1 Supplementary Data Supplementary Materials and methods Materials The antibodies used were: Negative control IgG (Active Motif), HNF-1α, LXRα/β, βactin and PARP1/2 (Santa-Cruz), Mirk/Dyrk1B (Cell Signaling), HCV core mAb for immunofluorescence analysis (Alexis Biochemicals) and HCV NS5A (Biodesign International). The polyclonal antibodies for HCV core and core+1 have been published elsewhere [1S,14]. The human HNF-1α expression plasmid and the (929/+109) human ANGPTL-3 promoter construct were kind gifts from Prof. Hadzopoulou-Cladaras (Aristotle University of Thessaloniki, Greece) and Dr Delerive (GSK Research Laboratories), respectively. Huh7-Lunet and Huh7.5 cells were supplied from Dr R. Bartenschlager (University of Heidelberg, Germany). Plasmids Mutations on the (-89/-74) HNF-1α and (-114/-99) LXR cis-acting elements of the ANGPTL-3 promoter were carried out by standard site-directed mutagenesis, so that the sites were abolished without altering local promoter topology, according to transcription factor prediction analysis (see Suppl. Table 2). Construction of all expression plasmids coding for HCV proteins used in this study is outlined in Supplementary Table 1. All constructs were subjected to sequencing analysis. 2 Cells, Viruses and viral RNA analysis Maintenance of the human hepatoma HepG2, Huh7.5 and Huh7-Lunet cell lines has been outlined in [2S,3S,4S]. The construction of HCV-1a core-expressing cell line (C2-3) and empty vector control (pTRE), has been described elsewhere [2S]. Viral infections of Huh7.5 cells with the JFH-1 infectious clone were carried out essentially as described in [3S]. In vitro transcription of the pFK-JFH1wt full length construct and electroporation of Huh7-Lunet cells has been described elsewhere [4S]. All infections were carried out at MOI (multiplicity of infection) =1. mRNA Expression analysis Total RNA was isolated from human liver biopsies and cells using the RNeasy™ Micro and Mini kits (Qiagen), respectively. RT-PCR was carried out using 0.2-1µg RNA. For semi-quantitative PCR, all conditions were in the exponential phase of amplification providing direct correlation between the amount of products and RNA template abundance in the samples. PCR products were analysed on a 2%(w/v) agarose gel. Quantity-One software (BioRad) was employed for densitometric analysis and values were normalised to 28S rRNA to offer relative mRNA expression. For quantitative PCR, Maxima® SYBR green qPCR mix (Fermentas) and the Corbett Rotor Gene 6000 PCR machine were used. Results were analysed with the internal standard-curve method and normalised to 18S rRNA. All experiments were performed in triplicate and histograms were used for representation as described in the transfection analysis section. The specific gene primers used are shown in Supplementary Table 2. 3 Protein Analysis Cellular fractionation was performed with the ProteoJet™ Cytoplasmic and Nuclear Extraction kit (Fermentas). All fractions were analysed for fractionation efficiency by β-actin (cytoplasm) and PARP1/2 (nucleus) Western blotting. Whole cell extract preparation, total protein determination and Western blot analysis have been described elsewhere [5S]. Quantity-One software was used for densitometric analysis of bands and histograms were prepared as described in the transfection analysis section. ANGPTL-3 protein levels were determined using the ANGPTL-3 ELISA kit (Adipogen) according to the manufacturer’s instructions. For co-immunoprecipitation, whole cell extracts (500μg) were pre-cleared (1.5h, 4ºC) with Protein A/G agarose beads (Santa-Cruz). The pre-cleared supernatant was incubated overnight at 4ºC with 3μg/ml anti-HNF-1α antibody. The protein-antibody complex was captured on Protein A/G agarose beads at 4ºC for 3h. The beads were collected by centrifugation (14,000rpm, 5min) and after three washes with detergentfree whole cell extract buffer, they were separated on SDS-PAGE and analysed by Western blot. Chromatin Immunoprecipitation Assays (ChIP) ChIP analysis was performed using the ChIP-IT Express kit (Active Motif) according to the manufacturer’s instructions. The immunoprecipitated DNA fractions and input control were subjected to qPCR with primers spanning both the HNF-1α and LXR binding site of the ANGPTL-3 promoter, as suggested by the manufacturer (Suppl. Table 2). 4 Immunofluorescence Analysis Immunofluorescence and confocal microscopy were carried out as previously described [6S]. All experiments were performed in triplicate. Electrophoretic mobility shift assays (EMSA) EMSA was carried out essentially as described in [5S]. The radiolabelled oligonucleotides used spanned both the HNF-1α and LXR binding sites of ANGPTL3 promoter (Supplementary Table 2). 5 Supplementary Table 1. Information on construction of expression plasmids used in this study. Name Protein Coding Region Method of cloning pHPI1320 (c191) pHPI1800 (c173) pHPI1802 (c120) pHPI8130 HCV-1a core HCV-1a core HCV-1a core HCV-1a core Full length (1-191aa) 1-173aa pHPI8198 HCV-3a core HCV-3a core HCV-1b (Met91) core HCV-1b (Met91) core pHPI8184 pHPI8167 pHPI8164 pHPI1579 pHPI 1602 HCV-1a core+1/S HCV-1a NS3NS5B Cloned Vector NdeI fragment from SmaI /pCI pHPI1319 PCR from pHPI1320 SmaI /pCI 1-120aa - His NdeI-BstYI fragment tag from pHPI8130 1-120aa NdeI-BstYI fragment from pET 20b(+) (prokaryotic expression) Full length NheI-XbaI fragment (1-191aa) from pHPI8184 Full length PCR from 3T2 (1-191aa) (PUC19) Full length NheI-XbaI fragment (1-191aa) from pHPI8164 Full length (1-191aa) PCR from pHPI1589 in/ REF [7S] SmaI /pCI NheI-XbaI /pCI [8S] NheI-XbaI /pCI [9S] [10S] [11S] 6 Supplementary Table 2. Sequences of gene-specific primers used in various analyses. Primer Name Primer Sequence (5’3’) ANGF GATTTAGCATTGATCTAACTCAATGTGGAAGAAGG TTACATTCGTGCAA GAGGAACAATAAAAAGAAGGAGCTT GTTAACACGGCTATGGATTACTATGTTCACCTACC GGTAGGTGAACATAGTAATCCATAGCCGTGTTAAC CTAACTCAATGTGGAAGAGGGCCCCATTCGTGCAA GTTAACACG CGTGTTAACTTGCACGAATGGGGCCCTCTTCCACAT TGAGTTAG TCTATCGCTGCAAACCAGTG ANGCR mHNF-1F mHNF-1R mLXRF mLXRR ANGPTL-3F ANGPTL3-R qANGPTL3F qANGPTL3R qHNF-1αF qHNF-1αR qNS3-2aF qNS3-2aR ANGEF ANGER 28S rRNAF 28S rRNAR 18S rRNAF 18S rRNAR Mirk/Dyrk1B F Mirk/Dyrk1B R CGGTCTGGAGAAGGTCTTTG CCAGAACACCCAGAAGTAACT TCTGTGGGTTCTTGAATACTAGTC GTACTCAGCAGGCTGTGGCT TCTCCCCCAGTAAGGTCCAC CTGCCACCCTGGGGTTTGGG GCAGCCCCCATCGGCGAGAA GGAAGAAGGTTACATTCGTGCAAGTTAACACGGCT TAA CATAGTTAATCATTAAGCCGTGTTAACTTGCACGA ATG TGAACTATGCTTGGGCAGGG AGCGCCATCCATTTTCAGGG [10S] CTCAACACGGGAAACCTCAC CGCTCCACCAACTAAGAACG [11S] ATGACTACATCGTGCGCAGT ATAGGCTTTCACCACCTGGC Type of Analysis ChIP Mutagenesis Mutagenesis PCR qPCR qPCR qPCR EMSA PCR qPCR qPCR 7 Supplementary References [1S] Budkowska A, Kakkanas A, Nerrienet E, Kalinina O, Maillard P, Horm SV, et al. Synonymous mutations in the core gene are linked to unusual serological profile in hepatitis C virus infection. PLoS One 2011;6:e15871. [2S] Katsarou K, Tsitoura P, Georgopoulou U. MEK5/ERK5/mef2: a novel signalling pathway affected by hepatitis C virus non-enveloped capsid-like particles. Biochim Biophys Acta 2011;1813:1854-1862. [3S] Kato T, Date T, Murayama A, Morikawa K, Akazawa D, Wakita T. Cell culture and infection system for hepatitis C virus. Nat Protoc 2006;1:22334-22339. [4S] Lohmann V. HCV replicons: Overview and basic protocols. In: Tang H ed. Hepatitis C: Methods and Protocols Volume 510, 2nd ed. Humana Press 2009:145162. [5S] Foka P, Irvine SA, Kockar F, Ramji DP. Interleukin-6 represses the transcription of the CCAAT/enhancer binding protein-alpha gene in hepatoma cells by inhibiting its ability to autoactivate the proximal promoter region. Nucleic Acids Res 2003;31:6722-6732. [6S] Katsarou K, Lavdas AA, Tsitoura P, Serti E, Markoulatos P, Mavromara P,et al. Endocytosis of hepatitis C virus non-enveloped capsid-like particles induces MAPKERK1/2 signaling events. Cell Mol Life Sci 2010;67:2491-2506. 8 [7S] Tsitoura P, Georgopoulou U, Pêtres S, Varaklioti A, Karafoulidou A, Vagena D, et al. Evidence for cellular uptake of recombinant hepatitis C virus non-enveloped capsid-like particles. FEBS Lett. 2007;581:4049-4057. [8S] Karamitros T, Kakkanas A, Katsoulidou A, Sypsa V, Dalagiorgou G, Mavromara P, Hatzakis A. Detection of specific antibodies to HCV-ARF/CORE+1 protein in patients treated with pegylated interferon plus ribavirin. J Viral Hepat 2012;19:182188. [9S] Boumlic A, Vassilaki N, Dalagiorgou G, Kochlios E, Kakkanas A, Georgopoulou U, Markoulatos P, et al. Internal translation initiation stimulates expression of the ARF/core+1 open reading frame of HCV genotype 1b. Virus Res 2011;155:213-220. [10S] Kong SE, Hall JC, McCauley RD. Estimation of gene expression within the intestinal mucosa using semiquantitative reverse transcriptase-polymerase chain reaction. Anal Biochem 1999;271:111–114. [11S] Tsitoura E, Thomas J, Cuchet D, Thoinet K, Mavromara P, Epstein AL. Infection with herpes simplex type 1-based amplicon vectors results in an IRF3/7dependent, TLR-independent activation of the innate antiviral response in primary human fibroblasts. J Gen Virol 2009;90:2209-2220. 9 Supplementary Figure legends Supplementary Fig. 1. (A) EMSA analysis of factors binding to an oligonucleotide containing the HNF-1α and LXR sites of the ANGPTL-3 promoter using nuclear extracts from pTRE/C2-3 cells. The free probe (FP) is shown by a labelled arrow to verify equal loading. (B1-B2) Overexpression of HNF-1α in pTRE/C2-3 HepG2 cells does not alleviate core-mediated down-regulation of ANGPTL-3 promoter activity. Cells were transfected with pANGPTL-3 promoter, pCI (V), HNF-1α and c191 (in HepG2 cells) expression plasmids. (C1-C2) Densitometric analysis of Western blots presented in Fig.2E1-E2 in HepG2 (C1) and pTRE/C2-3 (C2) cells. (D1). ANGPTL-3 mRNA levels in Huh7-Lunet cells transfected with JFH-1 full length replicon RNA at given time points. (D2) NS3 expression was used to monitor replication efficiency. Supplementary Fig. 2. (A) Comparative amino-acid sequence analysis of core proteins of genotypes 1a, 1b and 3a. (B) Long-term infection of Huh7.5 cells with the JFH-1 clone. Isolated RNA was subjected to qRT-PCR with HNF-1α and ANGPTL3-specific primers and compared to mock-infected cells. (d = days). Supplementary Fig. 3. (A) HepG2 cells co-transfected with pANGPTL-3 promoter and c191 expression plasmid or vector pCI (V), were subjected to treatment with the proteasomal inhibitor MG-132 (MG) or vehicle (D) for 8h. (B) Cellular extracts from the transfection described in (A) were subjected to immunoblotting with anti-HNF-1α and β-actin antibodies. Densitometric analysis of bands is presented underneath, with HNF-1α values normalised to β-actin. (C) RNA from Huh7.5 cells infected with the JFH-1 clone for the indicated time points was subjected to qRT-PCR with Mirk/Dyrk1B-specific primers.
© Copyright 2026 ExpyDoc