respir Crit Care Med 2000; 162:
1355–1360
13 Zheng T, Zhu Z, Wang Z, et al. Inducible targeting of IL-13
to the adult lung causes matrix metalloproteinase and cathepsin dependent emphysema. J Clin Invest 2000; 106:1081–
1093
14 Xie B, Laouar A, Huberman E: Autocrine regulation of
macrophage differentiation and 92-kDa gelatinase production
by tumor necrosis factor-alpha via alpha 5 beta 1 integrin in
HL-60 cells. J Biol Chem 1998; 273:11583–11588
15 Sethi JM, Rochester CL. Smoking and chronic obstructive
pulmonary disease. Clin Chest Med 2000; 21:67– 86
16 Selman M, Montan˜ o M, Ramos C, et al. Tobacco smokeinduced lung emphysema in guinea pigs is associated with
increased interstitial collagenase. Am J Physiol 1996; 271:
L734 –L743
17 Ofulue AF, Ko M, Abboud RT. Time course of neutrophil
and macrophage elastinolytic activities in cigarette smokeinduced emphysema. Am J Physiol 1998; 275:L1134 –L1144
18 Segura-Valdez L, Pardo A, Gaxiola M, et al. Upregulation of
gelatinases A and B, collagenases 1 and 2 and increased
parenchymal cell death in COPD. Chest 2000; 117:684 – 694
19 Dennis RJ, Maldonado D, Norman S, et al. Woodsmoke
exposure and risk for obstructive airways disease among
women. Chest 1996; 109:115–119
20 Pe´ rez-Padilla R, Regalado J, Vedal S, et al. Exposure to
biomass smoke and chronic airway disease in Mexican women: a case control study. Am J Respir Crit Care Med 1996;
154:701–706
21 Tzamakis N, Kallergis K, Bouros DE, et al. Short-term effects
of wood smoke exposure on the respiratory system among
charcoal production workers. Chest 2001; 119:1260 –1265
CHEST / 125 / 2 / FEBRUARY, 2004
471
22 American Thoracic Society. Standards for the diagnosis and
care of patients with chronic obstructive pulmonary disease:
in patient management of COPD. Am J Respir Crit Care Med
1995; 152:S78 –S83
23 Selman M, Pardo A, Barquin N, et al. Collagenase and
collagenase inhibitors in bronchoalveolar lavage fluids. Chest
1991; 100:151–155
24 Bradford MM. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the
principle of protein-dye binding. Anal Biochem 1976; 72:
248 –254
25 Ofulue AF, Sansores RH, Abboud RT. Effect of assay
conditions on measurement of elastolytic activity of alveolar
macrophages in culture and characterization with proteinase
inhibitors. Clin Biochem 1994; 27:13–20
26 Chapman HA, Stone OL. Comparison of human neutrophil
and alveolar macrophages elastolytic activity in vitro: relative
resistance of macrophage elastolytic activity to serum and alveolar proteinase inhibitors. J Clin Invest 1984; 74:1693–1700
27 Vadillo-Ortega, Gonza´ lez-Avila G, Furth EE, et al. 92 kD
type IV collagenase (matrix metalloprotease-9) activity in
472
Downloaded From: http://journal.publications.chestnet.org/ on 01/20/2015
28
29
30
31
32
human amniochorion increases with labor. Am J Pathol 1995;
146:148 –156
Ramos C, Montan˜ o M, Garcı´a-Alvarez, et al. Fibroblasts from
idiopathic pulmonary fibrosis and normal lungs differ in
growth rate, apoptosis, and tissue inhibitor of metalloproteinases expression. Am J Respir Cell Mol Biol 2001; 24:591–598
Anderson HR. Chronic lung disease in the Papua New
Guinea Highlands. Thorax 1979; 34:647– 653
Snider GL. Collagen vs elastin in pathogenesis of emphysema: cellular origin of elastases; bronchiolitis vs emphysema
as a cause of airflow obstruction. Chest 2000; 117:244S–246S
Russell REK, Culpitt SV, DeMatos C, et al. Release and
activity of matrix metalloproteinase-9 and tissue inhibitor of
metalloproteinase-1 by alveolar macrophages from patients
with chronic obstructive pulmonary disease. Am J Respir Cell
Mol Biol 2002; 26:602– 609
Zhang B, Ye S, Herrmann SM, et al. Functional polymorphism in the regulatory region of gelatinase B gene in relation
to severity of coronary atherosclerosis. Circulation 1999;
99:1788 –1794
Clinical Investigations

Download Report