Supplemental Information Cell Metabolism, Volume 14 Proatherogenic Abnormalities of Lipid Metabolism in SirT1 Transgenic Mice Are Mediated through Creb Deacetylation Li Qiang, Hua V. Lin, Ja Young Kim-Muller, Carrie L. Welch, Wei Gu, and Domenico Accili 1 Figure S1. Characterization of SirBACO:Ldlr–/– Mice (A-H) Metabolic parameters in SirBACO:Ldlr-/- mice on normal chow (A-D) (n=9-11 each) and WTD (E-H) (n=18-24 each). (I) Necrotic core area measurements of aortic root lesions (n=6-8 each). (J) Western blot analysis of insulin-induced Akt phosphorylation in livers of WTD-fed mice. Animals were fasted overnight and stimulated with insulin for the indicated times. Data are expressed as means ± SEM. 2 Figure S2. Effects of WTD Feeding on SirBACO Mice (A) Western blot analysis of liver extracts from SirT1–/– (KO) and control (WT) mice on normal chow. Dbc1 is used as a loading control. (B-C) Blood glucose (B), cholesterol, and TG levels (C) in chow-fed mice (n=5 each). (D) Plasma insulin levels during IPGTT shown in Figure 2C (n=5-6 each). (E-F) Plasma cholesterol and FFA levels in WTD-fed mice (n=10-11 each). (G) Hepatic de novo lipogenesis in SirBACO mice after 2 weeks on WTD (n=5 each). (H) Q-PCR analysis of hepatic gene expression in WTD-fed mice (*=P<0.05, n=5 each). Data are expressed as means ± SEM. 3 Figure S3. SirT1 Inhibits Creb Activity during Fasting (A) Quantification of western blots in Figure 3A (**=P<0.01, *=P<0.05, n=4). Data are expressed as means ± SEM. (B) Western blots of liver proteins in refed SirBACO mice after 2 weeks WTD. (C) Creb acetylation in refed SirBACO mouse liver. (D) H&E staining of liver sections from mice sacrificed at the indicated times of fasting and refeeding after 2 weeks on WTD. (E) Q-PCR analysis for hepatic metabolic gene expression in refed SirBACO mice after 2 weeks WTD feeding (*=P<0.05, n=5). (F) Expression of ER stress genes in SirBACO mice after 2 weeks on WTD (*=P<0.05, n=5). Data are expressed as means ± SEM. 4 Figure S4. SirT1 Deacetylase Activity Is Required for Creb Inhibition (A) Western blot analysis of Creb phosphorylation in 293 cells pretreated with nicotinamide (5 mM) or EX527 (5 M) for 1 hr, and then exposed to 5 mM forskolin for the indicated times. (B) Q-PCR analysis of gene expression in McA-RH7777 cells. Cells were treated with EX527 and serum-deprived overnight, and then treated with 20 M forskolin or 400 nM insulin for 6 hours (**=P< 0.01, *=P<0.05 vs. DMSO, n=3). 5 (C) Q-PCR analysis of gene expression in McA-RH7777 cells infected with GFP (blue bars) or SirT1 (red bars) adenovirus at MOI=1. Cells were deprived of serum overnight, and then treated with 20 M forskolin or 400 nM insulin for 6 hours (**=P< 0.01, *=P<0.05 vs. GFP, n=3). (D) Western blot analysis in 293 cells overexpressing FLAG-tagged Creb-M1 in combination with Cbp or SirT1. (E) Western blot analysis of 293 cells overexpressing FLAG-tagged Creb in combination with Cbp and GFP-tagged wild-type SirT1 (WT) or its dominant negative mutant HY. Cells were treated with 10 M EX527 overnight. (F) Western blots analysis in 3T3-L1 adipocytes stably overexpressing GFP-tagged wildtype (WT) or dominative-negative mutant SirT1-H355Y (HY). We used sepharose beads-conjugated Creb antibody (Cell Signaling) for immunoprecipitation. Data are expressed as means ± SEM. 6 Figure S5. Lys136 Is a SirT1 Substrate (A) Amino acid sequence alignment of Creb homologs. (B) 293 cells were transiently transfected with wildtype, K136Q or K136R Creb, incubated overnight with 10 M EX527 and harvested for western blot analysis. (C) Q-PCR analysis of gene expression in McA-RH7777 cells transfected with GFP, WT Creb, or K136Q Creb. Cells were incubated overnight in serum-free medium, then treated with 20 M forskolin or 400 nM insulin for 6 hr. (*= P<0.05, **= P<0.01, WT or K136Q vs. GFP; #=P<0.05, ##= P<0.01 K136Q vs. WT) (n=3). (D-G) C57BL/6J mice transduced with GFP, wild-type Creb (Ad-Creb) or K136Q (AdK136Q) adenovirus were fed on WTD for 1 week. IPGTT (D), blood glucose (E), total 7 cholesterol (F) and free fatty acids (FFA) (G) in overnight-fasted and 4-hr re-fed mice (n=6-7). Data are expressed as means ± SEM. 8 Figure S6. Effect of Creb K136Q Mutant in WTD-Fed SirBACO Mice SirBACO mice and control littermates (WT) were transduced with wild-type or K136Q mutant Creb adenovirus and then fed with WTD for 2 weeks prior to analysis of plasma cholesterol (A) and FFA (B) levels and body composition (**= P<0.01, n=7-9). Data are expressed as means ± SEM. 9 Table S1. Q-PCR Primer Sequences Gene Primer (5’-3’) Acc1 Forward: AGCAGATCCGCAGCTTG Reverse: ACCTCTGCTCGCTGAGTGC Acc2 Forward: ACAGAGATTTCACCGTTGCGT Reverse: CGCAGCGATGCCATTGT Acox1 Forward: GTGCAGCTCAGAGTCTGTCCAA Reverse: TACTGCTGCGTCTGAAAATCCA Adrp Forward: CTTGTGTCCTCCGCTTATGTCAGT Reverse: CTGCTCCTTTGGTCTTATCCACCA Cd36 Forward: TTGGCCAAGCTATTGCGACA Reverse: GCAAAGGCATTGGCTGGAAG C/ebpα Forward: GGACAAGAACAGCAACGAGTA Reverse: GCAGTTGCCATGGCCTTGA Chrebp Forward: AGAACCGACGTATCACACACATCT Reverse: CAGGGTGTCGAATCCTAGCTTAA Cpt1a Forward: TGCACTACGGAGTCCTGCAA Reverse: GGACAACCTCCATGGCTCAG Creb Forward: GGGCCGCGAACGAAA Reverse: CTCCAGATTCCATGGTCATTTAGTT Cycophilin A Forward: TATCTGCACTGCCAAGACTGAGTG Reverse: CTTCTTGCTGGTCTTGCCATTCC Dgat2 Forward: AGTGGCAATGCTATCATCATCGT Reverse: TCTTCTGGACCCATCGGCCCCAGGA Fas Forward: CTGACTCGGCTACTGACACG Reverse: TGAGCTGGGTTAGGGTAGGA G6pase Forward: GTCTGGATTCTACCTGCTAC Reverse: AAAGACTTCTTGTGTGTCTGTC Igfbp1 Forward: AGATCGCCGACCTCAAGAAAT Reverse: CTCCAGAGACCCAGGGATTTT Insig2a Forward: CCCTCAATGAATGTACTGAAGGATT Reverse: TGTGAAGTGAAGCAGACCAATGT Irs2 Forward: TCCAGAACGGCCTCAACTAT Reverse: AGTGATGGGACAGGAAGTCG Lxrα Forward: AGGAGTGTCGACTTCGCAAA Reverse: CTCTTCTTGCCGCTTCAGTTT Lxrβ Forward: AAGCAGGTGCCAGGGTTCT Reverse: TGCATTCTGTCTCGTGGTTGT Mtp Forward: GGGATCTCTGGGAAATTCAACAGTG Reverse: GTGAGCAGAGCTTCTGGTAGCAAAC 10 Nor1 Forward: TCAGCCTTTTTGGAGCTGTT Reverse: TGAAGTCGATGCAGGACAAG Nur77 Forward: TGATGTTCCCGCCTTTGC Reverse: CAATGCGATTCTGCAGCTCTT Nurr1 Forward: AACATCGACATTTCTGCCTTCTC Reverse: TCTTGGGTTCCT TGA GCC C Pcsk9 Forward: AGCATGGGATCTCAGGTCCTTC Reverse: TCTCCACTGGTCCTGTCTGCTC Pdk4 Forward: TTCCATGAGAAGAGCCCAGAAG Reverse: ATCCGAGTAGAAATGCGGTTCA Pepck Forward: CCTGGAAGAACAAGGAGTGG Reverse: AGGGTCAATAATGGGGCACT Pgc1α Forward: CCCTGCCATTGTTAAGACC Reverse: TGCTGCTGTTCCTGTTTTC PPARα Forward: GGGTACCACTACGGAGTTCACG Reverse: CAGACAGGCACTTGTGAAAACG Pparγ Forward: GTGCCAGTTTCGATCCGTAGA Reverse: GGCCAGCATCGTGTAGATGA Rxrα Forward: ACATGCAGATGGACAAGACG Reverse: GGGTTTGAGAGCCCCTTAGA Scd1 Forward: CTCCTGCTGATGTGCTTCAT Reverse: AGGGTGCTAACGAACAGGCT SirT1 Forward: GATGACGATGACAGAACGTCACA Reverse: GGATCGGTGCCAATCATGAG Srebp-1c Forward: GAAGCTGTCGGGGTAGCGTCT Reverse: CTCTCAGGAGAGTTGGCACCTG Srebp-2 Forward: GATGATCACCCCGACGTTCAG Reverse: GTACCGTCTGCACCTGCTGCT s-Xbp1 Forward: GAGTCCGCAGCAGGTG Reverse: GTGTCAGAGTCCATGGGA Erdj4 Forward: CCCCAGTGTCAAACTGTACCAG Reverse: AGCGTTTCCAATTTTCCATAAATT Edem Forward: AAGCCCTCTGGAACTTGCG Reverse: AACCCAATGGCCTGTCTGG Sec61a Forward: CTATTTCCAGGGCTTCCGAGT Reverse: AGGTGTTGTACTGGCCTCGGT Bip Forward: ACATCTCGGACTGTGATGAAAC Reverse: GATGGCATACACGGGGGAATA Chop Forward: GTCCCTAGCTTGGCTGACAGA Reverse: TGGAGAGC GAGGGCTTTG Rat 36B4 Forward: TTCCCACTGGCTGAAAAGGT Reverse: CGCAGCCGCAAATGC 11 Rat Acc1 Forward: CAGGATGGTTTGGCCTTTCAC Reverse: TTTCTTTCTGTCTCGACCTTGTTTTACT Rat Acc2 Forward: GCTTTGGAGGCAACAGGGTTAT Reverse: CCGCAGCGATACCATTATTGG Rat Dagt2 Forward: GGAACCGCAAAGGCTTTGTA Reverse: AATAGGTGGGAACCAGATCAGC Rat Fas Forward: GACCCTGACTCCAAGTTATTCGA Reverse: CGTCAAGCGGGAGACAGACT Rat G6pase Forward: TGAAACTTTCAGCCACATCCG Reverse: GCAGGTAAAATCCAAGTGCGAA Rat Igfbp1 Forward: GATCACTGACCTCAAGAAATGGAA Reverse: GCGGCACGTAATCTCTCTAACA Rat Il-1α Forward: AAGACAAGCCTGTGTTGCTGAAGG Reverse: TCCCAGAAGAAAATGAGGTCGGTC Rat Il-6 Forward: TCCTACCCCAACTTCCAATGCTC Reverse: TTGGATGGTCTTGGTCCTTAGCC Rat Irs2 Forward: CCACACGCCTTTCGCTAGA Reverse: GTACCCCCTTCACCAAAGTCAA Rat Pepck Forward: AGTCACCATCACTTCCTGGAAGA Reverse: GGTGCAGAATCGCGAGTT Rat Pparγ Forward: CTTGGCCATATTTATAGCTGTCATTATT Reverse: TGTCCTCGATGGGCTTCAC Rat Scd1 Forward: AAGATATCCACGACCCCAGCTA Reverse: TGCAGCAGGGCCATGAG Rat Srebp-1c Forward: GGAGCCATGGATTGCACATT Reverse: AGGCCAGGGAAGTCACTGTCT Rat Tnfα Forward: AAATGGGCTCCCTCTCATCAGTTC Reverse: TCTGCTTGGTGGTTTGCTACGAC 12
© Copyright 2026 ExpyDoc