Merial Avian Forum 2014 Paris 25 April 2014 Richard Irvine BVetMed, PGCertILHP, MSc(CIDA), Dipl.ECPVS, MRCVS Head of National Reference Laboratory (UK) for Statutory & Non‐statutory Viral Diseases of Poultry Deputy Head EU/OIE/FAO International Reference Laboratory for AI & ND AHVLA‐Weybridge [email protected] EU/OIE/FAO International Reference Laboratory for Avian Influenza (AI) and Newcastle Disease (ND) OIE Reference Laboratory for Swine Influenza Disease and scientific consultancy for AI/ND/Swine Influenza and other viral diseases of poultry: [email protected] Microorganisms’ variability: Epidemiological consequences Introduction • Diseases of importance in poultry – RNA viruses • Biology & mechanisms – Replication, mutation, selection • Epidemiological consequences – Viral variability: R&D, Diagnosis, Prevention & control Microorganisms’ variability • Different microorganisms can infect and cause disease in poultry, and their properties may change over time • Non‐infectious causes of bird and flock production problems are also very important: – Flock management & husbandry – Feed & water – Environment & hygiene Some pathogens & diseases of importance • Bacterial Infectious Coryza, Fowl cholera, E.coli, Staphylococcus aureus, Salmonellosis, Mycoplasmosis, Enterococcus hirae, Erysipelas, ORT, Clostridium perfringens, Riemerella anatipestifer • Protozoal Coccidiosis, Blackhead, Spironucleosis • Fungal Aspergillosis, Mycotoxicosis, Candidiasis • Viral Avian Influenza, Newcastle disease, IBV, Gumboro, TVP, HEV, Reoviral tenosynovitis, aMPV (TRT), Rotavirus, DVH I/II, CAV, Marek’s disease, ILT, Leukosis, Pox, IBH, EDS’76, MSD, DVE, GPV • Parasitic Red mite, Helminth worms Some viral diseases of importance in poultry • RNA viruses Avian Influenza, Newcastle disease, IBV, Gumboro, aMPV (TRT), Reoviral tenosynovitis, CAV, TVP, HEV, BLSDV, Rotavirus, DVH I/II • DNA viruses Marek’s disease, ILT, Leukosis, Pox, IBH, GE EDS’76, MSD, DVE, GPV Diseases of health, welfare, financial and economic importance to both poultry producers and the industry RNA viral diseases of importance in poultry • RNA viruses Avian Influenza, Newcastle disease, IBV, Gumboro, aMPV (TRT), Reoviral tenosynovitis, CAV, TVP, HEV, BLSDV, Rotavirus, DVH I/II • The nucleic acid that makes up the viral genome is RNA • Successful viral infection of host cells by RNA viruses requires many steps, including viral RNA replication and protein synthesis • Replication requires an RNA‐dependent RNA polymerase enzyme Viral RNA replication & synthesis + Viral protein synthesis ↓ New progeny viruses Mutations are introduced during viral RNA synthesis by the insertion of incorrect nucleotides by RNA polymerases into the new viral genome that is being made RNA viruses are prone to error & mutation • RNA viruses mutate at a higher rate than DNA viruses: o DNA viruses make ~1 error per 107‐109 nucleotide copied o RNA viruses make ~1 error per 103‐105 nucleotide copied • This high rate of mutation comes from the lack of proof‐reading ability in RNA polymerases during the viral replication process o DNA viruses also make mistakes, but they can correct them • RNA viruses have low copy fidelity and hence are error‐prone o Each new RNA virus produced is likely to have one or more mutations RNA viral diversity & evolution • Large numbers of new progeny viruses are produced during each round of viral replication • Each round of viral replication therefore produces thousands of co‐existing mutants • Viral population ‐ swarm ‐ of quasispecies • Mutations may provide a selective advantage or disadvantage – ‘viral fitness’ Lauring & Andino (2010). Quasispecies Theory and the Behavior of RNA Viruses. PLoS Pathog 6(7): e1001005. doi:10.1371/journal.ppat.1001005 RNA viral quasi‐species & ‘fitness’ • Genetically distinct, but functionally linked, virus variants (genotypes) will co‐exist in an infected host, eg. a chicken • Some genotypic variants (viral quasispecies) may be ‘fitter’ than others: o RNA mutation that result in a selective advantage for the virus o Immune escape mutants; transmissibility; tissue tropism, etc. • Genotypic diversity results in different viral phenotypes and therefore influences the pathogenesis of viral infection in the host Mechanisms for RNA viral diversity • RNA viruses Avian Influenza, Newcastle disease, IBV, Gumboro, aMPV (TRT), Reoviral tenosynovitis, CAV, TVP, HEV, BLSDV, Rotavirus, DVH I/II • Genetic drift Point mutations – nucleotide insertions • Genetic shift Re‐assortment/recombination of genes Generation of novel genotypes and/or phenotypes eg. New strains (AI, ND, IBV, IBDV); LPAI to HPAI; APMV‐1 to NDV RNA virus variability Epidemiological consequences Implications of viral variability: Diagnosis & control 1. Altered virulence & pathogenesis – Differences in the development and severity of pathology & clinical signs – R&D to understand implications for host, and detection approaches 2. Changes in antigenicity & immunogenicity – Virus: ‘Escape’ host immune responses – Host: Degree of vaccine protection vs. breaks in face of viral challenge 3. Challenges for diagnostic laboratory methods – Use of conserved regions for diagnostic tools, eg. ELISA, PCR – Disease criteria & definitions: internationally‐recognised standards Two mechanisms for genetic changes • Drift through accumulating point mutations in a single gene – Influenza: HA has highest rates • Shift by reassortment and/or recombination – Exchange of genes/segments • Examples: AI, ND, IBV Li et al, (2004). Genesis of HPAI in East Asia. Nature, 430(6996), pp209‐213. Influenza A Virus • • • • Family Orthomyxoviridae Genus Influenzavirus type A Segmented RNA virus Subtypes based on surface ‘spike’ glycoproteins – Heamagglutinin (HA): H1-H16* 1. Antigenic, immunogenic 2. Host cell receptor binding – Neuraminidase (NA): N1-N9* 1. Virion release from host cells *in birds Reassortment Two influenza viruses infect the same cell H1N1 H2N2 Plus 252 other combinations H1N1 H2N1 H1N2 H2N2 Dennis Alexander Two Avian influenza pathotypes • LPAI • HPAI INFLUENZA VIRUS PARTICLES Dennis Alexander Classification based on disease in chickens HA cleavage site sequence determines pathotype R/KET Single basic amino acid (R or K) Multiple basic amino acids Cleavage site point mutation(s) result in switch from LPAI to HPAI phenotype & genotype, after LPAI virus introduction to poultry from wild birds. H5/H7 AIV only. OIE & EU definitions of Notifiable AI Infection of poultry or other captive birds caused by any influenza A virus of the subtypes H5 or H7 is reportable. Classified as HPAI if: (i)An intravenous pathogenicity index (IVPI) in 6‐week‐old chickens >1.2 (max. 3.0) (ii)H5 or H7 with multiple basic amino acids at the cleavage site of the HA protein… cleaved by a ubiquitous host protease Confirmed disease requires immediate implementation of control measures Newcastle disease virus • Family Paramyxoviridae, Genus Avulavirus • Avian paramyxovirus serotype 1 (APMV‐1) • Virulent (NDV) and avirulent strains based on Fusion (F) gene cleavage site sequence • RNA genome – – – – ~15kb negative sense, single stranded non‐segmented 6 genes (8 proteins) ND Fusion gene: Virulence & Clinical signs Avirulent Virus Virulent virus Limited tissue/protease distribution Mild or asymptomatic infection Unlimited tissue/protease distribution Severe, systemic disease & death Typical avirulent motif: XRQXR * L Virulent motifs: RRQRR * F / XRQRR * F 3' 55 1746 1451 1241 1792 2031 6704 NP P M F HN L 2 1 1 35 47 5' 55 Phylogenetic data & viral relationships • Study the evolutionary relatedness between viruses using genome sequencing data • Particularly useful for rapidly evolving viruses • Virus classification (clades) • Understand epidemiology (source and spread) • Inform prevention and control policies Modified from: who.int/csr/disease/avian_influenza/H5N1evoconceptualdiagram.pdf Differences in H5 AI viruses between Western & Eastern hemispheres Eurasian H5N1 HPAI Eurasian: Other H5 AIVs, mainly LPAI American H5 AIVs PCR detection of AI viruses: Matrix gene • Matrix (M) gene highly conserved across all AI virus subtypes (H1 – H16), and across all geographic regions • Continued evolution of AI viruses eg. Eurasian lineage H5N1 HPAI • Mismatches with reverse primer (SEP2) of Matrix gene RRT‐PCR Match to Clade SEP2 sequence (Spackman et al 2002) 2.2 CAGAAACTTGAAGATGTCTTTGCA A/muscovy duck/Vietnam/F23/09 2.3.2 CAGAAACTTGAGGATGTCTTTGCA A/chicken/Romania/10580/10 2.3.4 CAGAAACTTGAGGATGTCTTTGCA H5N1 HPAI isolate A/chicken/Nepal/5185/10 CAGAGACTTGAAGATGTTTTTGCA M gene RRT‐PCR M1 ORF, segment 7 5’ Spackman et al (2002); 101 bp M1 3’ Nagy et al (2010); 182 bp Standardisation of robustly validated diagnostic methods in OIE & EU Manuals supported by laboratory ring trials. Slomka et al., (2012). Challenges for accurate and prompt molecular diagnosis of clades of highly pathogenic avian influenza H5N1 viruses emerging in Vietnam, Avian Pathology, 41,(2), pp177‐193. M gene (1) M gene (2) H5 HA2 Suspect AI/ND case in poultry flock Official veterinary visit Samples received in lab ≤ 12 hours: M gene + H5/H7 NAI or APMV‐1 PCR positive ≤ 36 hours: Virulent sequence 48 hours: Isolation of AI or ND virus 72 hours: Virus subtyping completed Day 7: Virus isolation complete Day 14: IVPI or ICPI complete Infectious Bronchitis Virus (IBV) • Global distribution of many different IBV serotypes – Variation within and between countries and regions – Indigenous IBV variants in many regions • IBV is of major economic, health and welfare importance to poultry & poultry industry worldwide • Continued emergence and evolutionary divergence of IBV variants – Changes in Spike (S) protein amino acids – Novel variants do not always persist & spread, but some do, causing major disease and control challenges Global distribution of IBV, 1950 onwards IBV Serotypes identified Europe Asia Americas Australia Mass D207 D212 D3128 D3896 D1466 PL‐64084‐France A224.74/Italy B1648‐Belgium UK/918/67 UK6/82 UK/142/86 UK793/B 624/Italy QX (D388) Mass Conn Gray Ark 99 N1/52‐T Kb8523‐Japan 793/B‐India NRZ‐China HV‐China SAIB3‐China KM91‐Korea EJ95‐Korea A1121‐Taiwan QX Mass Conn Florida Clark 333 Ark 99 SE17 JMK Iowa 97 Iowa 609 Holte Gray Main 209 DE/072/92 Chile 14 50/96‐Brazil 22/97‐Honduras A‐Vac1 B‐Vic S C‐N1/62 D‐N9/74 E‐01/73 F‐V2/71 G‐V1/71 H‐N1/75 I‐N2/75 J‐N3/63 K‐T1/82 L‐N1/88 M‐03/88 0‐NT2/89 P‐N1/81 Q‐V18/91 Adapted from: Ignjatovic, J. & Sapats, S. (2000) Avian Infectious Bronchitis virus. Rev. Sci. Tech. Off. int. Epiz.,19 2, pp. 493‐ 508. Data also from: de Wit et al (2010) Infectious bronchitis virus in Asia, Africa, Australia and Latin America ‐ history, current situation and control measures. Rev. Bras. Cienc. Avic. 12(2),pp.97‐106; de Wit et al (2011) Infectious bronchitis virus variants: a review of the history, current situation and control measures. Avian Pathology, 40(3),pp.223‐235; Jackwood, M. (2012) Review of Infectious Bronchitis Around the World. Avian Diseases, 56,pp.634‐641. The emergence and evolution of IBV variants can occur by: ‐Mutation ‐Recombination Shu‐Ming et al., (2013) Evolution of infectious bronchitis virus in Taiwan: Positively selected sites in the nucleocapsid protein and their effects on RNA‐binding activity. Vet Micro, 162(2), pp.408‐418. S1 gene sequencing & phylogenetic data reveal IBV diversity de Wit et al., (2011) Infectious bronchitis virus variants: a review of the history, current situation and control measures. Avian Pathology, 40(3),pp.223‐235 IBV variants have different properties Mutation Recombination IBV variants Variations in phenotype & genotype Virus Antigenicity & host Vaccinal interactions responses Virulence Tissue tropism Clinical signs Pathology After: Montassier, H.J. (2010) Molecular Epidemiology and Evolution of Avian Infectious Bronchitis Virus. Rev. Bras. Cienc. Avic. [online] 12(2)pp.87‐96 False layer syndrome Enlarged kidneys due to infection with a nephropathogenic IBV strain Images: AHVLA Vaccines are an important tool • Live attenuated vaccines eg. IBV, IBDV – Good protection if ‘match’ with same serotype in‐region – Variable/poor protection if infection with heterologous variant (or other causes of disease!) • Use of two different serotypes of live IBV vaccine (eg. Mass + variant) can provide broader protection and efficacy – Not always need a new vaccine; ‘Double live vaccine’ schedules – Live prime/inactivated boost schedules for breeders & layers • However, may not protect against all virus variants Cross‐protection between IBV strains varies with S1 gene homology de Wit et al., (2011) Infectious bronchitis virus variants: a review of the history, current situation and control measures. Avian Pathology, 40(3),pp.223‐235 Factors to consider: Vaccination & diversity • Vaccination – Must be properly administered – Can reduce the severity of clinical signs and mortality – Has best effect if there is a good antigenic match between vaccine and field virus: are new vaccines always needed? • Surveillance in vaccinated populations – Purpose? Virological vs. serological monitoring – Serology tests often not differentiate field and vaccine strains as based on conserved epitopes (unless DIVA strategy) Implications of viral variability: Diagnosis & control 1. Altered virulence & pathogenesis – Differences in the development and severity of pathology & clinical signs – R&D to understand implications for host, and detection approaches 2. Changes in antigenicity & immunogenicity – Virus: ‘Escape’ host immune responses – Host: Degree of vaccine protection vs. breaks in face of viral challenge 3. Challenges for diagnostic laboratory methods – Use of conserved regions for diagnostic tools, eg. ELISA, PCR – Disease criteria & definitions: internationally‐recognised standards Prevention & Control • Prompt veterinary investigation of flocks • Consider differential diagnoses and correct sampling • Robustly validated, appropriate & timely lab testing • Surveillance and R&D to understand viral diversity & implications • Information to support disease prevention & control decision‐making – Understanding epidemiology , risk pathways and control options – Appropriate vaccine selection (+ correct handling, storage, administration) • Biosecurity is good for your business Prevention & Control The most efficient and effective method for the control of infectious diseases in poultry is to prevent infection from entering the country, area, farm or flock Acknowledgements • Avian Virology & Mammalian Influenza Group, AHVLA Weybridge – Ian Brown, Dennis Alexander, Ruth Manvell, Jill Banks, Marek Slomka, Wendy Howard, Sharon Brookes, Brandon Londt, Scott Reid & teams • • • • • • • • Poultry industry, owners & keepers Private Veterinary Surgeons National & International laboratories & field staff Defra EU OIE FAO Merial Thank you for your attention [email protected]
© Copyright 2026 ExpyDoc