Supporting Information Sun et al. 10.1073/pnas.1318114111 SI Materials and Methods Metabolic Phenotyping and Tissue Collection. Food intake was mea- sured every other day by weighing the food pellets in the cage. Ad libitum blood glucose was measured at 9:30 AM every 2 d using TRUEresult Glucometer (Nipro Diagnostics). Rectal temperatures of mice were measured after overnight fasting using a thermometer (Alpha Technics, model 4600). Metabolic cage analysis was performed with a Comprehensive Lab Animal Monitoring System (CLAMS, Columbus Instruments) with 1-d acclimation followed by 2-d measurement. Euthanization was performed by cervical dislocation. Tissues were immediately harvested and either fixed in 10% neutralized formalin for histology or snap-frozen in liquid nitrogen for Western blot analyses. Frozen tissues were stored at −80 °C. Intralipid Gavage. Mice were fasted overnight and gavaged with intralipid (20% fat emulsion, Baxter 2B6023) at 20 μL/g body weight. Blood plasma was collected before and 1.5 h after the gavage. Triglyceride levels in the plasma were measured using the Triglyceride Determination Kit (Sigma-Aldrich TR0100) following the manufacture’s instructions. Oil-Red O Staining of Fecal Smear. Fat malabsorption (steatorrhea) was detected by Oil-Red O staining of fecal smear as previously described (1). Fecal samples were collected from mice at day 13. Fecal samples from mice on 60% high-fat diet (Research Diets D12492) for 2 mo were used as a positive control. Multiplex Assay and ELISA. Blood plasma was collected from mice under ad libitum at day 13 and analyzed with Bio-plex Pro mouse diabetes panel 8-plex system (Bio-Rad 171-F7001M) per the supplier’s protocols. Additionally, plasma insulin levels were measured using the mouse insulin ELISA kit (Crystal Chem 90080) per the supplier’s protocols. Pancreatic Enzymatic Activity. Tissue enzymatic activities were analyzed at day 13; 20-mg tissue from each sample was homogenized on ice by Dounce homogenizer with 200 μL saline. After centrifugation, supernatant was diluted 20- or 50-fold for lipase or amylase activity assays, respectively, with kits from Biotron Diagnostics Inc. (catalog nos. 47C and 17C). Tissue Lysate Preparation, Western Blot, and Quantitation. Preparation of cell and tissue lysates, subcellular fractions, and Western blot were performed as previously described (2, 3). Antibodies used in this study were: heat shock protein 90 (HSP90) (rabbit, 1:6,000), 78kDa glucose-regulated protein (GRP78) (goat, 1:1,000), apoptosis regulator Bcl-2 (rabbit, 1:1,000), pancreatic lipase (goat, 1:1,000), DNA-damage inducible transcript 3 (CHOP) (mouse, 1:500), ER degradation enhancer, mannosidase alpha-like 1 (EDEM1) (goat, 1:1,000), endoplasmic reticulum lectin 1 (XTP3B) 1. Harding HP, et al. (2001) Diabetes mellitus and exocrine pancreatic dysfunction in perk−/− mice reveals a role for translational control in secretory cell survival. Mol Cell 7(6):1153–1163. 2. Sha H, et al. (2009) The IRE1alpha-XBP1 pathway of the unfolded protein response is required for adipogenesis. Cell Metab 9(6):556–564. 3. Yang L, et al. (2010) A Phos-tag-based approach reveals the extent of physiological endoplasmic reticulum stress. PLoS ONE 5(7):e11621. Sun et al. www.pnas.org/cgi/content/short/1318114111 (goat, 1:1,000) from Santa Cruz; PKR-like endolplasmic reticulum kinase (PERK; rabbit, 1:1,000), (p-S51)-eukaryotic translation initiation factor 2a (eIF2α) (rabbit, 1:2,000), Microtubule-associated proteins 1A/1B light chain 3B (LC3B) (rabbit, 1:1,000), (p)-S6K and S6 (1:1,000) from Cell Signaling; Suppressor/Enhancer of Lin-12-like (Sel1L) (rabbit, 1:2,000), α-Amylase (rabbit, 1:5,000), amplified in osteosarcoma 9 (OS9) (rabbit, 1:10,000) from Abcam; hydroxymethylglutaryl reductase degradation protein 1 (Hrd1) (rabbit, 1:8,000), glyceraldehyde-3-phosphoate dehydrogenase (GAPDH) (mouse, 1:40,000) from Novus Biologicals; protein disulfide isomerase 1 (Pdia1) (rabbit, 1:10,000), GRP58 (rabbit, 1:2,000) from Assay Design. cAMP-responsive element binding protein (CREB) (rabbit, 1:10,000) was a kind gift from Marc Montminy (Salk Institute, San Diego). Bag6 and H2A (4) were generously provided by Yihong Ye (National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda). Band density was quantitated using the Image Lab software on the ChemiDOC XRS+ system (BioRad). Protein levels were normalized to HSP90 and presented as mean ± SEM unless otherwise specified. Linear regression line analysis shown in Fig. 3F was performed using Graphpad Prism software and the goodness of fit was represented by R2 value. Datapoints were collected from various tissue and cell samples (pancreas, gut, kidney and mouse embryonic fibroblasts) in several independent experiments, including all those shown in this report. TUNEL and Confocal Analysis. Paraffin-embedded pancreas tissue sections were rehydrated, treated with protease K, and stained for 1 h at 37 °C using the in Situ Death Detection TUNEL Kit (Roche 11684795910). The fluorescence was visualized and images were captured under a Zeiss LSM710 confocal microscope with 10× magnification at Cornell Biotechnology Resource Center Imaging Facility. For quantitation of TUNEL-positive cells, 40 views were randomly chosen under 20× magnification from WT and Sel1LIKO pancreas and TUNEL-positive cells were counted as a blind study. Image Quantitation. Size of pancreatic granules in WT and Sel1LIKO mice was measured from transmission electron microscope pictures using ImageJ (National Institute of Health). A scale was set for a known distance of 2 μm and 100 granules were randomly chosen from WT and Sel1LIKO pancreas as a blind study, outlined with oval or elliptical selection tool and measured for perimeter (micrometer) and area (square micrometer) (5). For Ki-67 quantitation, the number of pancreatic Ki-67+ nucleus on immunostained tissue sections was measured by randomly selecting a total of 30 ∼45,000-μm2 centrally located areas from each genotype (n = 3 mice each genotype) and visually counting the Ki-67+ cells as a blind study. The results were then calculated as the average number of Ki-67+ cells per area. 4. Wang Q, et al. (2011) A ubiquitin ligase-associated chaperone holdase maintains polypeptides in soluble states for proteasome degradation. Mol Cell 42(6): 758–770. 5. Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9(7):671–675. 1 of 10 C 1.0 + + + - + - - Cre f/f 57.5 58 f/f;cre+ 57.5 57 B 30 IKO 0.6 0.45 Heat (kcal/h) f/f;cre- * * * 0.9 0.8 0.7 expected observed 0.40 * 0.35 * 0.30 0.25 0.20 20 f/f;ERCre- 10 f/f;ERCre+ 0 4 8 12 16 8000 6000 * * 4000 2000 0 1 29 201 22 2 234 1 2 3 4 5 6 7 8 190 11 12 13 14 15 1 176 1 189 2 210 22 2 243 1 2 3 4 5 6 7 8 190 11 12 13 1 154 1 16 178 19 Age (week) Activity (count/h) Body weight (g) WT 1.1 Cre RER Genotyping results A Time (h) Fig. S1. Characterization of acute Sel1L knockout mice. (A) Genotyping of f/f;ERCre− and f/f;ERCre+ mice by PCR. (Lower) Observed genotypes in the offsprings. (B) Growth curve without tamoxifen injections. (C ) Metabolic cage study of WT and inducible knockout mouse (IKO) mice from day 10–12. RER, respiratory exchange ratio. n = 4 each. Data are mean ± SEM. *P < 0.05 by Student t test. E IKO Small intestine WT 100µm IKO 100µm Lung B WT Skeletal muscle A 100µm 300µm C Liver F 100µm Heart 100µm BAT D 100µm 100µm Fig. S2. (A–F) Tissue histology of Sel1LIKO mice. H&E images of various tissues from WT and IKO mice at day 8. Sun et al. www.pnas.org/cgi/content/short/1318114111 2 of 10 A B C WT 50 m Insulin IKO WT IKO 100 m 100 m 100 m 100 m Glucagon 100 80 60 40 20 0 Glucagon IKO d13 Serum level (pg/mL) Insulin 500 400 300 200 100 0 WT IKO Fig. S3. Sel1LIKO mice develop exocrine pancreatic insufficiency and nutrient malabsorption. Mice were analyzed at 13 d after the first tamoxifen injection. (A) H&E images of IKO pancreas, showing lymphocyte infiltration. Arrows indicates neutrophils and lymphocytes. n = 3–5 each group. (B) Plasma insulin and glucagon levels. n = 5 each. (C) Representative immunohistochemical staining of insulin and glucagon on the pancreatic sections. n = 3–5 each group. B C Downregulated Upregulated A WT IKO BC021614 Cox6a2 Tenm4 Krtap4-16 Bglap3 Gdf15 Rgs2 Paqr3 Angptl6 Ddit3 Soat2 Trib3 Hmgcs2 Acot2 B4galnt2 Ahsg Ndnf Cps1 Fetub 1810009J06Rik Cdhr2 Fxyd6 Slc30a2 Muc1 Dpp7 Fat3 Aldh1a7 Cryab Susd2 Gpc1 Fxyd1 Vtn Hamp2 Lcat Gm13011 Gal Pgf 2210404O07Rik Shank1 Upp2 Fig. S4. Microarray analysis of the pancreas. Pancreas were harvested at day 13. (A) Images showing high quality of pancreatic total RNA analyzed by Agilent Bioanalyzer. Two peaks represent 18S and 28S ribosomal RNA. RIN: RNA integrity number. RIN on a scale of 1–10 (1 = lowest; 10 = highest). (B) Heat map showing the top 20 genes that were either up-regulated or down-regulated in IKO pancreas. Red arrows, unfolded protein response (UPR) genes. (C) Ingenuity analysis of the microarray data showing that the transcription factors involved in lipid metabolism were activated in IKO pancreas. Sun et al. www.pnas.org/cgi/content/short/1318114111 3 of 10 TUNEL+DAPI B IKO Bcl-2 25 I II 15 LC3B Bcl-2 1.5 2.0 LC3BII/I 1.5 1.0 1.0 0.5 0.0 * WT IKO 0.5 0.0 25 m WT IKO IKO WT * Ki67+ cell count 250 m Relative protein levels (a.u.) Positive control HSP90 D Ki67 C IKO WT Negative control A 50 m 100 m 15 10 5 0 *** WT IKO IKO Fig. S5. Increased cell death and decreased proliferation in the exocrine pancreas of Sel1L mice. Pancreas were harvested at day 13. (A) Positive and negative controls of the TUNEL staining. IKO pancreas section incubated with TUNEL reaction without dTd enzyme served as a negative control. Small intestinal collected 24 h after 10-Gy irradiation were used as a positive control. (B) Western blot of Bcl-2 and LC3B cleavage with quantification below. (C) H&E images of cell death in the exocrine pancreas of IKO mice (arrows). n = 3 samples. (D) Immunohistochemistry staining of Ki-67 in WT and IKO pancreatic sections. Quantitation of Ki-67 from 40 random views under 20× magnification shown on the right (n = 3 mice each). Asterisk denotes an islet in the image. Data are mean ± SEM. *P < 0.05, ***P < 0.01 by Student t test. Representative data of two experiments shown. Sun et al. www.pnas.org/cgi/content/short/1318114111 4 of 10 Table S1. Complete hits identified by LC-MS/MS analysis of the soluble aggregates from NP-40–solubilzed pancreatic lysates of WT and Sel1LIKO mice shown in Fig. 6C WT_seq coverage (%) IKO_spe ctra counts 2 6.20 111 38.40 64 1 8.10 4.60 42 40 8.10 33.00 2 9.00 31 33.00 30 30 0 11.30 7.40 0 24 19 17 8.20 5.00 9.40 spjP84099jRL19_MOUSE 2 13.30 16 13.80 spjP35980jRL18_MOUSE 2 12.80 16 30.30 spjQ569Z5jDDX46_MOUSE 6 7.40 14 14.60 spjP62754jRS6_MOUSE 2 10.80 13 20.50 spjP47963jRL13_MOUSE 0 0 11 34.60 spjQ8VH51jRBM39_MOUSE 3 8.10 10 18.30 trjF7DBB3jF7DBB3_MOUSE 7 4.40 10 6.30 spjQ6ZWV7jRL35_MOUSE 0 0 10 18.70 spjP19253jRL13A_MOUSE 0 0 9 26.10 spjP43277jH13_MOUSE spjQ99PL5jRRBP1_MOUSE 0 14 0 6.80 9 9 22.60 7.20 spjP11276jFINC_MOUSE spjA2AN08jUBR4_MOUSE 12 26 7.70 6.00 8 8 4.20 2.20 spjO88492jPLIN4_MOUSE trjF7CVJ5jF7CVJ5_MOUSE 0 7 0 6.60 8 8 8.30 7.00 spjQ8CGN5jPLIN1_MOUSE spjQ8BTI8jSRRM2_MOUSE 0 8 0 5.10 8 8 16.20 4.30 spjP43274jH14_MOUSE trjE9PYB0jE9PYB0_MOUSE 0 5 0 4.20 8 8 22.80 4.50 trjE9PVY8jE9PVY8_MOUSE 0 0 8 1.50 spjP62242jRS8_MOUSE 0 0 7 30.80 spjP47911jRL6_MOUSE 0 0 7 19.60 trjD3YU93jD3YU93_MOUSE 0 0 7 20.00 trjE9QAZ2jE9QAZ2_MOUSE 0 0 7 25.50 spjQ9CR57jRL14_MOUSE 0 0 7 21.70 trjE9QAS5jE9QAS5_MOUSE 0 0 6 3.10 spjQ05D44jIF2P_MOUSE 0 0 6 6.60 Accession spjQ9D8E6jRL4_MOUSE trjQ9Z1R9jQ9Z1R9_MOUSE spjQ6ZWN5jRS9_MOUSE trjF6XI62jF6XI62_MOUSE trjA2AQ53jA2AQ53_MOUSE trjE9Q616jE9Q616_MOUSE spjO09167jRL21_MOUSE WT_sp ectra counts Sun et al. www.pnas.org/cgi/content/short/1318114111 IKO_seq coverage (%) Description 60S ribosomal protein L4 OS = Mus musculus GN = Rpl4 PE = 1 SV = 3 MCG124046 OS = Mus musculus GN = Prss1 PE = 2 SV = 1 40S ribosomal protein S9 OS = Mus musculus GN = Rps9 PE = 2 SV = 3 60S ribosomal protein L7 (Fragment) OS = Mus musculus GN = Rpl7 PE = 3 SV = 1 Fibrillin 1 OS = Mus musculus GN = Fbn1 PE = 4 SV = 1 Protein Ahnak OS = Mus musculus GN = Ahnak PE = 4 SV = 1 60S ribosomal protein L21 OS = Mus musculus GN = Rpl21 PE = 2 SV = 3 60S ribosomal protein L19 OS = Mus musculus GN = Rpl19 PE = 1 SV = 1 60S ribosomal protein L18 OS = Mus musculus GN = Rpl18 PE = 2 SV = 3 Probable ATP-dependent RNA helicase DDX46 OS = Mus musculus GN = Ddx46 PE = 1 SV = 2 40S ribosomal protein S6 OS = Mus musculus GN = Rps6 PE = 1 SV = 1 60S ribosomal protein L13 OS = Mus musculus GN = Rpl13 PE = 2 SV = 3 RNA-binding protein 39 OS = Mus musculus GN = Rbm39 PE = 1 SV = 2 Protein Ahnak2 (Fragment) OS = Mus musculus GN = Ahnak2 PE = 4 SV = 1 60S ribosomal protein L35 OS = Mus musculus GN = Rpl35 PE = 2 SV = 1 60S ribosomal protein L13a OS = Mus musculus GN = Rpl13a PE = 1 SV = 4 Histone H1.3 OS = Mus musculus GN = Hist1h1d PE = 1 SV = 2 Ribosome-binding protein 1 OS = Mus musculus GN = Rrbp1 PE = 2 SV = 2 Fibronectin OS = Mus musculus GN = Fn1 PE = 1 SV = 4 E3 ubiquitin-protein ligase UBR4 OS = Mus musculus GN = Ubr4 PE = 1 SV = 1 Perilipin-4 OS = Mus musculus GN = Plin4 PE = 1 SV = 2 Protein Ahnak2 (Fragment) OS = Mus musculus GN = Ahnak2 PE = 4 SV = 1 Perilipin-1 OS = Mus musculus GN = Plin1 PE = 1 SV = 2 Serine/arginine repetitive matrix protein 2 OS = Mus musculus GN = Srrm2 PE = 1 SV = 3 Histone H1.4 OS = Mus musculus GN = Hist1h1e PE = 1 SV = 2 Protein Ahnak2 (Fragment) OS = Mus musculus GN = Ahnak2 PE = 4 SV = 1 Microtubule-actin cross-linking factor 1 OS = Mus musculus GN = Macf1 PE = 4 SV = 2 40S ribosomal protein S8 OS = Mus musculus GN = Rps8 PE = 1 SV = 2 60S ribosomal protein L6 OS = Mus musculus GN = Rpl6 PE = 1 SV = 3 Uncharacterized protein OS = Mus musculus GN = Rpl7a-ps3 PE = 4 SV = 2 Ribosomal protein L15 OS = Mus musculus GN = Gm10020 PE = 3 SV = 1 60S ribosomal protein L14 OS = Mus musculus GN = Rpl14 PE = 2 SV = 3 Chromodomain-helicase-DNA-binding protein 4 OS = Mus musculus GN = Chd4 PE = 4 SV = 1 Eukaryotic translation initiation factor 5B OS = Mus musculus GN = Eif5b PE = 1 SV = 2 5 of 10 Table S1. Cont. Accession WT_sp ectra counts WT_seq coverage (%) IKO_spe ctra counts IKO_seq coverage (%) spjP62960jYBOX1_MOUSE 0 0 5 14.60 spjP23116jEIF3A_MOUSE 0 0 5 4.10 trjD3Z0M9jD3Z0M9_MOUSE 0 0 4 4.50 spjQ9QXS1jPLEC_MOUSE spjQ7TNC4jLC7L2_MOUSE 0 1 0 3.80 4 4 1.20 12.50 spjA2AJI0jMA7D1_MOUSE 0 0 4 4.60 trjF8WJ05jF8WJ05_MOUSE 1 1.60 4 6.50 spjP0CG50jUBC_MOUSE spjP62855jRS26_MOUSE 3 0 1.20 0 4 4 2.20 20.90 spjP41105jRL28_MOUSE 0 0 4 27.70 trjE9PZ16jE9PZ16_MOUSE 8 2.50 4 1.00 spjQ9JKB3jDBPA_MOUSE 0 0 4 13.00 spjP62892jRL39_MOUSE 0 0 4 19.60 spjP07724jALBU_MOUSE spjQ8BP67jRL24_MOUSE 2 0 4.10 0 4 4 6.40 25.50 trjQ9CPN9jQ9CPN9_MOUSE 1 4.90 3 7.70 spjQ9DAM7jCL023_MOUSE 0 0 3 31.30 spjP62717jRL18A_MOUSE 0 0 3 19.90 spjQ3TEA8jHP1B3_MOUSE 0 0 3 6.50 trjE9QKG5jE9QKG5_MOUSE spjP62911jRL32_MOUSE 0 0 0 0 3 3 1.30 17.80 trjD3Z1N9jD3Z1N9_MOUSE spjP61255jRL26_MOUSE 0 0 0 0 3 3 11.90 12.40 spjQ9JIX8jACINU_MOUSE 0 0 3 2.60 spjQ640N1jAEBP1_MOUSE 0 0 3 3.70 spjP62918jRL8_MOUSE 0 0 3 9.70 spjP49290jPERE_MOUSE 0 0 3 4.70 spjP10922jH10_MOUSE spjQ8BZX4jSREK1_MOUSE 0 0 0 0 3 2 16.50 6.10 spjP14115jRL27A_MOUSE 0 0 2 14.20 spjO35326jSRSF5_MOUSE 3 13.00 2 8.90 spjQ52KI8jSRRM1_MOUSE 1 1.60 2 5.20 spjQ9QYC0jADDA_MOUSE 0 0 2 4.10 Sun et al. www.pnas.org/cgi/content/short/1318114111 Description Nuclease-sensitive element-binding protein 1 OS = Mus musculus GN = Ybx1 PE = 1 SV = 3 Eukaryotic translation initiation factor 3 subunit A OS = Mus musculus GN = Eif3a PE = 1 SV = 5 MCG18410, isoform CRA_a OS = Mus musculus GN = Ddx23 PE = 3 SV = 1 Plectin OS = Mus musculus GN = Plec PE = 1 SV = 2 Putative RNA-binding protein Luc7-like 2 OS = Mus musculus GN = Luc7l2 PE = 1 SV = 1 MAP7 domain-containing protein 1 OS = Mus musculus GN = Map7d1 PE = 1 SV = 1 Interalpha-trypsin inhibitor heavy chain H1 OS = Mus musculus GN = Itih1 PE = 4 SV = 1 Polyubiquitin-C OS = Mus musculus GN = Ubc PE = 1 SV = 2 40S ribosomal protein S26 OS = Mus musculus GN = Rps26 PE = 2 SV = 3 60S ribosomal protein L28 OS = Mus musculus GN = Rpl28 PE = 1 SV = 2 Basement membrane-specific heparan sulfate proteoglycan core protein OS = Mus musculus GN = Hspg2 PE = 4 SV = 1 DNA-binding protein A OS = Mus musculus GN = Csda PE = 1 SV = 2 60S ribosomal protein L39 OS = Mus musculus GN = Rpl39 PE = 2 SV = 2 Serum albumin OS = Mus musculus GN = Alb PE = 1 SV = 3 60S ribosomal protein L24 OS = Mus musculus GN = Rpl24 PE = 2 SV = 2 Protein 2210010C04Rik OS = Mus musculus GN = 2210010C04Rik PE = 2 SV = 1 UPF0444 transmembrane protein C12orf23 homolog OS = Mus musculus PE = 2 SV = 1 60S ribosomal protein L18a OS = Mus musculus GN = Rpl18a PE = 1 SV = 1 Heterochromatin protein 1-binding protein 3 OS = Mus musculus GN = Hp1bp3 PE = 1 SV = 1 Protein PRRC2C OS = Mus musculus GN = Prrc2c PE = 4 SV = 1 60S ribosomal protein L32 OS = Mus musculus GN = Rpl32 PE = 2 SV = 2 MCG9889 OS = Mus musculus GN = Gm10709 PE = 4 SV = 1 60S ribosomal protein L26 OS = Mus musculus GN = Rpl26 PE = 2 SV = 1 Apoptotic chromatin condensation inducer in the nucleus OS = Mus musculus GN = Acin1 PE = 1 SV = 3 Adipocyte enhancer-binding protein 1 OS = Mus musculus GN = Aebp1 PE = 1 SV = 1 60S ribosomal protein L8 OS = Mus musculus GN = Rpl8 PE = 2 SV = 2 Eosinophil peroxidase OS = Mus musculus GN = Epx PE = 1 SV = 2 Histone H1.0 OS = Mus musculus GN = H1f0 PE = 2 SV = 4 Splicing regulatory glutamine/lysine-rich protein 1 OS = Mus musculus GN = Srek1 PE = 2 SV = 1 60S ribosomal protein L27a OS = Mus musculus GN = Rpl27a PE = 2 SV = 5 Serine/arginine-rich splicing factor 5 OS = Mus musculus GN = Srsf5 PE = 1 SV = 1 Serine/arginine repetitive matrix protein 1 OS = Mus musculus GN = Srrm1 PE = 1 SV = 2 α-adducin OS = Mus musculus GN = Add1 PE = 1 SV = 2 6 of 10 Table S1. Cont. Accession WT_sp ectra counts WT_seq coverage (%) IKO_spe ctra counts IKO_seq coverage (%) spjO54774jAP3D1_MOUSE 0 0 2 1.70 spjP84104jSRSF3_MOUSE 0 0 2 12.80 spjQ9WTI7jMYO1C_MOUSE 0 0 2 2.40 spjP43276jH15_MOUSE spjP83882jRL36A_MOUSE 0 0 0 0 2 2 10.30% 17.00% spjQ6DID3jSCAF8_MOUSE trjD3YW41jD3YW41_MOUSE 0 1 0 10.50 2 2 1.90% 18.10% trjE9Q6E5jE9Q6E5_MOUSE trjD3YWJ3jD3YWJ3_MOUSE 2 0 6.10 0 2 2 6.10% 7.30% trjG3X977jG3X977_MOUSE 2 3.20 2 2.70% spjO55042jSYUA_MOUSE spjQ5SUF2jLC7L3_MOUSE 0 2 0 5.80 2 2 25.70 5.80 spjQ62376jRU17_MOUSE 0 0 2 4.50 trjQ9CPX4jQ9CPX4_MOUSE spjP07146jTRY2_MOUSE 0 0 0 0 2 1 16.90 4.50 trjE9PZM7jE9PZM7_MOUSE 0 0 1 1.00 trjQ642K5jQ642K5_MOUSE 0 0 1 7.50 spjQ9D8K3jDERL3_MOUSE spjQ8BL97jSRSF7_MOUSE 0 1 0 5.20 1 1 5.70 4.50 spjQ61464jZN638_MOUSE 0 0 1 0.70 spjQ8C5N3jCWC22_MOUSE 0 0 1 1.00 trjA2AHK0jA2AHK0_MOUSE 0 0 1 1.20 trjQ9D937jQ9D937_MOUSE 0 0 1 11.40 spjP49817jCAV1_MOUSE spjQ8VCR2jDHB13_MOUSE 0 0 0 0 1 1 5.60 3.60 trjF8WHU5jF8WHU5_MOUSE 0 0 1 0.70 spjP26369jU2AF2_MOUSE 0 0 1 4.40 spjQ9D958jSPCS1_MOUSE 0 0 1 7.50 spjQ9WTQ5jAKA12_MOUSE 0 0 1 1.10 spjP20029jGRP78_MOUSE 0 0 1 2.40 spjQ61136jPRP4B_MOUSE 2 2.80 1 1.70 spjA2A4P0jDHX8_MOUSE 0 0 1 0.90 spjQ61687jATRX_MOUSE 0 0 1 0.50 Sun et al. www.pnas.org/cgi/content/short/1318114111 Description AP-3 complex subunit delta-1 OS = Mus musculus GN = Ap3d1 PE = 1 SV = 1 Serine/arginine-rich splicing factor 3 OS = Mus musculus GN = Srsf3 PE = 1 SV = 1 Unconventional myosin-Ic OS = Mus musculus GN = Myo1c PE = 1 SV = 2 Histone H1.5 OS = Mus musculus GN = Hist1h1b PE = 1 SV = 2 60S ribosomal protein L36a OS = Mus musculus GN = Rpl36a PE = 3 SV = 2 Protein SCAF8 OS = Mus musculus GN = Scaf8 PE = 1 SV = 1 60S ribosomal protein L36 OS = Mus musculus GN = Rpl36-ps3 PE = 3 SV = 1 Protein Srsf11 OS = Mus musculus GN = Srsf11 PE = 4 SV = 1 40S ribosomal protein S2 OS = Mus musculus GN = Rps2 PE = 3 SV = 1 Interalpha trypsin inhibitor, heavy chain 2 OS = Mus musculus GN = Itih2 PE = 4 SV = 1 Alpha-synuclein OS = Mus musculus GN = Snca PE = 1 SV = 2 Luc7-like protein 3 OS = Mus musculus GN = Luc7l3 PE = 1 SV = 1 U1 small nuclear ribonucleoprotein 70 kDa OS = Mus musculus GN = Snrnp70 PE = 1 SV = 2 Ferritin OS = Mus musculus GN = Ftl1 PE = 2 SV = 1 Anionic trypsin-2 OS = Mus musculus GN = Prss2 PE = 2 SV = 1 Protein Scaf11 OS = Mus musculus GN = Scaf11 PE = 4 SV = 1 40S ribosomal protein S30 OS = Mus musculus GN = Fau PE = 2 SV = 1 Derlin-3 OS = Mus musculus GN = Derl3 PE = 2 SV = 1 Serine/arginine-rich splicing factor 7 OS = Mus musculus GN = Srsf7 PE = 1 SV = 1 Zinc finger protein 638 OS = Mus musculus GN = Znf638 PE = 1 SV = 2 Pre-mRNA-splicing factor CWC22 homolog OS = Mus musculus GN = Cwc22 PE = 1 SV = 1 Diacylglycerol kinase zeta OS = Mus musculus GN = Dgkz PE = 4 SV = 1 MCG127334 OS = Mus musculus GN = 1810009A15Rik PE = 2 SV = 1 Caveolin-1 OS = Mus musculus GN = Cav1 PE = 1 SV = 1 17-β-hydroxysteroid dehydrogenase 13 OS = Mus musculus GN = Hsd17b13 PE = 1 SV = 2 Sister chromatid cohesion protein PDS5 homolog B OS = Mus musculus GN = Pds5b PE = 4 SV = 1 Splicing factor U2AF 65 kDa subunit OS = Mus musculus GN = U2af2 PE = 1 SV = 3 Signal peptidase complex subunit 1 OS = Mus musculus GN = Spcs1 PE = 2 SV = 3 A-kinase anchor protein 12 OS = Mus musculus GN = Akap12 PE = 1 SV = 1 78-kDa glucose-regulated protein OS = Mus musculus GN = Hspa5 PE = 1 SV = 3 Serine/threonine-protein kinase PRP4 homolog OS = Mus musculus GN = Prpf4b PE = 1 SV = 3 ATP-dependent RNA helicase DHX8 OS = Mus musculus GN = Dhx8 PE = 2 SV = 1 Transcriptional regulator ATRX OS = Mus musculus GN = Atrx PE = 1 SV = 3 7 of 10 Table S1. Cont. Accession WT_sp ectra counts WT_seq coverage (%) IKO_spe ctra counts IKO_seq coverage (%) spjP62849jRS24_MOUSE 0 0 1 11.30 spjQ61704jITIH3_MOUSE 3 3.10 1 1.80 spjQ61171jPRDX2_MOUSE 1 5.60 1 5.60 spjB2RY56jRBM25_MOUSE 0 0 1 1.70 spjP24788jCD11B_MOUSE 0 0 1 1.40 spjQ8K0C5jZG16_MOUSE 24 1 5.40 spjO35492jCLK3_MOUSE 0 0 1 2.20 spjP62996jTRA2B_MOUSE 0 0 1 5.60 spjQ62093jSRSF2_MOUSE 1 3.60 1 3.60 spjP62806jH4_MOUSE 1 9.70 1 9.70 spjP51881jADT2_MOUSE 0 0 1 4.40 spjP62281jRS11_MOUSE 0 0 1 6.30 spjQ9CQU3jRER1_MOUSE 0 0 1 5.60 spjP62852jRS25_MOUSE 2 1 8.00 spjP27659jRL3_MOUSE 0 0 1 3.00 trjQ9ER67jQ9ER67_MOUSE 0 0 1 1.30 spjP62900jRL31_MOUSE 0 0 1 11.20 spjP61358jRL27_MOUSE 0 0 1 6.60 spjP62751jRL23A_MOUSE 0 0 1 8.30 spjQ91V04jTRAM1_MOUSE 0 0 1 3.70 spjQ3UC65jCA063_MOUSE 0 0 1 4.70 spjP47962jRL5_MOUSE 0 0 1 3.40 spjQ8K194jSNR27_MOUSE 0 0 1 7.10 spjQ14AX6jCDK12_MOUSE 0 0 1 1.10 spjP52480jKPYM_MOUSE 0 0 1 1.70 spjQ9EQ06jDHB11_MOUSE 0 0 1 3.70 spjQ8C522jENDD1_MOUSE 0 0 1 2.60 spjP62267jRS23_MOUSE 0 0 1 7.70 spjP27661jH2AX_MOUSE 3 1 13.30 spjQ52KE7jCCNL1_MOUSE trjH9KV00jH9KV00_MOUSE 0 0 1 1 2.80 0.60 Sun et al. www.pnas.org/cgi/content/short/1318114111 42.50 14.40 13.30 0 0 Description 40S ribosomal protein S24 OS = Mus musculus GN = Rps24 PE = 1 SV = 1 Interalpha-trypsin inhibitor heavy chain H3 OS = Mus musculus GN = Itih3 PE = 1 SV = 3 Peroxiredoxin-2 OS = Mus musculus GN = Prdx2 PE = 1 SV = 3 RNA-binding protein 25 OS = Mus musculus GN = Rbm25 PE = 1 SV = 1 Cyclin-dependent kinase 11B OS = Mus musculus GN = Cdk11b PE = 1 SV = 2 Zymogen granule membrane protein 16 OS = Mus musculus GN = Zg16 PE = 2 SV = 1 Dual specificity protein kinase CLK3 OS = Mus musculus GN = Clk3 PE = 1 SV = 2 Transformer-2 protein homolog β OS = Mus musculus GN = Tra2b PE = 1 SV = 1 Serine/arginine-rich splicing factor 2 OS = Mus musculus GN = Srsf2 PE = 1 SV = 4 Histone H4 OS = Mus musculus GN = Hist1h4a PE = 1 SV = 2 ADP/ATP translocase 2 OS = Mus musculus GN = Slc25a5 PE = 1 SV = 3 40S ribosomal protein S11 OS = Mus musculus GN = Rps11 PE = 2 SV = 3 Protein RER1 OS = Mus musculus GN = Rer1 PE = 1 SV = 1 40S ribosomal protein S25 OS = Mus musculus GN = Rps25 PE = 2 SV = 1 60S ribosomal protein L3 OS = Mus musculus GN = Rpl3 PE = 2 SV = 3 Maged2 protein OS = Mus musculus GN = Maged2 PE = 2 SV = 1 60S ribosomal protein L31 OS = Mus musculus GN = Rpl31 PE = 2 SV = 1 60S ribosomal protein L27 OS = Mus musculus GN = Rpl27 PE = 2 SV = 2 60S ribosomal protein L23a OS = Mus musculus GN = Rpl23a PE = 1 SV = 1 Translocating chain-associated membrane protein 1 OS = Mus musculus GN = Tram1 PE = 1 SV = 3 UPF0471 protein C1orf63 homolog OS = Mus musculus GN = D4Wsu53e PE = 1 SV = 1 60S ribosomal protein L5 OS = Mus musculus GN = Rpl5 PE = 1 SV = 3 U4/U6.U5 small nuclear ribonucleoprotein 27 kDa protein OS = Mus musculus GN = Snrnp27 PE = 2 SV = 1 Cyclin-dependent kinase 12 OS = Mus musculus GN = Cdk12 PE = 1 SV = 2 Pyruvate kinase isozymes M1/M2 OS = Mus musculus GN = Pkm PE = 1 SV = 4 Estradiol 17-β-dehydrogenase 11 OS = Mus musculus GN = Hsd17b11 PE = 2 SV = 1 Endonuclease domain-containing 1 protein OS = Mus musculus GN = Endod1 PE = 1 SV = 2 40S ribosomal protein S23 OS = Mus musculus GN = Rps23 PE = 2 SV = 3 Histone H2A.x OS = Mus musculus GN = H2afx PE = 1 SV = 2 Cyclin-L1 OS = Mus musculus GN = Ccnl1 PE = 1 SV = 1 Protein SON OS = Mus musculus GN = Son PE = 4 SV = 1 8 of 10 Table S1. Cont. Accession WT_sp ectra counts WT_seq coverage (%) IKO_spe ctra counts IKO_seq coverage (%) spjQ61176jARGI1_MOUSE spjE9Q557jDESP_MOUSE spjP62737jACTA_MOUSE 1 2 1 4.30 1.10 4.20 1 0 0 3.40 0 0 spjQ8VDD5jMYH9_MOUSE spjQ9CZM2jRL15_MOUSE 3 1 2.10 6.90 0 0 0 0 trjQ3TWW8jQ3TWW8_MOUSE spjP17742jPPIA_MOUSE 2 1 5.30 5.50 0 0 0 0 spjP99027jRLA2_MOUSE 1 28.70 0 0 spjP00688jAMYP_MOUSE 4 11.00 0 0 spjA2ASQ1jAGRIN_MOUSE spjQ6P8U6jLIPP_MOUSE 1 1 0.90 4.10 0 0 0 0 spjP56480jATPB_MOUSE 1 2.60 0 0 spjP09103jPDIA1_MOUSE 1 3.10 0 0 spjQ9QXE0jHACL1_MOUSE 1 3.10 0 0 spjP07356jANXA2_MOUSE spjP02089jHBB2_MOUSE 1 1 3.20 6.80 0 0 0 0 spjP05208jCEL2A_MOUSE 1 5.90 0 0 spjQ8BX70jVP13C_MOUSE 12 4.30 0 0 spjQ99M28jRNPS1_MOUSE 1 4.90 0 0 trjQ9ER05jQ9ER05_MOUSE trjQ792Z1jQ792Z1_MOUSE spjQ9CR35jCTRB1_MOUSE 1 3 1 5.30 8.50 4.90 0 0 0 0 0 0 spjQ9JM93jAR6P4_MOUSE 1 5.20 0 0 spjQ9R1C7jPR40A_MOUSE 1 1.70 0 0 Total spectral counts 332 Description Arginase-1 OS = Mus musculus GN = Arg1 PE = 1 SV = 1 Desmoplakin OS = Mus musculus GN = Dsp PE = 3 SV = 1 Actin, aortic smooth muscle OS = Mus musculus GN = Acta2 PE = 1 SV = 1 Myosin-9 OS = Mus musculus GN = Myh9 PE = 1 SV = 4 60S ribosomal protein L15 OS = Mus musculus GN = Rpl15 PE = 2 SV = 4 Protein Srsf6 OS = Mus musculus GN = Srsf6 PE = 2 SV = 1 Peptidyl-prolyl cis-trans isomerase A OS = Mus musculus GN = Ppia PE = 1 SV = 2 60S acidic ribosomal protein P2 OS = Mus musculus GN = Rplp2 PE = 1 SV = 3 Pancreatic α-amylase OS = Mus musculus GN = Amy2 PE = 1 SV = 2 Agrin OS = Mus musculus GN = Agrn PE = 1 SV = 1 Pancreatic triacylglycerol lipase OS = Mus musculus GN = Pnlip PE = 1 SV = 1 ATP synthase subunit β, mitochondrial OS = Mus musculus GN = Atp5b PE = 1 SV = 2 Protein disulfide-isomerase OS = Mus musculus GN = P4hb PE = 1 SV = 2 2-hydroxyacyl-CoA lyase 1 OS = Mus musculus GN = Hacl1 PE = 1 SV = 2 Annexin A2 OS = Mus musculus GN = Anxa2 PE = 1 SV = 2 Hemoglobin subunit β-2 OS = Mus musculus GN = Hbb-b2 PE = 1 SV = 2 Chymotrypsin-like elastase family member 2A OS = Mus musculus GN = Cela2a PE = 2 SV = 1 Vacuolar protein sorting-associated protein 13C OS = Mus musculus GN = Vps13c PE = 1 SV = 2 RNA-binding protein with serine-rich domain 1 OS = Mus musculus GN = Rnps1 PE = 2 SV = 1 Chymopasin OS = Mus musculus GN = Ctrl PE = 2 SV = 1 MCG140784 OS = Mus musculus GN = Try10 PE = 2 SV = 1 Chymotrypsinogen B OS = Mus musculus GN = Ctrb1 PE = 2 SV = 1 ADP ribosylation factor-like protein 6-interacting protein 4 OS = Mus musculus GN = Arl6ip4 PE = 1 SV = 1 Pre-mRNA-processing factor 40 homolog A OS = Mus musculus GN = Prpf40a PE = 1 SV = 1 720 Ribosomal subunits and initiation factors appear in boldface. The list was sorted based on the descending spectra counts of Sel1LIKO sample. Sun et al. www.pnas.org/cgi/content/short/1318114111 9 of 10 Table S2. Primer sequences used in this study Primers Genotyping primers flox/flox Cre RT-PCR primers Xbp1 L32 Quantitative PCR primers Xbp1t Xbp1s Perk Chop Atf4 Atf6 Grp78 Grp58 P58ipk Edem1 Erdj4 Pdia6 Sel1l Hrd1 Os9 Gp78 Rma1 Teb4 Amy2a5 Pnlip L32 Sun et al. www.pnas.org/cgi/content/short/1318114111 Forward Reverse CTGACTGAGGAAGGGTCTC AGCGATGGATTTCCGTCTCT GCTAAAAACATTACAAAGGGGCA CACCAGCTTGCATGATCTCC ACACGCTTGGGAATGGACAC GAGCAACAAGAAAACCAAGCA CCATGGGAAGATGTTCTGGG TGCACACAAGCCATCTACTCA ACATCTTCCCATGGACTCTG GAGTCCGCAGCAGGTG TCAAGTTTCCTCTACTGTTCACTCA TATCTCATCCCCAGGAAACG CGAGATGAGCTTCCTGAACAGC TACCACCCACAACAAGACCA TGTGGTACCCACCAAGAAGTC GAGGCTTGCCCCTGAGTATG GTGGCATCCAGATAATTTCCAG GGGACCAAGAGGAAAAGTTTG CTTAGGTGTGCCAAAGTCTGC TGGTTCCTTTCCTACCATCACT TGGGTTTTCTCTCTCTCCTCTG AGCTACTTCAGTGAACCCCACT GCTGGCTGACTGATGAGGAT GCATGTTAGTTCAGCGCAAG AATGCCCATGAACCTTTCAG CAGCCTGCACGAAACAATAA GCAACAATGTTGGTGTCCGTAT TGGATGTTGGAGATTTGCAG GAGCAACAAGAAAACCAAGCA TAGGTCCTTCTGGGTAGACC GTGTCAGAGTCCATGGGA CGGGAAACTCCAAGTTCTCA GGGCACTGACCACTCTGTTT GGAAAAGGCATCCTCCTTGC TGATGATCCCGGAGATAAGG TTCAGCTGTCACTCGGAGAAT GTTGGCAGTGCAATCCACC GAGTTCCAACTTCTGTGGAAGG GAGGTGAGCAGGTCAAATCAA GGCATCCGAGAGTGTTTCATA ACTTTCACTGCTGGAAAACTGC CCTTTGTTCCGGTTACTTCTTG CTCCTCTACAATGCCCACTGAC CGGTAGTTGCTCTCCAGCTC CCTCTGAAGTCTCCGCTCAG GAAAAAGATGGCGAGGAACA GGCTGGCAATTAGCAATGTT AATTCCCTGTTATTTGGATTGAGG GGACGTCTTCCCTCACTGTC TGCACACAAGCCATCTACTCA 10 of 10
© Copyright 2026 ExpyDoc