Thesis Toll-like receptor agonist decorated chitosan nanoparticles for pulmonary DNA vaccination HEUKING, Simon Abstract Ce travail de thèse vise à l´évaluation de nouvelles nanoparticules (NP) vectorisant un antigène sous forme d'acide nucléique, fonctionnalisées par de puissants adjuvants pour une vaccination par voie respiratoire. La vaccination par ADN est une nouvelle approche vaccinale pour induire une réponse immunitaire spécifique contre un agent pathogène. Suite à son administration, un vaccin à ADN permet la synthèse in vivo de l´antigène, puis sa présentation sous forme de peptides antigéniques par les molécules du complexe majeur d´histocompatibilité (CMH) de classe I. Par conséquent, les lymphocytes T CD8+ sont stimulés, et déclenchent une réponse cytotoxique dirigée contre l´antigène. Malgré des résultats pré-cliniques prometteurs de vaccination par ADN, les essais réalisés chez le primate ou chez l'Homme n´ont pas permis l'induction d'une réponse immunitaire protectrice. A cause de cela, plusieurs stratégies ont été proposées, comme le changement de la voie d'administration, la complexation de l'ADN avec un polymère sous forme (nano)particulaire ou l´ajout d´un adjuvant. Reference HEUKING, Simon. Toll-like receptor agonist decorated chitosan nanoparticles for pulmonary DNA vaccination. Thèse de doctorat : Univ. Genève, 2010, no. Sc. 4242 URN : urn:nbn:ch:unige-119140 Available at: http://archive-ouverte.unige.ch/unige:11914 Disclaimer: layout of this document may differ from the published version. [ Downloaded 28/11/2016 at 12:10:45 ] UNIVERSITE DE GENEVE SECTION DES SCIENCES PHARMACEUTIQUES LABORATOIRE DE PHARMACIE GALENIQUE ET DE BIOPHARMACIE FACULTE DES SCIENCES PROFESSEUR GERRIT BORCHARD Toll-like receptor agonist decorated chitosan nanoparticles for pulmonary DNA vaccination THESE présentée à la Faculté des Sciences de l´Université de Genève pour obtenir le grade de Docteur en Sciences, mention sciences pharmaceutiques par Simon HEUKING de Hünxe (Allemagne) Thèse N°4242 Genève Atelier d´impression ReproMail 2010 2 To my families in Germany, Sweden and Switzerland. 3 Stufen Wie jede Blüte welkt und jede Jugend dem Alter weicht, blüht jede Lebensstufe, blüht jede Weisheit auch und jede Tugend zu ihrer Zeit und darf nicht ewig dauern. Es muss das Herz bei jedem Lebensrufe bereit zum Abschied sein und Neubeginne, um sich in Tapferkeit und ohne Trauern in and're, neue Bindungen zu geben. Und jedem Anfang wohnt ein Zauber inne, der uns beschützt und der uns hilft zu leben. Wir sollen heiter Raum um Raum durchschreiten, an keinem wie an einer Heimat hängen, der Weltgeist will nicht fesseln uns und engen, er will uns Stuf' um Stufe heben, weiten. Kaum sind wir heimisch einem Lebenskreise und traulich eingewohnt, so droht Erschlaffen. Nur wer bereit zu Aufbruch ist und Reise, mag lähmender Gewöhnung sich entraffen. Es wird vielleicht auch noch die Todesstunde uns neuen Räumen jung entgegen senden: des Lebens Ruf an uns wird niemals enden ... Wohlan denn, Herz, nimm Abschied und gesunde ! Hermann Hesse 4 TABLE OF CONTENTS Part I – Introduction Chapter 1 Progress in chitosan-based vaccine delivery systems 7 Chapter 2 Aim of the thesis and study objectives 45 Part II – Preparation and in vitro characterization of TLRagonist functionalized DNA nanoparticles Chapter 3 Toll-like receptor-2 agonist functionalized biopolymer for mucosal vaccination 52 Chapter 4 Stimulation of macrophages using Toll-like receptor-2 (TLR-2) agonist decorated nanocarriers 79 Chapter 5 Functionalization with a TLR-7 agonist enhances the immunogenicity of chitosan DNA nanoparticles in human THP-1 macrophages 109 Part III – In vitro and in vivo evaluation of TLR-agonist functionalized nanoparticles for pulmonary DNA vaccination Chapter 6 Fate of TLR-2 agonist functionalized pDNA nanocarriers upon deposition at the bronchial epithelium in vitro 144 Chapter 7 Preliminary in vivo immunogenicity of TLR-2 agonist decorated chitosan nanoparticles encapsulating a plasmid DNA vaccine against Mycobacterium tuberculosis 168 Chapter 8 Discussion and future perspectives 196 Chapter 9 Summary 207 Chapter 10 Résumé 211 List of Abbreviations 215 Publications, oral presentations and awards 217 Curriculum vitae 219 Acknowledgments 220 5 Part I Introduction 6 Chapter 1 Progress in chitosan-based vaccine delivery systems F. Esmaeili1,2,*, S. Heuking1,2,*, H.E. Junginger3 and G. Borchard1,2 Adapted from: Journal of Drug Delivery and Science Technology (2010) 20, 53-61. 1School of Pharmaceutical Sciences, University of Geneva, Switzerland 2Centre Pharmapeptides, Archamps, France 3Department of Pharmaceutics, Faculty of Pharmaceutical Sciences, Naresuan University, Phitsanulok, Thailand *F.E. and S.H. have contributed equally to this review 7 Abstract The biopolymer chitosan, derived from chitin by deacetylation, has been considered for drug and vaccine carrier systems due to its biocompatibility, biodegradability, and absence of toxicity. In addition, chitosan serves as the base for the synthesis of various derivatives, having, e.g., an increased aqueous solubility at a wide pH range or offering the opportunity for functionalization with targeting moieties. As the polymer was described to display adjuvant properties, as well, chitosan and its derivatives are used in vaccine delivery systems, alone or in combination with other polymers. This review is highlighting the current status of the use of chitosan and its derivatives in vaccine carrier design. 1. Chitosan Chitosan is a cationic polymer derived from chitin and consists of randomly distributed β-(1-4)-linked D-glucosamine (deacetylated unit) and N-acetyl-D-glucosamine (acetylated unit) monomers. Its properties are dependent on molecular weight and degree of deacetylation [1,2]. Chitosan is a low cost, non-toxic, biodegradable and biocompatible mucoadhesive polymer. Once the polymer is positively charged, it transiently opens intercellular tight junctions, thereby enabling paracellular transport of drugs [3]. Moreover, chitosan exhibits potential adjuvant properties to be exploited in vaccine delivery [4]. With regard to the formulation of vaccines, the polymer may encapsulate or adsorb antigens, giving rise to the formation of micro- or nanoparticles. In addition, chitosan polymers are co-administered with the antigen in solution [5]. In mucosal vaccination by the nasal or pulmonary route, chitosan, due to its mucoadhesive properties, prolongs the residence time of the loaded antigen at mucosal sites, which is suggested to increase antigenic uptake [6]. 8 Because of its beneficial properties mentioned, chitosan attracted much attention as an excipient for the preparation of vaccine delivery systems over the last decades, and has been applied to the delivery of protein as well as plasmid DNA vaccines. 2. Chitosan for the formulation of protein and subunit vaccines Peptide and protein subunit vaccines are single or multiple antigen(s) derived from a pathogenic organism. Subunit vaccines often show a low immunogenicity, especially when applied by mucosal routes. Adjuvant co-administration is therefore advised, preferably within the same formulation or carrier system as the antigen itself. A range of studies has been performed to identify and develop adjuvants especially suitable for the mucosal route of immunization [7,8]. Many studies showed that chitosan, in soluble form as well as in particulate systems does improve antigen uptake at mucosal epithelia, thereby allowing vaccine access to subepithelial antigen-presenting cells (APC) and increasing local immune responses [911]. As an example, immunostimulatory effects of nasal co-administration of chitosan and selected other adjuvants with recombinant Helicobacter pylori urease antigen were examined by Moschos et al. [7]. In this study, the adjuvanticity of chitosan was evaluated and compared to two well-defined adjuvants. The first of these adjuvants, cholera toxin subunit B (CTB), is known as a potent mucosal adjuvant inducing strong humoral responses [12]. The second, muramyl di-peptide (MDP), represents an adjuvant eliciting cell-mediated immunity [13]. Results of these studies showed that immunomodulatory effects of the H. pylori antigen were increased by chitosan as well as by MDP; in addition, a combination of adjuvants administered with the vaccine also contributed to the increased antigenicity of the recombinant antigen [7]. 9 Related to this study, Xie et al. demonstrated the superiority of chitosan over cholera toxin as an adjuvant for an H. pylori vaccine. Co-administration of chitosan and H. pylori antigen did not only induce Th1 and Th2 immune responses, but also adjusted the Th1/Th2 imbalance due to H. pylori infection [11]. In another study, Seferian and Martinez studied the immunogenic activity of two new adjuvant formulations based on chitosan to increase the immunogenic potential of bhCG (beta human chorionic gonadotropin) [14]. bhCG is known as a target protein for immunocontraceptive vaccines and tumor immunotherapy [15], while its immunogenicity, when administered alone, is not pronounced. In vivo studies in BALB/c mice using bhCG in combination with zinc-chitosan particles and/or an emulsion formulation containing chitosan resulted in high and prolonged titers of antibodies as a result of B and T lymphocyte stimulation. Many studies have been performed to develop an effective vaccine against (myco)bacterial infections such as tuberculosis (TB), diphtheria, cholera and pertussis, especially for mucosal vaccination. Regarding TB vaccination, Zhu et al. have reported on the formulation of Ag85B– MPT64190–198–Mtb8.4 (AMM) antigen in chitosan microspheres. AMM is a fusion protein containing the structure of three antigenic epitopes of M. tuberculosis. In mice, subcutaneously administered chitosan microspheres containing AMM produced stronger humoral and cellular immune responses than a solution of AMM in phosphate buffer saline (PBS) administered by the same route [9]. In view of nasal immunization, CRM197, a non-toxic mutant cross-reacting material of diphtheria toxin (DT) was formulated with chitosan in solution or powder form and CRM197´s in vivo immunogenic activity was studied [16]. Intranasal administration of this formulation in mice as well as in guinea pigs yielded high titers of toxin-neutralizing antibodies. Further studies revealed that intranasal administration of a powder 10 formulation of chitosan CRM197-based vaccine resulted in a boosted humoral and cellular immune response in adult volunteers [16,17]. In a further investigation, van der Lubben et al. formulated chitosan microparticles loaded with diphtheria toxoid (DT) and bovine serum albumin (BSA) by using a precipitation/coacervation method [18]. Following oral administration of this formulation in mice, confocal laser scanning microscopy (CLSM) and immunohistochemistry revealed that these microparticles were taken up by intestinal Peyer’s patches of the gut-associated lymphoid tissue (GALT) being an essential step in oral vaccination [19]. Bordetella pertussis filamentous haemagglutinin and recombinant pertussis toxin have been shown to induce very strong systemic and mucosal immune reactions against antigens when co-administered nasally with chitosan [20,21]. In a study by Jabbal-Gill et al. (1998), filamentous haemagglutinin (FHA) and recombinant pertussis toxin (rPT) were formulated in a number of different chitosan-based nasal vaccines for pertussis as single or as bivalent vaccines. Following intranasal administration of the chitosan formulation in mice, immunological responses were monitored, and results revealed that chitosan could enhance significantly serum IgG and secretory IgA levels after nasal administration of FHA antigen or a mixture of FHA and rPT antigens, when compared to the formulation lacking chitosan [20,21]. Moreover, chitosan microspheres containing Bordetella bronchiseptica dermonecrotoxin (BBD) were formulated for nasal vaccination against atrophic rhinitis. In vitro stimulation of murine macrophages (RAW264.7 cell line) by these particles resulted in the gradual secretion of tumor necrosis factor-alpha (TNF-α) and nitric oxide (NO) from macrophages, apparently induced by BBD released from the chitosan microspheres [22]. 11 Interestingly, intranasal administration of the BBD-loaded chitosan microparticles in mice was studied by Kang et al. [23]. BBD-specific IgA titers in the nasal cavity, as well as those of systemic IgA and IgG were dependent on time and dose. Next to these studies, intranasal administration of chitosan nanoparticles and emulsions containing cholera toxin (CT) and bovine serum albumin (BSA) was addressed by Nagamoto et al. [24]. Their results revealed that these formulations could effectively target the NALT (nasalassociated lymphoid tissue) and induce a systemic immune effect. In addition, BSA as a model antigen was also incorporated in chitosan microspheres, prepared from chitosan base or chitosan chloride, using spray-drying [6]. This method of preparation was shown to preserve the integrity of BSA, and administration of the particles via the intranasal route in mice resulted in significantly more pronounced immune responses than the administration of BSA in solution. Moreover, enhancement of the IgG immune response was shown to be dependent on the type of chitosan used for particle formation. Interestingly, microparticles prepared with chitosan base were found to have a more pronounced effect on anti-BSA IgG secretions than those prepared from chitosan chloride. This effect was suggested to be due to the higher permeation enhancement potential of chitosan base than chitosan chloride across the nasal mucosa [6,25], allowing chitosan vaccine carrier systems an improved access to subepithelial antigen-presenting cells (APC). One goal in the development of vaccine delivery systems has been to achieve prolonged local delivery of immunomodulatory cytokines to enhance immune responses. As an example, Zaharoff et al. studied the potential of chitosan to control the dissemination and to improve the immunoadjuvant properties of GM-CSF [26]. Compared to lipid-based adjuvants and other vehicles, subcutaneous injection of recombinant GM-CSF (rGM-CSF) formulated in chitosan solution resulted in longer local 12 retention up to nince days of rGM-CSF at the injection site. Prolongation of retention time, in turn, resulted in a significant increase in antigen presenting cells (MHCII+ cells and dendritic cells) and increase in overall vaccine´s immunogenicity [26]. McClure [27] described the feasibility of antigen delivery across the mucosal epithelium for the induction of mucosal immune responses against Trichostrongylus colubriformis, a non-blood-feeding intestinal nematode. Cellulose gel and chitosan gel or sponge formulations were used as carrier systems, whereby delivery of Trichostrongylus native and recombinant antigens across the rectal epithelium resulted in significant immune responses even in the absence of mucosal adjuvants like cholera or E. coli toxins. In the light of the results obtained, further investigations for the developpment of a mucosal delivery system for vaccines against gastrointestinal helminths are warranted. In general, most of studies performed used chitosan as an adjuvant or as a delivery system for protein and subunit vaccines and demonstrated a potentiating effect of this polymer on the immunogenicity of the vaccines applied. 3. Chitosan for the formulation of plasmid DNA vaccines DNA vaccines consist of plasmid DNA of bacterial origin, bearing the genetic information of one or more specific microbial antigenic epitopes [28]. In spite of extensive efforts to translate results from animal studies into the clinic and into products for human use, only a small number of DNA vaccines has recently been approved, all of them in the area of veterinary medicine [29]. It is therefore the goal of currently ongoing studies to elicit a sustained cellular and humoral immune response in a clinical setting. This challenge is addressed by, on one hand, unraveling the biological concept of DNA vaccination in humans, and on the other hand by designing improved formulations and vaccination regimen. 13 Several studies on the improvement of the immunogenicity of DNA vaccines employed cationic liposomes [30,31] and polymeric particulate delivery systems based on chitosan [32] and poly (lactide-co-glycolide) (PLGA) [33-35]. These carrier systems were able to enhance the uptake of DNA vaccines by antigen-presenting cells (APC) and to facilitate T cell responses [36-38], which resulted in an improved immunogenicity [39,40], especially after application by mucosal routes [41]. As chitosan is positively charged in weak acidic solutions, it readily forms associates with highly negatively charged plasmid DNA by virtue of strong electrostatic interaction [21,42]. In one of the first studies on orally applied gene delivery systems, Roy et al. described the incorporation of a DNA vaccine against peanut allergy into chitosan particles [42], which protected against allergy challenge. Illum et al. evaluated a flu vaccine, formulated as chitosan-DNA nanoparticles. Intramuscular or intranasal administration of these complexes in BALB/c mice resulted in antibody titers, which were significantly elevated above those obtained by administration of DNA alone [32]. In a first study focusing on pulmonary delivery of a DNA vaccine against tuberculosis, Bivas-Benita et al. [43] formulated chitosan nanoparticles containing a polyepitope DNA vaccine encoding eight different HLA-A*0201-restricted T-cell epitopes of Mycobacterium tuberculosis. Induction of dendritic cell (DC) maturation by the DNAchitosan nanoparticles was shown in vitro. Secretion of IFN-γ from isolated splenocytes post vaccination and incubated with M. tuberculosis homogenate was significantly elevated in case of the pulmonary route of administration, as compared to intramuscular injection. The same result was obtained when isolated splenocytes were challenged with individual antigenic epitopes. The same research group also used chitosan nanoparticles to deliver orally a DNA vaccine encoding Toxoplasma gondii GRA-1 antigen, and chitosan microparticles for the 14 delivery of the GRA-1 protein, to the intestinal Peyer’s patches in mice. Their results showed that the vaccination regime (prime/boost) and the type of vaccine (pDNA, protein) are clearly the factors affecting the type of immune response [44]. Orally administered GRA-1 loaded chitosan microparticles or GRA-1 protein expressiong plasmid DNA loaded in chitosan nanoparticles could prime the immune response, when anti-GRA antibodies in sera were analysed. In order to indicate the type of immune response, IgG1 and IgG2a isotype ratios were determined. It was shown that priming with plasmid DNA nanoparticles in mice induces IgG1 production, which is associated with a Th2 response, while priming with GRA1 loaded microparticles reflects a mixed Th1/Th2 immune response [44]. Topical application of DNA nanoparticulate vaccines was evaluated by Cui and Mumper [45]. DNA chitosan nanoparticles, and DNA coated onto pre-formed cationic chitosan/carboxymethylcellulose (CMC) nanoparticles were applied topically to mice. Both vaccine systems were shown to induce increased titers of IgG up to 28 days, showing that topical application of chitosan DNA vaccines allows significant stimulation of the immune system [45]. Because of the promising results from studies using chitosan for the application of DNA vaccines, in addition to its biocompatibility and its ability to readily form complexes or particles with negatively charged DNA, future studies should be focusing on developing safe, sustained release DNA vaccine carrier systems. 4. Vaccine formulation using chitosan in combination with other polymers Cationic nanoparticles made from polyesters, such as poly(lactide) (PLA) and coated with chitosan, have shown promising results for the delivery of DNA vaccines. 15 In one study [46], chitosan was compared to two other cationic agents, poly(ethyleneimine) (PEI) and poly(2-dimethyl-amino)ethyl methacrylate (pDMAEMA)), for the preparation of DNA-loaded PLA nanoparticles. All three formulation groups could at least partially protect DNA from nuclease degradation, although this effect was less pronounced for PLA–chitosan. PLA–pDMAEMA showed the highest transfection efficiency in cell culture studies in vitro [46]. Kumar et al. [47] and Davies et al. [48] also described on the use of similar chitosan-coated poly (lactic acid glycolic acid) (PLGA) nanoparticles. In an investigation by Fischer et al. [49], chitosan-coated PLGA microparticles were prepared through a novel surfactant-free process, by which negatively charged PLGA microparticles were coated with positively charged chitosan. In addition, targeting moieties (antigenic and recombinant hepatits B surface, HBS) were grafted to chitosan´s free amine groups onto the surface of these microparticules [49,50]. After nasal administration, clearance rates of microparticles were shown to be lower than for unmodified PLGA microspheres or lactose powder. The humoral immune response following nasal administration of these modified systems was comparable to alum-HBS antigen administered subcutaneously. In addition, modified microspheres not only elicited significantly both systemic and mucosal humoral, but also a strong cellular immune responses [50]. Another approach was based on the preparation of a complex between mannosebearing chitosan (m-chitosan) and hepatitis B virus, as reported by Zhou et al. [51]. Mannose receptors are expressed at a high density on the surface of antigen presenting cells (APC), such as immature DC and mannose-bearing chitosan (MC) particles have been shown to be able to target these cells. Interaction between targeting MC particles and APC was followed by a sustained release of DNA, which induced an increased 16 cellular and humoral immune response compared to DNA alone. In addition, DNA release was controlled by the biodegradation of chitosan and MC, with antigen release from m-chitosan microspheres being quicker than from chitosan microspheres [51]. Alginate is another biopolymer, which has been used in combination with chitosan for the preparation of vaccine delivery systems [52]. Proteins, cells, and DNA were successfully incorporated into alginate matrices by a gelation process, while their biological activity remained intact [53,54]. Ciofani et al. [55] reported on the performance of polymeric alginate/chitosan nanoparticles for intracellular drug delivery. A simple way to prepare chitosan-based vaccine delivery systems is to adsorb the antigens onto the chitosan particle surface. Complexation of antigen-coated chitosan particles with sodium alginate was used to increase the stability of these carrier systems and also to prevent an immediate release of the adsorbed antigen [56]. Borges et al. applied such a nanoparticulate system for the incorporation of BSA as a model antigen and showed that alginate complexation with chitosan nanoparticles can increase the stability of the particles, leading to a sustained release of the antigen and a better uptake by Peyer's patches, rendering them an appropriate system for intestinal mucosal vaccination [56]. 5. Studies on interaction of chitosan particles with epithelial and immune cells The exact mechanism of induction of the immune system by the majority of immunomodulatory molecules remains yet to be elucidated. Chitosan, as an adjuvant, was shown to induce polarized Th2 responses. Although the mechanism of this induction is not well defined, results of the related studies showed that chitosan polymer appears to specifically interact with APC and CD4+ T cells. 17 Such an interaction of chitosan particles with APC was demonstrated to enhance the subsequent antigen presentation [56,57]. In the field of protein delivery, besides interactions with the immune system and activation of macrophages and the complement system, the absorption enhancing properties of chitosan represent an added value [57]. In several studies, the superiority of chitosan powder enabling absorption enhancing properties over its aqueous solutions was demonstrated [4,58]. As an example, Hall et al. showed in a recent study that peptide antigen adsorbed to chitosan could transiently activate T-cells to produce the immune cytokine IL-10 via antigen-specific T cells [59]. IV III Polymeric chitosan II nucleus V Expression of antigenic protein(s) VI Proteolysis VII MHC-I processing I Plasmid DNA & presentation VIII T-cell Figure 1: Schematic presentation of the uptake of plasmid DNA chitosan particles into cells, successive expression of antigenic protein(s) in situ followed by MHC-I processing and presentation to T-cells. 18 With regard to the application of DNA vaccines, if the delivery system can be targeted to APC and induce endolysosomal DNA vaccine release, an effective T cell immunity may be achieved at lower doses of plasmid DNA, which can be safer and more cost-effective [43]. As mentioned before, mannose-bearing chitosan has the ability to target APC and provide a sustained release of DNA vaccines [51]. Murthy et al. demonstrated that chitosan particles are rapidly degraded within the lysosomal compartment after cellular uptake, possibly resulting in dissociation of DNA from the polymer (Figure 1, I-III). Antigens encoded by the DNA vaccines are then expressed and processed, finally resulting in MHC-I restricted antigen presentation (Figure 1, IV-VIII) and a successive immune response, which can be significantly higher than for DNA alone [60]. Moreover, some studies have shown that chitosan nanoparticles appeared to be captured and transported by adsorptive transcytosis [61]. It was shown that the mucus covering the nasal epithelium did not act as a diffusion barrier to the particles. On the contrary, association of chitosan nanoparticles with mucus appeared to strongly increase permeability of the particles through the mucus layer, compared to other polymeric particles [61]. Behrens et al. also showed that internalization of chitosan nanoparticles by epithelial and immune cells is a saturable, energy- and temperaturedependent process. Intra-duodenal administration of chitosan nanoparticles in rats confirmed these in vitro results, and demonstrated that nanoparticles could be detected in both epithelial cells and in immune cells comprising intestinal Peyer’s patches [61]. In conclusion, considering the ability of chitosan to modulate the immune system as an adjuvant, as well as its role as a delivery system especially for DNA vaccines, its further evaluation as vaccine carrier system can be supported [57]. 19 6. Chitosan formulations for human use Until now, solely a few studies have been performed in order to test chitosan-based vaccine delivery in human subjects. In 2003, Mills et al. evaluated a chitosan vaccine against diphtheria in healthy volunteers [62]. Inactivated diphtheria toxoid (CRM197) in a chitosan delivery system was administered intranasally in human healthy volunteers, which was well tolerated after single immunization. The antitoxin neutralizing activity of this vaccine was comparable to standard intramuscular diphtheria vaccine, while presence of chitosan could potentiate the immunogenic responses significantly. Huo et al. (2005) also tested another chitosan-based vaccine formulation in human volunteers. A single intramuscular injection of a vaccine containing Neisseria meningitidis serogroup C polysaccharide (MCP) conjugated with CRM197, in alum or two nasal insufflations of the same vaccine powder mixed with chitosan, without alum, was evaluated in healthy volunteers. Nasal vaccination was well tolerated, with fewer symptoms. CRM197-specific IgG and diphtheria toxin-neutralizing levels were increased after either nasal or intramuscular immunization, with balanced IgG1/IgG2 and higher IgG4, while significant MCP-specific secretory IgA was detected in nasal washings only after nasal immunization. These results showed that formulation of the MCP-CRM197 conjugate in chitosan could be an effective and inexpensive vaccine against N. meningitides (serogroup C) and diphtheria [63]. Read et al. (2005) reported immunization of healthy volunteers against chitosan-based influenza vaccine. Intranasal administration of influenza virus subunit proteins in combination with chitosan glutamate revealed that immunogenic responses for intranasal chitosan-based vaccine was only slightly lower or similar to the results for standard intramuscular influenza vaccine [64]. 20 These kinds of studies support the development of mucosal vaccines against diphtheria and other subunit chitosan-based vaccines especially when mucosal immunization is desirable, such as human immunodeficiency virus infection [62]. 7. Chitosan derivatives in vaccine carrier design An important physico-chemical property of chitosan is the pKa value of 6.5 to 6.6 of the primary amine group. This value does not vary significantly for different types of chitosan of varying degrees of N-acetylation [65]. Chitosan´s amine groups (present in the glucosamine unit) are therefore positively charged only in diluted acidic solutions (pH < 5.5), rendering chitosan water-soluble. However, at physiological pH values (pH 7.2-7.4), amine groups are not protonated and chitosan precipitates from solution. In an attempt to overcome this limitation, several derivatives were synthesized over the last two decades and their potential use in drug carrier systems assessed. The molecular structure of chitosan shows a free primary amine function, as well as a primary alcohol function, both of which have been considered for chemical modification. Synthesis and modification of chitosan polymers for vaccine delivery are well-described in literature (see table 1 and figure 2), and will be presented here. For a comprehensive overview of chitosan polymers in vaccine delivery we also recommend the excellent review by Arca et al. [66], which was published during the edition of this review. TMC polymer is a positively charged chitosan derivative, which is readily soluble in water at pH values of 1-9 and at concentrations of up to 10% (w/v) [67]. In general, TMC is prepared in a one- or two-step synthesis through nucleophilic substitution at the primary amine group by methyl iodide (MeI) under basic conditions [68]. The degree of trimethylation (%DTM) is controlled by adjusting the reaction time and number of reaction steps, and measured by 1H NMR spectroscopy [69]. This parameter 21 is of high relevance, as only TMC with a %DTM above 22% was shown to be capable of opening tight junctions between epithelial cells in a transient manner, a prerequisite for paracellular drug transport [64]. Table 1: Selected in vivo investigated chitosan derivatives for mucosal antigen delivery. Derivative MW[kDa] TMC DS [%] 20 40 60 Delivery form Delivery route Ref. 110 81 79 Antigen/adjuvan t Ovalbumin Ovalbumin Ovalbumin Solution Solution Solution Nasal Nasal Nasal 73 TMC n.s. n.s. CRM-MenC/LTK63 Solution Nasal 74 TMC 15 37 63 94 Inactivated influenza virus Solution Nasal 75 TMC 19 n.s. CRM-MenC/LTK63 Microparticles, solution Nasal 76 TMC 25 177 H3N2 influenza subunit Nanoparticles Nasal 77 TMC 57 n.s. Tetanus toxoid Nanoparticles Nasal 78 TMC 50 n.s. Diphtheria toxoid Microparticles Pulmonary 79 TMC 20 n.s. Diphtheria toxoid Microparticles, solution Nasal, oral 82 TMC 37 n.s. H. pylori urease Nanoparticles, solution Oral 83 TMC 15 n.s. Ovalbumin Nanoparticles Oral 84 CTM CDM MCC TMC n.s. n.s. 70 57 n.s. n.s. n.s. pVAX(HBc) Nanoparticles Intramuscular 85 Tetanus toxoid Nanoparticles, solution Nasal 80 MCC-TMC 70/5 7 5.9 n.s. Tetanus toxoid Nanoparticles Nasal 86 n.s. Multiple antigens of B. bronchiseptica Microparticles Nasal 87 MC MW: molecular weight; DS: degree of substitution; Ref.: reference; TMC: N,N,N-trimethyl chitosan polymer; CRM-MenC: C. menigococci conjugate vaccine; LTK63: E. coli enterotoxin LTK63; CTM: chitosanN-trimethylaminonethylacrylate chloride-methylacrylate; CDM: chitosan-N-dimethyl-aminoethylmethacrylate hydrochloride-methylmethacrylate; pVAX(HBc): plasmid DNA expressing the Hepatitis B virus core antigen; MCC: Mono-N-carboxymethl chitosan; MC: Mannosylated chitosan; n.s.: not stated. 22 7.1. N,N,N-trimethyl chitosan (TMC) On the other hand, Kean et al. [70] reported that an increase in %DTM of oligomeric and polymeric TMC induces an increase in cytotoxicity in monkey kidney fibroblasts (COS-7) and epithelial breast cancer (MCF-7) cells. In addition, the degree of 3- and 6-hydroxy-methylation (%D3OM and %D6OM, respectively), as well as dimethylation (%DDM) of TMC need to be determined following synthesis, as it has been described that these three parameters are strongly correlated to the cytotoxicity and physico-chemical properties of TMC. Jintapattanakit et al. [71] reported that a ratio of %DDM/%DTM greater than unity causes a decrease in mucoadhesion and cytotoxicity; as an example, for TMC of a DTM of 20% and a DDM of 20% (denoted TMC20-20), an IC50 value approximately 100-times lower than for TMC20-60 was measured. 23 OH OH H3C H3C O O HO OH H3C N+ H3C Cl- OH O OH HO H n CH3 OH H TMC OH NH NH H n S O H MC OH H3C O O HO OH O O HO OH NH HO H3C n O O O MCC H3C Cl OH H3C H3C H3C O O HO p NH O n o H3CO + N - CH3 R R = H for CDM R = CH3 for CTM Figure 2: Molecular structure of a selection of chitosan derivatives (TMC = N,N,Ntrimethyl chitosan; MC = Mannosylated chitosan; MCC = Mono-N-carboxymethyl chitosan; CTM = chitosan-N-trimethylaminonethylacrylate chloride-methylacrylate; CDM = chitosan-N-dimethyl-aminoethylmethacrylate hydrochloride-methylmethacrylate). In addition, Verheul et al. [72] highlighted that 3- and 6-hydroxy-methylation of TMC polymers cause lower cytotoxicity on Caco-2 cells when compared to the corresponding O-methyl free TMC polymers. With regard to the formulation of antigens, TMC is capable of forming complexes or particles with negatively charged molecules by electrostatic interactions. This property is employed for i) polyelectrolyte complexation (polyplex) or nanoparticle (in aqueous sodium sulfate solution) formation with plasmid DNA (pDNA) encoding for the specific 24 antigen(s) in situ; ii) the association or coating of subunit antigen(s) with TMC and iii) the encapsulation and/or absorption of subunit antigen(s) via ionic cross-linking with tripolyphosphate (TPP). Considering this versatility in vaccine formulation, TMC solutions as well as micro- or nanosized particulate systems were extensively examined as carrier systems for mucosally applied vaccines (see table 1), whereby most studies focused on the nasal, pulmonary and oral routes of immunization [67]. Nasal delivery Generally, DTM is used as a measure for the positive charge density of TMC, which largely affects its permeation enhancing properties [69]. Boonyo et al. [73] studied the immune stimulatory effect of three different TMC polymers (DTM 20, 40 and 60%) in nasal application of ovalbumin in mice. In these studies, TMC with a DTM of 40% was shown to be the more expedient delivery system/adjuvant owing to its higher induction of mucosal and systemic antibodies at day 13 following immunization, when compared to the other TMC polymers and polymeric chitosan. Although this superior effect of TMC-40 became not significant at day 21, still ovalbumin in TMC-40 solution triggered higher IgG and IgA responses than TMC with a DTM of 20 and 60%. In another study involving an aqueous TMC solution, Baudner et al. [74] investigated the impact of TMC solution (DTM not stated) on the immune response of a conjugate vaccine against group C. meningococci (CRM-MenC) being co-administered with the mucosal adjuvant E. coli enterotoxin LTK63. Interestingly, intranasal immunization enhanced antibody as well as bactericidal responses in the presence of TMC, which were comparable to those induced by subcutaneous vaccination using aluminium hydroxide as a reference Th2 adjuvant and delivery system. Furthermore, Hagenaars et al. [75] coated whole inactivated 25 influenza virus (WIC) by simple mixing the antigen with two different TMC solutions (%DTM 15 and 37, respectively), and evaluated their influence on the physico-chemical and immunological properties of WIC. Around 10-15% of TMC polymer was associated with the WIC antigen. As expected, only the TMC-37 coated vaccine enabled paracellular transport across confluent Caco-2 cell monolayers. Following nasal immunization, the TMC-37 coated vaccine elicited higher IgG levels than TMC-15 in mice. This effect was, however, less pronounced than seen after intramuscular administration of the WIC antigen alone. More noteworthy, both TMC coated nasal vaccines protected mice well against influenza challenge, whereas nasally applied uncoated WIC did not. However, in contrast to the studies mentioned above, TMC solutions might not be the most suitable formulation type. Several studies indicated that particulate systems are more advantageous with respect to immunogenicity and stability of the formulation, among other factors [76,77]. Therefore, TMC-based micro- and nanoparticles were also included in mucosal immunization studies. In a follow-up of the above-mentioned study [78], CRM-MenC antigen was associated with LTK63 in TMC microparticles and their stimulating effect was compared with the respective powder formulation. Intranasal and subcutaneous application in mice did not result in significantly different serum and antibody titres. However, only nasal vaccine delivery was able to generate mucosal antibodies (immunoglobulin A, IgA). Moreover, the concept of using a particulate delivery system was extended by Amidi et al. [79] by the formulation of a monovalent influenza subunit H3N2 antigen in TMC nanoparticles. Particles had a size of about 650 nm and showed a positive surface charge. Nasal application of particles elicited more secretions local IgA (in nasal washes) and serum IgG in mice when compared to intranasal and intramuscular administration of the influenza antigen alone. In contrast, Sayın et al. [80] did not detect high titres of local IgA in nasal and vaginal 26 secretions in mice after application of TMC nanoparticles loaded with tetanus toxoid (TT). However, TT loaded TMC nanoparticles were capable to trigger significant levels of serum IgG in a Th2 predominant way, which was assumed to be beneficial, as a systemic immune response against TT was intended. Pulmonary vaccine delivery Besides nasal delivery, Amidi et al. [81] studied intratracheal immunization of guinea pigs using TMC microparticles encapsulating a diphtheria toxoid (DT). Administration of antigen-loaded TMC microparticles (MP) in guinea pigs resulted in a pronounced secretion of systemic antibodies, with an IgG2/IgG1 ratio of approximately three. Secrection of IgG and IgM were measured to be similar or even higher than those evoked by subcutaneous administration of alum-associated DT. More interestingly, local S-IgA antibodies were solely elicited after intratracheal application of DT-loaded TMC MP. Oral vaccine delivery The above mentioned diphtheria toxoid (DT) was also encapsulated in TMC microparticles (MP) by van der Lubben et al. [82]. Particles had a size of around 2 µm and were stable over a period of at least three months. In vivo studies in mice demonstrated that orally administered MP can induce a strong systemic immune response measured as significantly elevated IgG titers in the serum. In another study [83], the antigenic protein urease of H. pylori was associated to TMC nanoparticles. Mice immunized with these nanoparticles showed higher titres of serum IgG, as well as intestinal IgA antibodies, when compared to the application of the antigen in the absence of TMC. More recently, Slütter et al. [84] evaluated the use of ovalbuminloaded TMC nanoparticles in vivo in mice in a more systematic approach. 27 Similarly to van der Lubben et al. [82], oral application of TMC nanoparticles induced considerably higher levels of serum IgG in comparison to intramuscular injection of the model antigen. IgG response was slightly biased towards the Th1 type. In order to elucidate the mechanism, the transport of ovalbumin-loaded TMC nanoparticles across Caco-2/Raji-B cell co-culture was investigated. Caco-2 cell monolayers were previously shown to differentiate to an M-cell phenotype on co-cultivation with human B-cells (Raji). Stimulation of human dendritic cells (DC) by TMC nanoparticles was studied, as well. It was demonstrated that TMC nanoparticles transported the antigenic ovalbumin to a much higher extent across modified Caco-2 monolayers in comparison to the control group. However, this increase in transport was independent of the presence of M-cells capable of uptake and transcytosis of nanoparticles. On the other hand, only ovalbuminTMC nanoparticles facilitated maturation of human DCs into MHCII+/CD86+ DC, which is considered a critical step towards antigen presentation and subsequent immune activation of T lymphocytes. 7.2 Other chitosan derivatives Beyond the broad application of TMC, several other water-soluble chitosan derivatives have been used for the formulation of mucosal vaccines. In order to conserve the positive charge of TMC, Jiang et al. [85] synthesized a series of water-soluble chitosan derivatives by free radical polymerization. After polymerization, chitosan-N-trimethylaminonethylacrylate chloride-methylacrylate (CTM) as well as chitosan-N-dimethyl-aminoethylmethacrylate hydrochloride- methylmethacrylate (CDM) were obtained and used for complexation of the pDNA vaccine pVAX(HBc) encoding a hepatitis B virus (HBV) core antigen (HBcAg). 28 Both chitosan derivatives formed nanoparticles of a size of 230-270 nm, a positive surface charge and a complexation efficiency varying from 32 to 76%. After intramuscular administration of CTM and CDM pDNA nanoparticles in mice, a much stronger immune response to the pVAX(HBc) vaccine was elicited than for the vaccine alone, shown by elevated IFN-γ production, high HBcAg-specific IgG titer and an HbsAgspecific cytotoxic T-lymphocyte response of murine splenocytes. Although no HBV challenge study was performed, these studies indicated that both derivatives are suitable pDNA vaccine delivery systems, with CTM appearing to be the better candidate. A further water-soluble derivative of chitosan intended for vaccine delivery is mono-Ncarboxymethyl chitosan (MCC) [80]. Sayın and colleagues compared TMC to MCC in oral delivery of a tetanus toxoid (TT) in particulate and dispersion form. MCC particles had a small particle size of 40-90 nm and were negatively charged. In contrast to TT-bearing chitosan and TMC nanoparticles, MCC particles did not elicit high levels of serum IgG in mice after intranasal and subcutaneous administration. Interestingly, intranasal codelivery of MCC and TT in a dispersion triggered higher subclass IgG1 antibody secretion than free TT. However, compared to chitosan and TMC, the IgG1 response to MCC nanoparticles was significantly lower. In a subsequent investigation, Sayın et al. [86] applied MCC and positively charged TMC polymers to form nanosized particles incorporating TT. Intranasal administration in mice of these TMC-MCC nanoparticles elicited systemic TT-specific IgG levels being slightly superior to those of the control group (free TT applied subcutaneously). In addition, MCC-TMC nanoparticles induced a Th2 predominant immune response (see also section 5 of this review), when the ratio of IgG2a to IgG1 was calculated to be lower than unity. 29 Local IgA antibody titers in vaginal and nasal secretions were not found to be significant in comparison to systemic IgA titers. In order to evaluate further the benefit of this vaccine carrier system, a challenge study in mice is strongly recommended. Besides rendering polymeric chitosan water-soluble for its use at physiological pH, another approach for vaccine delivery is the attachment of targeting moieties onto the surface of chitosan particles. Jiang et al. [87] described the synthesis of mannosylated polymeric chitosan (MC) for improved receptor-mediated uptake of particles, presumably due to interaction of grafted mannose residues with the mannose receptor predominantly expressed on macrophages and dendritic cells. Chitosan and MC microparticles containing multiple antigens of B. bronchiseptica were applied nasally to mice. Compared to chitosan microparticles, MC microparticles induced slighty higher titers of local IgA (nasal and saliva washes) and serum IgA 10 weeks post immunization. Moreover, immunization with both delivery systems yielded high survival rates of up to 70% seven days post challenge, although no significant difference between the MC and chitosan groups was detected. In our lab, a new water-soluble chitosan derivative 6-Ocarboxymethyl-N,N,N-trimethyl chitosan polymer (CM-TMC) was synthesized, and used for covalent attachment of a Toll-like receptor (TLR) agonist as adjuvant [88], as described in chapter 2 of this thesis. This concept allows for the combination of an innate immune system stimulator (adjuvant) and an antigen in the same delivery system (i.e. chitosan particles), which is generally supposed to be needed for effective vaccines [89]. As described in chapter 3 of this thesis, nanoparticles formed from this polymer and green fluorescent protein (GFP) expressing DNA by self-assembly were shown to elicit TLR-mediated chemokine IL-8 release from human macrophages [90]. 30 8. Outlook In the future, we expect the following progress in chitosan-based vaccine delivery system taking place: i) More chitosan-based vaccine formulations are going into clinical trials. LigoCyte Pharmaceutical, Inc. recently has introduced its product, Norwalk vaccine, into a clinical phase I trial. The Norovirus vaccine is a needle-free, dry powder formulation based on virus like particle (VLP) antigens, including the adjuvant Monophosphoryl Lipid A, and chitosan to enhance nasal delivery [91]. ii) More thorough investigations on chitosan’s adjuvant properties will help to better define its potential in vaccine formulation. iii) New chitosan derivatives might emerge from the field of non-viral gene delivery [92], e.g., PEGylated TMC for the field of DNA vaccine delivery [93]. iv) Further improvements in vaccine design will be the attachment/inclusion of specific adjuvants to antigen loaded chitosan formulations in order to trigger well-defined parts of the immune system. In a nutshell, as demonstrated in this review, chitosan and its derivatives are very auspicious materials for the delivery of mucosal vaccines (e.g., for nasal, pulmonary and oral administration), and merit further elaborate investigations as a vaccine delivery platform. 31 References [1] Senel S. and McClure S.J. Potential applications of chitosan in veterinary medicine. - Adv. Drug Deliv. Rev., 56 (10),1467–1480, 2004. [2] Mun S., Decker E. A., McClements D. J., Effect of molecular weight and degree of deacetylation of chitosan on the formation of oil-in-water emulsions stabilized by surfactant-chitosan membranes. - J. Colloid Interface Sci., 296 (2), 581-590, 2006. [3] Schipper N.G., Olsson S., Hoogstraate J.A., deBoer A.G., Varum K.M., Artursson P., Chitosan as absorption enhancers for poorly absorbable drugs. 2: Mechanism of absorption enhancement. - Pharm. Res., 14, 923–9, 1997. [4] Illum, L., 1998. Chitosan and its use as a pharmaceutical excipient. - 101–103. Pharm. Res. 15, 1326–1331. [5] van der Lubben I.M., Verhoef J.C., Borchard G., Junginger H.E., Chitosan for mucosal vaccination. - Adv. Drug Deliv. Rev., 52, 139–144, 2001. [6] Alpar H.O., Somavarapua S., Atuahb K.N., Bramwell V.W. - Biodegradable mucoadhesive particulates for nasal and pulmonary antigen and DNA delivery. Adv. Drug Deliv. Rev., 57, 411–430, 2005. [7] Moschos S.A., Bramwell V.W., Somaravapu S., Alpar H.O. - Special Feature Adjuvant synergy: The effects of nasal coadministration of adjuvants. - Immun. Cell Biol., 82, 628–637, 2004. [8] Cui C., Stevens V.C., Schwendeman S.P. - Injectable polymer microspheres enhance immunogenicity of a contraceptive peptide vaccine. - Vaccine, 25, 500509, 2007. [9] Zhu B., Qie Y., Wang J., Zhang Y., Wang Q., Xu Y., Wang H. - Chitosan microspheres enhance the immunogenicity of an Ag85B-based fusion protein containing 32 multiple T-cell epitopes of Mycobacterium tuberculosis. - Eur. J. Pharm. Biopharm., 66, 318–326, 2007. [10] Borges O., Borchard G., Verhoef J.C., de Sousa A., Junginger H.E. - Preparation of coated nanoparticles for a new mucosal vaccine delivery system. - Int. J. Pharm., 299, 155–166, 2005. [11] Xie Y., Zhou N.J., Gong Y.F., Zhou X.J., Chen J., Hu S.J., Lu N.H., Hou X.H. - The immune response induced by H pylori vaccine with chitosan as adjuvant and its relation to immune protection. - World J. Gastroenterol., 13, 1547-1553, 2007. [12] Lycke N., Holmgren J. - Strong adjuvant properties of cholera toxin on gut mucosal immune responses to orally presented antigens. - Immunology, 59, 301308, 1986, [13] Matter A. - The effects of Muramyldipeptide (MDP) in cell-mediated immunity. Cancer Immunology Immunother., 6, 1432-0851, 1979. [14] Seferian P.G., Martinez M.L. - Immune stimulating activity of two new chitosan containing adjuvant formulations. - Vaccine, 19, 661–668, 2001. [15] Aitken R.J. - Immunocontraceptive vaccines for human use. - J. Reproduct. Immun., 57, 273-287, 2002. [16] McNeela E. A., Jabbal-Gill I. , Illum L., Pizza M., Rappuoli R., Podda A., Lewis D.J.M., Mills K.H.G. - Intranasal immunization with genetically detoxified diphtheria toxin induces T cell responses in humans: enhancement of Th2 responses and toxinneutralizing antibodies by formulation with chitosan. - Vaccine, 22, 909–914, 2004. [17] McNeela E., O’Connan D., Jabbal-Gill I., Illum L., Davis S.S., Pizza M., Rappuoli R., Mills K.H.G.A. - Mucosally delivered vaccine against diphtheria; formulation of 33 reacting material (CRM197) of diphtheria toxin with chitosan enhances local and systemic responses following nasal delivery. - Vaccine., 19, 1188-1198, 2000. [18] Van der Lubben I.M., Verhoef J.C., Van Aelst A., Borchard G., Junginger H.E. Chitosan microparticles for oral vaccination: preparation, characterization and preliminary in vivo uptake studies in murine Peyer’s patches. - Biomaterials, 22, 687–694, 2001. [19] Van der Lubben I.M., Konings F.A.J., Borchard G., Verhoef J.C., Junginger, H.E.. - In vivo uptake of chitosan microparticles by murine Peyer’s patches: visualization studies using confocal laser scanning microscopy and immunohistochemistry. - J. Drug Target., 9, 39–47, 2001. [20] Jabbal-Gill I., Fischer A.N., Rappuoli R., Davis S.S. Illum L.- Stimulation of mucosal and systemic responses against Bordetella pertussis filamentous haemagglutinin and recombinant pertussis toxin after nasal administration with chitosan in mice.- Vaccine, 16, 2039–2046, 1998. [21] MacLaughlin F.C., Mumper R.J., Wang J., Tagliaferri J.M., Gill I., Hinchcliffe M., Rolland A.P. - Chitosan and depolymerised chitosan oligomers as condensing carriers for in vivo plasmid delivery. - J. Control. Rel., 56, 259–272, 1998. [22] Jiang H.L., Park I.K., Shin N.R., Kangb S.G., Yoo H.S., Kim S.I., Suh S.B., Akaiked T., Cho C.S. - In vitro study of the immune stimulating activity of an athrophic rhinitis vaccine associated to chitosan microspheres. - Eur. J. Pharm. Biopharm., 58, 471– 476, 2004. [23] Kang M.L., Kang S.G., Jiang H.L., Shin S.W., Lee D.Y., Ahn J.M., Rayamahji N., Park I.K., Shin S.K., Cho C.S., Yoo H.S. - In vivo induction of mucosal immune responses by intranasal administration of chitosan microspheres containing Bordetella bronchiseptica DNT. - Eur. J. Pharm. Biopharm., 63 (2), 215-220, 2006. 34 [24] Nagamoto T., Hattori Y., Takayama K., Maitani Y. - Novel Chitosan Particles and Chitosan-Coated Emulsions Inducing Immune Response via Intranasal Vaccine Delivery. - Pharm. Res., 21, 671-674, 2004. [25] Tengamnuay P., Sahamethapat A., Sailasuta A., Mitra A. - Chitosans as nasal absorption enhancers of peptides: comparison between free amine chitosans and soluble salts. - Int. J. Pharm., 197, 53–67, 2000. [26] Zaharoff D.A., Rogers C.J., Hance K.W., Schlom J., Greiner J.W. - Chitosan solution enhances the immunoadjuvant properties of GM-CSF. - Vaccine, 25, 8673–8686, 2007. [27] McClure S.J. - Mucosal delivery of native and recombinant protein vaccines against Trichostrongylus colubriformis. - Int. J. Parasitol., 39(5), 599-606, 2009. [28] Alarcon J.B., Waine G.W., McManus D.P. - DNA vaccines: technology and application as anti-parasite and anti-microbial agents. - Adv. Parasitol., 42, 343– 410,1999. [29] Kutzler M.A., Weiner D.B. - DNA vaccines: ready for prime time? - Nature Rev., 9, 776-788, 2008. [30] Felgner J.H., Kumar R., Sridhar C.N., Wheeler C.J., Tsai Y.J., Border R., Ramsey P., Martin M., Felgner P.L. - Enhanced gene delivery and mechanism studies with a novel series of cationic lipid formulations. - J. Biol. Chem., 269, 2550–2561, 1994. [31] Gregoriadis G., McCormack B., Obrenovic M., Saffie R., Zadi B., Perrie Y. -Vaccine entrapment in liposomes. - Methods, 19, 156–162, 1999. [32] Illum L., Jabbal-Gill I., Hinchcliffe M., Fischer A.N., Davis S.S. - Chitosan as a novel nasal delivery system for vaccines. - Adv. Drug Deliv., Rev. 51, 81–96, 2001. 35 [33] Atuah K.N., Walter E., Merkle H.P., Alpar H.O. - Encapsulation of plasmid DNA in PLGA-stearylamine microspheres: a comparison of solvent evaporation and spray-drying methods. - J. Microencapsul., 20, 387– 399, 2003. [34] Bramwell V.W., Eyles J.E., Somavarapu S., Alpar H.O. - Liposome/DNA complexes coated with biodegradable PLA improve immune responses to plasmid encoding hepatitis B surface antigen. - Immunology, 106, 412– 418, 2002. [35] Somavarapu S., Bramwell V.W., Alpar H.O. - Oral plasmid DNA delivery systems for genetic immunization. - J. Drug Target., 11, 547–553, 2003. [36] Men Y., Audran R., Thomasin C., Eberl G., Demotz S., Merkle H.P., Gander B., Corradin G. - MHC class I- and class II-restricted processing and presentation of microencapsulated antigens. - Vaccine, 17, 1047–1056, 1999. [37] Kanke M., Morlier E., Geissler R., Powell D., Kaplan A., DeLuca P.P. - Interaction of microspheres with blood constituents II: Uptake of biodegradable particles by macrophages. - J. Parenter. Sci. Technol., 40 (4), 114–118, 1986. [38] Raychaudhuri S., Rock K.L. - Fully mobilizing host defence: building better vaccines. - Nat. Biotechnol., 16, 1025–1031, 1998. [39] Perrie Y., Frederik P.M., Gregoriadis G. - Liposome-mediated DNA vaccination: the effect of vesicle composition. - Vaccine, 19, 3301–3310, 2001. [40] Alpar H.O., Bramwell V.W. - Current status of DNA vaccines and their route of administration. - Crit. Rev. Ther. Drug Carr. Syst., 19, 307– 383, 2002. [41] Yewdell W.J., Norbury C.C., Bennink J.R. - Mechanisms of exogenous antigen presentation by MHC class I molecules in vitro and in vivo: implications for generating CD8+ T cell responses to infectious agents, tumor, transplants, and vaccines. - Adv. Immunol., 73, 1–77, 1999. 36 [42] Roy K., Mao H.-Q., Huang S.-K., Leong K. - Oral gene delivery with chitosan DNA nanoparticles generates immunologic protection in a murine model for peanut allergy. - Nat. Med., 5, 382–390, 1999. [43] Bivas-Benita M., van Meijgaarden K.E., Franken K.L.M.C., Junginger H.E., Borchard G., Ottenhoff T.H.M., Geluk A. - Pulmonary delivery of chitosan-DNA nanoparticles enhances the immunogenicity of a DNA vaccine encoding HLA-A*0201-restricted T-cell epitopes of Mycobacterium tuberculosis. - Vaccine, 22 (13-14), 1609-1615, 2004. [44] Bivas-Benita M., Laloup M., Versteyhe S., Dewit J., De Braekeleer J., Jongert E., Borchard G. - Generation of Toxoplasma gondii GRA1 protein and DNA vaccine loaded chitosan particles: preparation, characterization, and preliminary in vivo studies. - Int. J. Pharm., 266, 17–27, 2003. [45] Cui Z., Mumper R.J. - Chitosan-based nanoparticles for topical genetic immunization. - J. Control. Rel., 75 (3), 409-419, 2001. [46] Munier S., Messai I., Delair T., Verrier B., Ataman-Onal Y. - Cationic PLA nanoparticles for DNA delivery: Comparison of three surface polycations for DNA binding, protection and transfection properties. - Colloid. Surf. B: Biointerfaces, 43(3-4), 163-173, 2005 [47] Kumar R., Bakowsky U., Lehr C.M. - Preparation and characterization of cationic PLGA nanospheres as DNA carriers. - Biomaterials, 25 1771-1777, 2004. [48] Davies O. R., Head L., Armitage D., Pearson E.A., Davies M.C., Marlow M., Stolnik S. - Surface modification of microspheres with steric stabilizing and cationic polymers for gene delivery. - Langmuir, 24, 7138-7146, 2008. 37 [49] Fischer S., Foerg C., Ellenberger S., Merkle H.P., Gander B. - One-step preparation of polyelectrolyte-coated PLGA microparticles and their functionalization with model ligands. - J. Control. Rel., 111, 135-144, 2006. [50] Jaganathan K.S., Vyas S. P. - Strong systemic and mucosal immune responses to surface-modified PLGA microspheres containing recombinant hepatitis B antigen administered intranasally. - Vaccine, 24, 4201–4211, 2006. [51] Zhou X., Liu B., Yu X., Zha X., Zhang X., Chen Y., Wang X., Jin Y., Wu Y., Chen Y., Shan Y., Chen Y., Liu J. Kong W., Shen J. - Controlled release of PEI/DNA complexes from mannose-bearing chitosan microspheres as a potent delivery system to enhance immune response to HBV DNA vaccine. - J. Control. Rel., 121, 200–207, 2007. [52] Gombotz W.R., Wee S.F. - Protein release from alginate matrices. - Adv. Drug Deliv. Rev., 31, 267–285, 1998. [53] Chretien C., Chaumeil J.C. - Release of a macromolecular drug from alginateimpregnated particles. - Int. J. Pharm., 304, 18–28, 2005. [54] Douglas K.L., Tabrizian M. - New approach to the preparation of alginate–chitosan nanoparticles as gene carriers. - J. Biomater. Sci. Polymer Edn., 16, 43–56, 2005. [55] Ciofani G., Raffa V., Menciassi A. Dario P. - Alginate and chitosan particles as drug delivery system for cell therapy. - Biomed. Microdevices, 10, 131–140, 2008. [56] Borges O., Cordeiro-da-Silva A., Romeijn S.G., Amidi M., de Sousa A., Borchard G., Junginger H.E. - Uptake studies in rat Peyer's patches, cytotoxicity and release studies of alginate coated chitosan nanoparticles for mucosal vaccination. - J. Control. Rel., 114, 348–358, 2006. [57] Tokura S., Tamura H., Azuma I. - Immunological aspects of chitin and chitin derivatives administered to animals. - Experientia, 87, 279– 292, 1999. 38 [58] Illum L. - Bioadhesive formulations for nasal peptide delivery, in: Mathiowitz E., Lehr C.M., Chickering D.S. (Eds.), Bioadhesion in Drug Delivery — Issues in Fundamental, Novel Approaches and Development, Marcel Dekker, New York, pp. 507–539, 1998. [59] Hall G., Lund L., Lamb J.R., Jarman E.R. - Kinetics and mode of peptide delivery via the respiratory mucosa determine the outcome of activation versus TH2 immunity in allergic inflammation of the airways. - J. Allergy Clin. Immunol., 110, 883-890, 2002. [60] Murthy G.N., Xu M., Frechet J.M. - Cross-linked microparticles as carriers for the delivery of plasmid DNA for vaccine development. - Bioconjug. Chem., 15, 467– 474, 2004. [61] Behrens I., Pena A.I.V., Alonso M.J., Kissel T. - Comparative uptake studies of bioadhesive and non-bioadhesive nanoparticles in human intestinal cell lines and rats: the effect of mucus on particle adsorption and transport. - Pharm. Res., 19, 1185-1193, 2002. [62] Mills K. H. G., Cosgrove C., McNeela E. A., Sexton A., Giemza R., Jabbal-Gill I., Church A., Lin W., Illum L., Podda A., Rappuoli R., Pizza M., Griffin G. E., Lewis D. J. M. - Protective levels of diphtheria-neutralizing antibody induced in healthy volunteers by unilateral priming-boosting intranasal immunization associated with restricted ipsilateral mucosal secretory immunoglobulin A. - Infect. Immun., 71 (2), 726–732, 2003. [63] Huo Z., Sinha R., McNeela E. A., Borrow R., Giemza R., Cosgrove C., Heath P.T., Mills K. H. G., Rappuoli R., Griffin G. E., Lewis D. J. M. - Induction of protective serum meningococcal bactericidal and diphtheria-neutralizing antibodies and mucosal immunoglobulinA in volunteers by nasal insufflations of the Neisseria 39 meningitides serogroup C polysaccharide-CRM197 conjugate vaccine mixed with chitosan. - Infect. Immun., 73 (12), 8256–8265, 2005. [64] Read R.C., Naylor S.C., Potter C.W., Bond J., Jabbal-Gill I., Fisher A., Illum L., Jennings R. - Effective nasal influenza vaccine delivery using chitosan. - Vaccine, 23(35), 4367-4374, 2005. [65] Strand S.P., Tømmeraas K., Varum K.M., Østgaard K. - Electrophoretic light scattering studies of chitosans with different degrees of N-acetylation. Biomacromolecules, 2, 1310-1314, 2001. [66] Arca H.C., Günbeyaz M., Senel S - Chitosan-based systems for the delivery of vaccine antigens.- Expert Rev. Vaccines, 8, 937-953, 2009. [67] Sahni J.K., Chopra S., Ahmad F.J., Khar R.K. - Potential prospects of chitosan derivative trimethyl chitosan chloride (TMC) as a polymeric absorption enhancer: synthesis, characterization and applications. - J. Pharm. Pharmacol., 60, 1111-1119, 2008. [68] Polnok A., Borchard G., Verhoef J.C., Sarisuta N., Junginger H.E. - Influence of methylation process on the degree of quaternization of N-trimethyl chitosan chloride. - Eur. J. Pharm. Biopharm., 57, 77-83, 2004. [69] Hamman J.H., Schultz C.M., Kotzé A.F. - N-trimethyl chitosan chloride: optimum degree of quaternization for drug absorption enhancement across epithelial cells. - Drug. Dev. Ind. Pharm., 29, 161-172, 2003. [70] Kean T., Roth S. Thanou M. - Trimethylated chitosans as non-viral gene delivery vectors: cytotoxicity and transfection efficiency. - J. Control. Rel., 103, 643-53, 2005. 40 [71] Jintapattanakit A., Mao S., Kissel T., Junyaprasert, V.B. - Physicochemical properties and biocompatibility of N-trimethyl chitosan: Effect of quaternization and dimethylation. - Eur. J. Pharm. Biopharm., 70, 563-571, 2008. [72] Verheul R.J., Amidi M., van der Wal S., van Riet E., Jiskoot W. , Hennink W.E. Synthesis, characterization and in vitro biological properties of O-methyl free N,N,N-trimethylated chitosan. - Biomaterials, 29, 3642-3649, 2008. [73] Boonyo W., Junginger H.E., Waranuch N., Polnok A., Pitaksuteepong T. - Chitosan and trimethyl chitosan chloride (TMC) as adjuvants for inducing immune responses to ovalbumin in mice following nasal administration. - J. Control. Rel., 121, 168-75, 2007. [74] Baudner C.B., Morandi M., Giuliani M.M., Verhoef J.C., Junginger H.E., Costantino P., Rappuoli R., Giudice G.D. - Modulation of immune response to group C meningococcal conjugate vaccine given intranasally to mice together with the LTK63 mucosal adjuvant and the trimethyl chitosan delivery system. - J. Infect. Dis., 189, 828-832, 2004. [75] Hagenaars N., Mastrobattista E., Verheul R.J., Mooren I., Glansbeek H.L., Heldens J.G., van den Bosch H., Jiskoot W. - Physicochemical and immunological characterization of N,N,N-trimethyl chitosan-coated whole inactivated influenza virus vaccine for intranasal administration. - Pharm. Res., 26, 1353-1364, 2009. [76] Soane R.J., Frier M., Perkins A.C., Jones N.S., Davis S.S., Illum L. - Evaluation of the clearance characteristics of bioadhesive systems in humans. - Int. J. Pharm., 178, 55-65, 1999. [77] Soane R.J., Hinchcliffe M., Davis S.S., Illum L. - Clearance characteristics of chitosan based formulations in the sheep nasal cavity. - Int. J. Pharm., 217, 183191, 2001. 41 [78] Baudner B., Verhoef J.C., Giuliani M.M., Peppoloni S., Rappuoli R., DelGiudice G., Junginger H.E. - Protective immune responses to meningococcal C conjugate vaccine after intranasal immunization of mice with the LTK63 mutant plus chitosan or trimethyl chitosan chloride as novel delivery platform. - J. Drug Target., 13, 489-498, 2005. [79] Amidi M., Romeijn S.G., Verhoef J.C., Junginger H.E., Bungener L., Huckriede A., Crommelin D.J., Jiskoot W. - N-trimethyl chitosan (TMC) nanoparticles loaded with influenza subunit antigen for intranasal vaccination: biological properties and immunogenicity in a mouse model. - Vaccine, 25, 144-153, 2007. [80] Sayın B., Somavarapu S., Li X.W., Thanou M., Sesardic D., Alpar H.O., Senel S. Mono-N-carboxymethyl chitosan (MCC) and N-trimethyl chitosan (TMC) nanoparticles for non-invasive vaccine delivery. - Int. J. Pharm., 363, 139-148, 2008. [81] Amidi M., Pellikaan H.C., Hirschberg H., de Boer A.H., Crommelin D.J., Hennink W.E., Kersten G., Jiskoot W. - Diphtheria toxoid-containing microparticulate powder formulations for pulmonary vaccinatiopn: preparation, charactrization and evaluation in guinea pigs. - Vaccine., 25, 6818-6829, 2007. [82] van der Lubben I.M., Verhoef J.C., Fretz M.M., van Opdorp F.A.C., Mesu I., Kersten G. - Trimethyl chitosan chloride (TMC) as novel excipient for oral and nasal immunization against diphtheria. - STP Pharm. Sci., 12, 235–242, 2002. [83] Chen F., Zhang Z.R., Yuan F., Qin X., Wang M., Huang Y. - In vitro and in vivo study of N-trimethyl chitosan nanoparticles for oral protein delivery. - Int. J. Pharm., 349, 226-233, 2008. 42 [84] Slütter B., Plapied L., Fievez V., Alonso S.M., des Rieux A., Schneider Y.J., van Riet E., Jiskoot W., Préat V. - Mechanistic study of the adjuvant effect of biodegradable nanoparticles in mucosal vaccination. - J. Control. Rel., 138, 113-121, 2009. [85] Jiang L., Qian F., He X., Wang F., Ren D., He Y., Li K., Sun S., Yin C. - Novel chitosan derivative nanoparticles enhance the immunogenicity of a DNA vaccine encoding hepatitis B virus core antigen in mice. - J. Gene Med. 9, 253-264, 2007. [86] Sayin B. Sayın B., Somavarapu S., Li X.W., Sesardic D., Senel S., Alpar O.H. - TMCMCC (N-trimethyl chitosan-mono-N-carboxymethyl chitosan) nanocomplexes for mucosal delivery of vaccines. Eur. J. Pharm. Sci. 38, 362-369, 2009, [87] Jiang H.L., Kang M.L., Quan J.S., Kang S.G., Akaike T., Yoo H.S., Cho C.S. - The potential of mannosylated chitosan microspheres to target macrophage mannose receptors in an adjuvant-delivery system for intranasal immunization. Biomaterials, 29, 1931-1939, 2008. [88] Heuking S., Iannitelli A., Di Stefano A., Borchard G. - Toll-like receptor-2 agonist functionalized biopolymer for mucosal vaccination. - Int. J. Pharm., 381, 97–105, 2009. [89] O´Hagan D.T., Singh M., Ulmer J.B. - Microparticle-based technology for vaccines. Methods, 40, 10-19, 2006. [90] Heuking S., Adam-Malpel S., Sublet E., Iannitelli A., di Stefano A., Borchard G. Stimulation of human macrophages (THP-1) using Toll-like receptor-2 (TLR-2) agonist decorated nanocarriers. - J. Drug Target., 2009, 17, 662-670 . [91] http://www.clinicaltrials.gov/ct2/show/NCT00806962?term=ligocyte&rank=1 [92] Lai W.F., Lin M.C. - Nucleic acid delivery with chitosan and its derivatives. - J. Control. Rel., 134, 158-168, 2009. 43 [93] Germershaus O., Mao S., Sitterberg J., Bakowsky U., Kissel, T. - Gene delivery using chitosan, trimethyl chitosan or polyethylenglycol-graft-trimethyl chitosan block copolymers: establishment of structure-activity relationships in vitro. - J. Control. Rel., 125, 145-154, 2008. 44 Chapter 2 Aim of the thesis and study objectives 45 General According to a recent report of the Initiative of Vaccine Research (WHO, 2005), three major intracellular diseases (HIV/AIDS, malaria and tuberculosis) contribute to half of the burden of all infectious diseases and cause death of over 15 million humans every year worldwide. With an increasing understanding of the human immune system and its molecular answers to infections, it becomes more and more obvious that antibody-inducing vaccines might be not the appropriate solution. For prevention of intracellular infections, a vaccine initiating a potent cytotoxic T lymphocyte (CTL) response is required. Plasmid deoxyribonucleic acid (DNA) vaccination might be an answer due to its hallmark of inducing a strong CTL response in orchestration with CD4+ T helper cells (cellular immunity), as well as its generation of antibodies (humoral immunity). In comparison to current protein vaccines, plasmid DNA vaccination offers many advantages, such as i) favoring a cellular immunity, ii) allowing the genetic construction of multiple antigens of choice included in the same vector, iii) possessing an intrinsic adjuvant, unmethylated 5´-deoxycytidine-phosphate-guanosine (CpG)-motifs, which are stimulating the innate immune system via the Toll-like receptor-9 (TLR-9), iv) prolonging the expression of the antigenic protein(s), which is continuously stimulating the immune response, v) being easily produced, up-scaled and stored at higher temperatures without causing loss of activity. Despite promising results of plasmid DNA immunizations in preclinical trials, studies in non-human primates and humans have failed so far in achieving protective immunity. The main reason for this drawback was related to the low transfection efficacy of plasmid DNA vaccines as a result of extra- (e.g., enzymatic degradation by DNases) and intracellular (e.g., endosomal escape) transport barriers for plasmid DNA resulting in 46 low amounts of antigenic proteins expressed in situ. Consequently, amelioration strategies were undertaken in relation to the targeted infectious disease, ranging from plasmid DNA optimization over co-formulation with adjuvants to changing the route of administration, to e.g., aerosol vaccination. Aerosol delivery of vaccines is considered a promising route of immunization owing to several clinical trials with measles vaccines, one being currently tested in clinical phase II/III trial. Concerning an efficient delivery of DNA vaccine into the lung, particle-based delivery systems are beneficial, because of their ability to protect the plasmid DNA from enzymatic degradation and to facilitate DNA transfection in vivo. Next to the antigen delivery system, a potent adjuvant capable of stimulating the innate immune system is required for enhancing the overall poor immunogenicity of a DNA vaccine alone. Moreover, adjuvant and antigen have to be co-delivered in the same particulate system in order to elicit successfully an immune response against the targeted antigen. Aim of thesis: 1. To prepare and to characterize TLR agonist functionalized polymers. 2. To use these new polymers for the formulation of DNA containing nanoparticles. 3. To study in vitro the benefit of TLR agonist functionalization of DNA nanoparticles. 4. To evaluate the in vivo immunogenicity of TLR agonist functionalized DNA nanoparticles. 47 Innovation of thesis To our best knowledge, we are the first to provide a vaccine delivery system with a covalent bond between the polymeric drug delivery system and Toll-like receptor agonists. We submitted the detailed synthesis of CM-TMC-g-PEG-Pam3Cys co-polymer on the 28th of October 2008 to the International Journal of Pharmaceutics. In more detail, this thesis focused on the covalent coupling of different adjuvants (Tolllike receptor (TLR) agonists) onto a vaccine carrier system (polymeric chitosan) followed by their detailed chemical analysis. TLR agonist functionalized chitosan derivatives were then applied for the encapsulation of a plasmid DNA resulting in nanosized particles. TLR agonist functionalized DNA particles were investigated in vitro for their transfection efficiency and immunogenicity in THP-1 macrophages. In terms of pulmonary vaccination, we studied uptake and immune stimulatory capacity of adjuvant functionalized DNA nanoparticles by using a triple cell culture model of the human respiratory tract. Finally, the immunogenicity of TLR agonist functionalized nanoparticles was evaluated in vivo for the delivery of a DNA vaccine encoding the epitope Ag85A of Mycobacterium tuberculosis. Organization of this thesis This thesis consists of two experimental parts (part II and part III). Part II describes the synthesis of novel TLR agonist chitosan derivatives being used for the preparation of DNA nanoparticles and successive in vitro evaluation. Part III comprises uptake studies in an in vitro model of the human respiratory tract followed by an immunogenicity study in mice. 48 Part II Within the first experimental part, chapter 3 describes the synthesis of a new watersoluble polymeric chitosan derivative, 6-O-carboxymethyl-N,N,N-trimethyl chitosan (CM-TMC), which was employed as platform for the ligation of further TLR agonists. To CM-TMC, we grafted a water-soluble TLR-2 agonist (NH2-PEG-Pam3Cys) through the use of a poly(oxyethylene) (PEG) spacer (final product: co-polymer CM-TMC-g-PEGPam3Cys). In chapter 4, we used the new co-polymer for preparation of DNA nanoparticles, which were investigated for their physico-chemical properties, transfection efficiency and immunogenicity in vitro. Chapter 5 presents the synthesis of a new TLR-7 agonist (9benzyl-8-hydroxyadenine, 8HA) functionalized co-polymer, CM-TMC-g-NH-PEG-8HA, which was similarly used for DNA NP preparation followed by an in vitro analysis of transfection efficiency and immunogenicity. Part III Chapter 6 reports on the uptake pattern of TLR-2 agonist nanoparticles in a triple cell culture model involving two important species of antigen-presenting cells: human-blood derived macrophages and dendritic cells. In chapter 7, we studied the in vivo adjuvant potential of the CM-TMC-g-PEG-Pam3Cys co-polymer for the delivery of the plasmid DNA vaccine pAg85A against Mycobacterium tuberculosis. 49 50 Part II Preparation and in vitro characterization of TLR-agonist functionalized DNA nanoparticles 51 Chapter 3 Toll-like receptor-2 agonist functionalized biopolymer for mucosal vaccination S. Heuking1,2,#, A. Iannitelli1,2,3,#, A. di Stefano3 and G. Borchard1,2 Published in: International Journal of Pharmaceutics (2009) 381, 97-105. ¹School of Pharmaceutical Sciences, University of Geneva, Switzerland 2Centre Pharmapeptides, Archamps, France 3Department of Drug Science, University ”G. D'Annunzio”, Chieti, Italy # Authors S.H. and A.I. contributed equally to this work 52 Abstract The objective of this study was to provide a new water-soluble chitosan derivative being functionalized with a Toll-like receptor-2 (TLR-2) agonist. At first, we synthesized the water-soluble TLR-2 agonist ω-amido-[Nα-palmitoyl-oxy-S-[2,3-bis(palmitoyl-oxy)-(2R)propyl]-[R]–cysteinyl]-α-amino poly(ethylene glycol) (Pam3Cys-PEG-NH2), which was characterized by 1H and 13C NMR as well as mass spectroscopy. Secondly, Pam3Cys-PEGNH2 was then successfully grafted to 6-O-carboxymethyl-N,N,N-trimethyl chitosan polymers (CM-TMC) using EDC/NHS as condensing agents. The copolymer was analysed by means of 1H and 13C NMR and FTIR spectroscopy. 13C NMR spectroscopy did not deliver evidence that an amide bond was formed between CM-TMC and Pam3Cys-PEGNH2. However, 1H NMR and FTIR spectroscopy demonstrated clearly that successful grafting took place. Based upon these results, this new TLR-2 functionalized biopolymer merits further investigation as material for vaccine delivery systems. 1. Introduction Chitosan is a linear, cationic polysaccharide consisting of randomly distributed β-(1-4)linked D-glucosamine (deacetylated unit) and N-acetyl-D-glucosamine (acetylated unit) monomers. It is industrially produced by alkaline deacetylation of chitin, which is the structural element in the exoskeleton of crustaceans. Due to many advantageous properties, such as low toxicity, absorption enhancement of hydrophilic drugs and mucoadhesive properties (van der Lubben et al. 2001a; Chopra et al. 2006), chitosan attracted considerable attention as a novel excipient in mucosal drug and vaccine delivery. Regarding the latter, chitosan polymers can easily encapsulate or adsorb antigens via the formation of micro- or nanoparticles, which has been demonstrated, e.g., for tetanus toxoid, diphtheria toxoid (van der Lubben et al. 2001b) and a plasmid 53 DNA encoding eight different antigenic epitopes of M. tuberculosis (Bivas-Benita et al. 2004) . However, the majority of such vaccines lack most of the features of the original pathogen, such as innate immune stimulation, and are therefore often poorly immunogenic (O’Hagan et al. 2006). Hence, non-specific stimulators of the immune system (adjuvants) are needed to render a vaccine more effective in view of eliciting protective immunity (Pashine et al. 2005). The present strategy for the development of new vaccines is to include highly purified synthetic adjuvants, which are able to trigger well-defined elements of the immune system. Hereby, so-called Toll-like receptor (TLR) agonists have been lately considered as very auspicious due to their ability to elicit a significant innate immune response which, in turn, affects strongly the initiation of adaptive immunity (Iwasaki and Medzhitov 2004). TLRs are a family of at least 10 receptors able to recognize and discriminate highly conserved microbial structural motifs of bacteria, viruses, fungi and protozoae. Their activation results in an immune response accompanied by increased levels of proinflammatory and immune-related cytokines. Maturation of dendritic cells and their subsequent migration to regional lymph nodes followed by a facilitated presentation of antigens to T-lymphocytes have been described (Iwasaki and Medzhitov 2004). Among all TLRs, TLR-2 recognizes the broadest repertoire of pathogen-associated molecular patterns (PAMPs) from a large variety of pathogens. TLR-2 is highly expressed on the membrane ofby dendritic cells, which are considered as the most potent cell type for antigen presentation (Wetzler 2003; Iwasaki and Medzhitov 2004; Schmitt et al. 2008). TLR-2 recognizes its ligands as heterodimer either in combination with TLR-1 or TLR-6. 54 A major difference between both heterodimer types is that TLR-1/TLR-2 enables recognition of triacylated lipoproteins, whereas TLR-2/TLR-6 detects diacylated lipoproteins and peptidoglycans (Wetzler 2003). Notably, Nα-Palmitoyl-S-[2,3-bis(palmitoyloxy)-(2RS)-propyl]-[R]-Cys-[S]-Ser-[S]-Lys (4) trihydrochloride (Pam3CSK4), a synthesized tripalmitoylated lipopeptide, is capable to trigger TLR-2 as a TLR-1/TLR-2 agonist and possesses a strong adjuvant capacity (Lombardi et al. 2008; Wedlock et al. 2008). Moreover, Kleine et al. demonstrated that conjugates of the lipophilic Pam3Cys moiety coupled to poly (ethylene glycol) (PEG) become water-soluble (up to 10mg/mL), while retaining their immunological properties (Kleine et al. 1994). In order to combine the adjuvant capacity of Pam3Cys moiety with the excellent mucosal vaccine delivery features of chitosan polymers, we synthesized the pure diastereomeric TLR-2 agonist ω-amido-[Nα-palmitoyl-oxy-S-[2,3-bis(palmitoyl-oxy)-(2R)-propyl]-[R]– cysteinyl]-α-amino poly (ethylene glycol) (abbreviated Pam3Cys-PEG-NH2, molecular weight ~3990 Da) and coupled it covalently to a new water-soluble chitosan polymer. This concept would allow an ideal combination of adjuvant and (encapsulated or surface adsorbed) antigens in the same particulate system (chitosan polymer), which is supposed to be required for effective vaccines (O`Hagan et al. 2006; Schlosser et al. 2008). As water-soluble chitosan derivative, we selected 6-O-carboxymethyl-N,N,N-trimethyl chitosan polymer (CM-TMC, molecular weight ~200 kDa) and applied a relatively low grafting percentage (Pam3Cys-PEG-NH2 to CM-TMC) of ≤ 5%, so that the main characteristics of chitosan as a polymeric delivery system were preserved. In order to synthesize CM-TMC we started firstly by trimethylation of chitosan polymer giving N,N,N-trimethyl chitosan polymer (TMC). This chitosan derivative demonstrated 55 beneficial water-solubility at physiological pH values due to its permanent quaternization (Sahni et al. 2008) and featured strong adjuvant properties when used as vaccine delivery system, e.g., for a CRM-MenC conjugate vaccine (Baudner et al. 2004, Baudner et al. 2005). The successive synthesis of CM-TMC from TMC was described previously by Murata and colleagues, however, neither the molecular weight of chitosan (e.g., oligomeric or polymeric) used and conditions under which the chemical synthesis was performed were mentioned (Murata et al. 1996; 1997). Furthermore, Jansma et al. (2003) synthesized 6-O-carboxymethyl-N,N,N-trimethyl chitosan oligomers (CM-TMO). However, oligomeric chitosan is readily water-soluble, whereas polymeric chitosan solely dissolves in diluted acidic aqueous solutions (pH < 6.5) (Qin et al. 2006). The aim of our study was to establish a reproducible method for the synthesis of CMTMC and to successively graft Pam3Cys-PEG-NH2 to polymeric CM-TMC. 2. Materials and methods 2.1 Materials Chitosan (ChitoClear® cg110), of an intrinsic viscosity of 33 mPa·s, a molecular weight (MW) of approximately 200 kDa, and a degree of deacetylation (DD) of 94% was purchased from Primex, Iceland. Dialysis membrane Spectra/Por 4 (cut-off 12-14 kDa) was obtained from Spectrum, USA. N,N’-Bis(fluorenylmethoxycarbonyl)-[R]-cystine-bistert-butyl ester was purchased from Bachem, Switzerland. α,ω-bis-amino poly(ethylene glycol), PEG diamine (MW ~ 3000Da) was purchased from Iris Biotech GmbH, Germany. All the other reagents and solvents were of analytical grade and supplied by SigmaAldrich, Switzerland. 56 2.2 Characterization of polymers 1H NMR and 13C NMR spectra were recorded on a Varian VXR 300 MHz or 500 MHz spectrometer (Varian, Switzerland). Chitosan was dissolved in 1% v/v DCl/D2O, chitosan derivatives in D2O and all other compounds in CDCl3. Chemical shifts are reported in parts per million (δ) downfield from the internal standard tetramethylsilane (Me4Si). MS spectra were recorded on an API 150 EX LC/MS System (Applied Biosystems/MDS Sciex, Switzerland) equipped with a turbo ion spray ionization source. The MALDI-Tof mass spectrometry was carried out on an Axima CFR+, Shimadzu mass spectrometer, using 2-(4-hydroxyphenylazo)-benzoic acid (HABA) as matrix. Homogeneity was confirmed by thin layer chromatography (TLC) on silica gel Merck 60 F254 aluminium-backed plates. Solutions were routinely dried over anhydrous sodium sulphate prior to evaporation. Chromatographic purifications were performed by employing a Merck 60 70-230 and 230-400 mesh ASTM silica gel column. FTIR spectra were recorded on a Perkin-Elmer 100 FTIR spectrometer (Perkin-Elmer, Switzerland) in the range of 4000–400 cm-1 using KBr pellets (1% w/w of product in KBr). 2.3 Synthesis of TMC Trimethylation of chitosan polymers was performed according to a previously published method (Sieval et al. 1998) that was slightly modified. Briefly, chitosan polymer (2g) was suspended in 1-methyl-2-pyrrolidinone (NMP, 80mL) with sodium hydroxide (NaOH, 4.8g) at 60 °C under stirring in a round bottom flask. Sufficient NaOH (11 mL of 15% w/v; aqueous) was added in order to maintain an alkaline environment throughout the reaction. Methylation was achieved through nucleophilic substitution by addition of methyl iodide (MeI, 12 mL). 70 minutes later, the solution was taken and products were precipitated by addition of sufficient volumes of a mixture of diethyl ether and ethanol 57 (ratio of 1:1 v/v). The wet product was again dissolved in 80 mL NMP at 60 °C and 10 mL of 15% w/v sodium hydroxide (NaOH, aqueous) was added to the solution. After addition of 7 mL methyl iodide (MeI), the reaction was let under condensor for 35 minutes. Next, 0.6 g NaOH pellets and 5 mL MeI were added for further 35 minutes. TMC was then precipitated by using 5-10 volumes diethyl ether:ethanol (1:1 v/v) and centrifuged (1850 x g, 15 minutes). The finalized product was subsequently dissolved in 40 mL 10% NaCl solution to perform counter ion replacement and to prevent iodine oxidation. After stirring overnight the TMC solution was dialysed over three days (twice daily changing deionized water) and finally freeze-dried. The degree of trimethylation (DTM), dimethylation (DDM), 3-hydroxy- (D3OM) and 6-hydroxy-methylation (D6OM) were calculated as reported elsewhere (Polnok et al. 2004; Verheul et al. 2008). Yield 36%. 1H NMR (300 MHz, D2O): δ 2.0 (COCH3); δ 2.8 (N-(CH3)2 ); δ 3.3 (N+-(CH3)3); δ 3.4 (6O-CH3); δ 3.5 (3O-CH3); 4.8-6.0 (H-1, CH). DTM 61.4%; DDM 35.8%; DD 3.8%; D3OM 21.3%; D6OM 22.1%. 13C NMR (300 MHz, D2O): δ 42.1 (N-(CH3)2); δ 54.5 (N+-(CH3)3); δ 58.9 (C2); δ 61.1 (C6); δ 77.3 (C3); δ 96. 7 (C1). FTIR: 3429 (O-H stretching); 2925 (C-H asymmetric stretching of methyl groups); 1642 (C=O stretching of amide groups); 1478 (C-H asymmetric bending of methyl groups); 1076 (C-N stretching of primary amine groups). 2.4 Synthesis of CM-TMC 6-O-carboxymethylation of TMC was performed pursuant to a modification of a method published by Jansma et al. (2003). TMC (0.5 g) was suspended in 50 mL of NMP and let stirring overnight at room temperature. The next day, the pH was readjusted to a value of 10 by using 15% aqueous NaOH solution and successively 2.2 g of chloroacetic acid (20 mol equivalents (mol eq.) to TMC sugar monomers) were added. The pH was 58 maintained during the reaction at a value of 10 by sufficient addition of 15% aqueous NaOH solution. After 3 hours, the product was precipitated by adding 5-10 volumes ethanol and diethylether (1:1 v/v) and subsequently isolated by centrifugation (1850 x g, 15 minutes). After re-dissolution in 50 mL of MilliQ water, CM-TMC were rendered water-soluble by adjusting the pH to 5, the solution dialysed over the course of three days (twice daily changing deionized water) and sterile filtrated before lyophilization. The degree of carboxymethylation (DCM) of CM-TMC was estimated using the following equation: %DCM = ([(CH2)-CO)] / [H] x 1/2) x 100. Hereby, [(CH2)-CO)] is the integral value of the methylene group of newly introduced carboxymethyl function at 4.1 ppm and again [H] the integral value of the H-1 peaks between 4.7 and 6.0 ppm. Yield 73%. 1H NMR (300 MHz, D2O): δ 2.0 (COCH3); δ 2.8 (N-(CH3)2; δ 3.3 (N+-(CH3)3); δ 3.4 (6O-CH3); δ 3.5 (3O-CH3); δ 4.1 (CH2-CO); δ 4.8-6.0 (H-1, CH). DCM 17.2%; DTM 61.4%; DDM 35.8%; DD 3.8%; D3OM 21.3%; D6OM 22.1%. 13C NMR: (300 MHz, D2O) δ 42.1 (N-(CH3)2); δ 54.5 (N+-(CH3)3); δ 58.9 (C2); δ 61.1 (C6); δ 77.3 (C3); δ 96. 7 (C1); δ 175.2 (C=O of CH2-COOH). FTIR: 1725 (C=O stretching of COOH group), 1606 (C=O asymmetric stretch vibration), 1384 (C=O symmetric stretch vibration). 2.5 Synthesis of ω-amido-[Nα-palmitoyl-oxy-S-[2,3-bis(palmitoyl-oxy)-(2R)-propyl]-[R]– cysteinyl]-α-amino poly(ethylene glycol) (abbreviated Pam3Cys-PEG-NH2, 7) 2.5.1 Nα-Fluorenylmethoxycarbonyl-S-[2,3-dihydroxy-(2R)-propyl]-[R]-cysteine tert-butyl ester (2) To a solution of 1 (2.58 g; 3.34 mmol) in CH2Cl2 (20.4 mL), zinc (1.48 g) and a freshly 59 prepared mixture of MeOH, 32% HCl (d = 1.16 g/mL) and concentrated H2SO4 (10.78 mL; 100:7:1) were added under vigorous stirring. After 15 min (S)-(-)-glycidol (1.16 mL; 32.42 mmol) was added. The mixture was stirred for 5 h at 40 °C. The solution was evaporated to about half of its original volume and diluted with 5% KHSO4 (26 mL). This mixture was kept at -4 °C for 16 h and then extracted with CH2Cl2. The organic phase was dried over anhydrous Na2SO4, evaporated to dryness and the crude residue chromatographed on silica gel with CHCl3, then CHCl3/MeOH (10:1) as eluant to yield 2 (2.74 g; 5.79 mmol) as a colourless oil. Yield 89%. Rf = 0.11, CHCl3; 0.73, CHCl3/MeOH (10:1). 13C NMR (CDCl3) δ 169 (Cys-CO); δ 155.7 (Fmoc-CO); δ 143.8 141.3 127.7 127 125.2 120 (Fmoc); δ 83.2 (tBu-Cq); δ 70.2 (S-glyceryl-CH); δ 67.3 (Fmoc-CH2-O); δ 63.4 (S-glyceryl-CH2-O); δ 54 (Cys-CH); δ 47.1 (Fmoc); δ 35 (Cys-CH2); δ 34.3 (S-glycerylCH2); δ 27.9 (COOtBu-CH3). 2.5.2 Nα-Fluorenylmethoxycarbonyl-S-[2,3-bis(palmitoyl-oxy)-(2R)-propyl]-[R]-cysteine tert-butyl ester (3) 2 (2.73 g; 5.78 mmol), palmitic acid (Pam-OH; 4.75 g; 18.54 mmol) and N,Ndiisopropylcarbodiimide (DIC; 3.46 mL; 22.35 mmol) were dissolved in dry tetrahydrofuran (THF, 56.7 mL). N-Dimethylamino-pyridine (DMAP; 0.29 g; 2.37 mmol) was added, and the mixture stirred for 2 h. After the addition of glacial acetic acid (2.3 mL) the mixture was evaporated to dryness. The residue was recrystallized from CH2Cl2/MeOH (1:3; 68 mL) at -20 °C. 3 (5.10 g; 5.37 mmol) was obtained as a colourless powder. Yield 93%. Rf = 0.72, CHCl3. 13C NMR (CDCl3) δ 173.5 173.4 (PamCO); δ 169 (Cys-CO); δ 155.7 (Fmoc-CO); δ 143.8 141.3 127.7 127 125.2 120 (Fmoc); δ 83.2 (tBu-Cq); δ 70.2 (S-glyceryl-CH); δ 67.3 (Fmoc-CH2-O); δ 63.4 (S-glyceryl-CH2-O); δ 54 (Cys-CH); δ 47.1 (Fmoc); δ 35 (Cys-CH2); δ 34.5 (Pam-CH2); 60 δ 34.3 (S-glyceryl-CH2); δ 32.2 29.9 29.7 29.5 (Pam-CH2); δ 27.9 (COOtBu-CH3); δ 25.8 25.1 22.9 (Pam-CH2); δ 14.3 (Pam-CH3). MS (API) m/z 950 M+. 2.5.3 S-[2,3-bis(palmitoyl-oxy)-(2R)-propyl]-[R]-cysteine tert-butyl ester (4) To a solution of 3 (5.07 g; 5.34 mmol) in dry CH2Cl2 at 0 °C was added 1,8diazabicyclo[5.4.0]undec-7-ene (DBU). After 20 minutes the mixture was dried under vacuum and chromatographed on silica gel, using as eluant CHCl3 then CHCl3/MeOH (95:5) to give 4 (3.45 g; 4.73 mmol). Yield 89%. Rf = 0.13, CHCl3; 0.89, CHCl3/MeOH (95:5). 13C NMR (CDCl3) δ 173.5 173.4 (PamCO); δ 169 (Cys-CO); δ 83.2 (tBu-Cq); δ 70.2 (S-glyceryl-CH); δ 63.4 (S-glyceryl-CH2-O); δ 54 (Cys-CH); δ 35 (Cys-CH2); δ 34.5 (PamCH2); δ 34.3 (S-glyceryl-CH2); δ 32.2 29.9 29.7 29.5 (Pam-CH2); δ 27.9 (COOtBu-CH3); δ 25.8 25.1 22.9 (Pam-CH2); δ 14.3 (Pam-CH3). MS (API) m/z 728 (M-H)+. 2.5.4 Nα-palmitoyl-oxy-S-[2,3-bis(palmitoyl-oxy)-(2R)-propyl]-[R]-cysteine t-butyl ester (5) Pam-OH (1.07 g; 4.16 mmol) was activated in dry CH2Cl2 (62.4 mL) with DIC (0.73 mL; 4.71 mmol) and hydroxybenzotriazole hydrate (HOBt; 0.64 g; 4.71 mmol) in dry DMF at 0 °C. After 30 min 4 (3.43 g; 4.71 mmol) was added. After being stirred for 15 h at room temperature the solution was evaporated to dryness, the crude residue was dissolved in CHCl3 and extracted with NaHCO3 5% and water. The organic phase was then evaporated under vacuum and crystallized from CH2Cl2/MeOH (1:3; 73.8 mL) at -20 °C affording 5 (2.73 g; 2.82 mmol) as a colourless powder. Yield 60%. Rf = 0.66, CHCl3. 13C NMR (CDCl3) δ 173.6, 173.5, 173.4 (PamCO); δ 169 (Cys-CO); δ 83.2 (tBu-Cq); δ 70.2 (Sglyceryl-CH); δ 63.4 (S-glyceryl-CH2-O); δ 54 (Cys-CH); δ 35 (Cys-CH2); δ 34.5 (PamCH2); δ 34.3 (S-glyceryl-CH2); δ 32.2 29.9 29.7 29.5 (Pam-CH2); δ 27.9 (COOtBu-CH3); δ 61 25.8 25.1 22.9 (Pam-CH2); δ 14.3 (Pam-CH3). MS (API) m/z 967 (M-H)+. 2.5.5 Nα-palmitoyl-oxy-S-[2,3-bis(palmitoyl-oxy)-(2R)-propyl]-[R]-cysteine (6) To a solution of 5 (0.57 g; 0.59 mmol) in dry CH2Cl2 (0.35 mL) was added trifluoroacetic acid (TFA; 0.59 mL; 7.64 mmol) and Et3SiH (0.23 mL; 1.47 mmol). After stirring for 6 h at room temperature the solution was evaporated to dryness and the crude residue repeatedly evaporated with diethyl ether to give 6 in quantitative yield. The product was used without further purification. Rf = 0.38, CHCl3/MeOH (95:5). ). 13C NMR (CDCl3) δ 174.6 (Cys-COOH); δ 173.6, 173.5, 173.4 (PamCO); δ 70.2 (S-glyceryl-CH); δ 63.4 (Sglyceryl-CH2-O); δ 54 (Cys-CH); δ 35 (Cys-CH2); δ 34.5 (Pam-CH2); δ 34.3 (S-glycerylCH2); δ 32.2 29.9 29.7 29.5 25.8 25.1 22.9 (Pam-CH2); δ 14.3 (Pam-CH3). MS (API) m/z 910 (M-H)+. 2.5.6 ω-amido-[Nα-palmitoyl-oxy-S-[2,3-bis(palmitoyl-oxy)-(2R)-propyl]-[R]–cysteinyl]-αamino poly(ethylene glycol) (7) 6 was activated in dry CH2Cl2 (4 mL) with DIC (0.06 mL; 0.4 mmol) and HOBt (0.05 g; 0.4 mmol) in dry DMF at 0 °C. After 30 min a solution of α, ω-bis-amino poly(ethylene glycol) (1.2 g; 0.4 mmol) in dry CH2Cl2/DMF (1:1; 4 mL) at 0 °C was added. After being stirred for 15 h at room temperature the reaction solution was evaporated to dryness, the crude residue dissolved in CHCl3 and extracted with NaHCO3 5% and water. The organic layer was dried over anhydrous Na2SO4 and evaporated under vacuum. The crude residue was chromatographed on silica gel (230-400 mesh) with CH2Cl2/MeOH/H2O (91:9:0.1) then CH2Cl2/MeOH/H2O (78:19:1) as eluant to yield 7 (0.41 g; 0.1 mmol) as a colourless powder. Yield 30%. Rf = 0.2; CH2Cl2/MeOH/H2O (91:9:0.1). 1H NMR (300 MHz, D2O): δ 0.9 (CH3-Pam); δ 1.4 (CH2-Pam); δ 1.7 (C13-CH2) δ 62 2.2 (C14-CH2); δ ~3.6 (PEG-CH2); δ 4.5 (S-glyceryl-CH2-O); δ 5.0 (S-glyceryl-CH). 13C NMR (CDCl3) δ 173.6, 173.5, 173.4 (PamCO); δ 170.4 (CysCO); δ 74.0 70.8 70.5 (PEG-CH2); δ 70.3 (S-glyceryl-CH); δ 63.8 (S-glyceryl-CH2-O); δ 52.1 (Cys-CH); δ 39.7 (PEG-CH2); δ 35.1 (Cys-CH2); δ 34.6 (Pam-CH2); δ 34.3 (S-glyceryl-CH2); δ 32.2 29.9 29.7 29.5 25.8 25.1 22.9 (Pam-CH2); δ 14.3 (Pam-CH3). FTIR: 3429 (O-H stretching); 2918 (C-H asymmetric stretching of methyl groups); 1725 (C=O stretching of the COOH group); 1639 (C=O stretching of amide groups); 1470 (C-H asymmetric bending of methyl groups); 1352 (C=O symmetric stretch vibration); 1102 (C-H stretching). MS (MALDI-Tof) m/z 3990 (M+). 2.6 Grafting of Pam3Cys-PEG-NH2 (7) to CM-TMC 7 (10.6 mg; 0.002 mmol, 0.2 mol equiv. to COOH) was completely dissolved in 1 mL of MilliQ water by gently heating at 40 °C for 5 minutes. Separately, CM-TMC (degree of trimethylation (DTM) 61.4%; degree of carboxymethylation (DCM) 17.2%; 20 mg; 0.089 mmol sugar units, 0.015 mmol COOH) was dissolved in MilliQ water (3 mL) at room temperature and the pH adjusted to a value of 7±0.1. Next, EDC (5.7 mg, 0.03 mmol, 2 mol equiv. to COOH) and NHS (3.5 mg; 0.03 mmol, 2 mol equiv. to COOH) were added and the pH re-adjusted to neutrality. The solution containing 7 was then added and reaction was performed over 96 hours, whereby the pH was maintained at 7±0.1. In the following, the solution was dialysed (membrane cut-off 12-14 kDa) over one week (medium twice daily changed), sterile filtered and then freeze dried. The finalized product (8) was then used for further investigations. The degree of grafting (DG) was calculated by using the following equation: %DG = ([CH2-Pam] / [H] x 1/66) x 100, whereby [(CH2-Pam)] is the integral value of the peak at 1.3 ppm, which is assigned to methylene groups (3x11xCH2, 66H) of the palmitoyl moiety. [H] is the integral value of 63 H-1 peaks between 4.7 ppm and 6.0 ppm. A further approach of defining the %DG was performed as follows: %DG = ([PEG-CH2CH2] / [H] x 1/290.9) x 100. Hereby, ([PEG-CH2CH2] is an average integral value of methylene groups of the PEG unit (72.7xCH2CH2, 290.9H) at ~ 3.6 ppm. Both methods gave in accordance a grafting degree of around 4.3%. Practical yield 87%. 1H NMR (300 MHz, D2O): δ 0.9 (CH3-Pam); δ 1.3 (CH2-Pam); δ 2.0 (COCH3); δ 2.8 (N-(CH3)2); δ 3.3 (N+-(CH3)3); δ 3.4 (6O-CH3); δ 3.5 (3OCH3); δ ~3.6 (CH2-CH2-CO); δ 4.1 (CH2-CO); δ 4.8-6.0 (H-1, CH); 13C NMR (300 MHz, D2O): δ 22.3 36.1 (Pam-CH2); δ 42.1 (N-(CH3)2); δ 54.7 (N+-(CH3)3); δ 58.9 (C2); δ 61.1 (C6); ~ 69.8 (PEG-CH2CH2); δ 77.3 (C3); δ 96. 7 (C1); δ 174.9 (C=O of COOH and CO-NH-PEG). FTIR: 1725 (C=O stretching of the COOH group); 1600 (C=O asymmetric stretch vibration); 1655 (C=O stretching of amide group); 1384 (C=O symmetric stretch vibration). 3. Results and discussion The aim of this study was at first to provide a water-soluble chitosan derivative with auspicious properties for transmucosal vaccine delivery as well as the ability to covalently bind targeting ligands. We therefore opted to synthesize TMC, which was in turn modified to 6-O-carboxymethyl-N,N,N-trimethyl chitosan polymer (CM-TMC). To our best knowledge, we report here for the first time a detailed synthesis of polymeric CM-TMC. This new chitosan derivative merges the promising vaccine delivery properties of TMC together with the potential of covalent attachment of targeting ligands thanks to new introduced carboxylic functions. In a second step, we synthesized a TLR-2 targeting agonist (Pam3Cys-PEG-NH2) with the aid of modifications of by already published 64 methods (Metzger et al. 1991; Kleine et al. 1994). Finally, we grafted Pam3Cys-PEG-NH2 to CM-TMC by means of condensing agents (s. figure 1). 3.1 Synthesis of TMC Regarding the characteristics of TMC, the degree of trimethylation (DTM) is assumed to play an important role, whereby solely TMC having a DTM between 40% and 60% is supposed to be beneficial as permeation enhancer of macromolecules (Sahni et al. 2008; Hamman et al. 2003). In this study, we involved a TMC having a DTM of around 60%, which was shown to facilitate transport of a peptide drug across the bronchial epithelium in vivo (Florea et al. 2006). 65 HO COOt-Bu Fmoc a S NH Pam-O b HO CH3 Pam-O 2 1 NH Fmoc COOt-Bu RNH 2 Pam-O d c COOt-Bu 3 R = -Fmoc 4 R = -H Pam-O Pam-O Pam-O f Pam NH COOR H N Pam NH 72 O 5 R = -t-Bu e NH2 O 7 6 R = -H OR1 g O O H 3C CH3 O R3 R2 n 8 O R1 = -H, -CH3, -CH2COOH, -CH2 O NH O NH 72 NH Pam + R2 = -NHCOCH3, -N(CH3)2, -N (CH3)3 O-Pam R3 = -OH, -OCH 3 O-Pam Figure 1: Reaction scheme for the synthesis of CM20-TMC60-g-PEG-Pam3Cys. Reagents and conditions: a) CH2Cl2, Zn/HCl/H2SO4, (S)-(+)-glycidol; b) Anhydrous THF, Pam-OH, DIC, DMAP; c) Anhydrous CH2Cl2, DBU; d) Anhydrous CH2Cl2/DMF, Pam-OH, DIC, HOBt; e) Anhydrous CH2Cl2, TFA, Et3SiH; f) Anhydrous CH2Cl2/DMF, PEG diamine, DIC, HOBt; g) H2O, CM20-TMC60, EDC, NHS. 66 Moreover, the degrees of 3- (D3OM) and 6-hydroxy-methylation (D6OM), as well as dimethylation (DDM) have to be taken into consideration. As reported elsewhere, they influence cytotoxicity and physicochemical properties of TMC (Jintapattanakit et al. 2008; Verheul et al. 2008). A typical 1H NMR spectrum of TMC (61.4% trimethylated, abbreviated TMC60) is shown in figure 2. Major peak assignments are as follows: δ = 3.3 ppm N+-(CH3)3, δ = 2.8 N-(CH3)2, δ = 3.4 6O-CH3, and δ = 3.5 3O-CH3 (Jintapattanakit et al. 2008). In addition, the extent of di- and trimethylation of chitosan polymers was analysed by 13C NMR spectroscopy, whereby the corresponding peaks appear at δ = 42.1 and 54.4 ppm, respectively (data not shown; Sieval et al. 1998). Furthermore, FTIR spectroscopy of TMC60 showed the introduction of methyl groups, which was observed at 2925 cm-1 (C-H asymmetric stretching of methyl groups) and 1478 cm-1 (C-H asymmetric bending of methyl groups). 3.2 Synthesis of CM-TMC Regarding the carboxymethylation of chitosan, in most cases chloroacetic acid is used as introducing reagent. Chen and Park investigated this reaction by using chloroacetic acid in different mixtures of water and isopropanol under strong basic conditions (Chen and Park 2003). Further on, Jansma et al. (1996) carboxymethylated trimethyl oligomers (CM-TMO) using chloroacetic acid in NMP at pH 10, whereby the extent of carboxymethylation was controlled by varying reaction time and equivalents of chloroacetic acid used. We opted for the latter mild method and altered it for the carboxymethylation of polymeric TMC60. 67 3-6 HO HO 6 HO HO 5 2 3 O O 4 OH O HO 1 H2N A HN O 2 1 H3C 7 7 CH3 11 HO HO O 6 5 2 N H3C 8 CH3 8 8 N H3C O 10 O HO HN CH3 O O O O 1 + 3 H3C 8 O O 4 HO HO CH3 CH3 9 3-6 H3C 7 10 11 1 9 7 B HO 11 HO O 6 2 5 + 3 N H3C 8 CH3 8 CH3 8 1 O O O 4 HO HO 8 CH3 O 12 10 O HO HN O H3C 12 O O O O N H3C 9 H3C CH3 1 7 CH3 3-6 10 11 9 7 C Figure 2: 1H NMR spectra of a) chitosan (1% v/v DCl/D2O, 80 °C), b) TMC-60 and c) CM20-TMC60 (both in D2O at 80 °C). Figure 2c shows the 1H NMR spectrum of a CM-TMC with a degree of carboxymethylation (DCM) of 17.2% (abbreviated CM20-TMC60). The successful introduction of carboxymethyl groups was observed at δ = 4.1 ppm (CH2-COO). Moreover, it can be assumed that the carboxymethylation primarily occurred at the 6-O position due to an exclusive peak appearance at δ = 4.1 ppm (Chen and Park 2003). Besides, the new carboxylic functionality can also be noticed is similarly detected in the 13C NMR spectrum (see figure 4a) at δ 175.2 ppm (C=O of CH2-COO). FTIR spectroscopy (figure 3) similarly indicated an effective introduction of carboxylic moieties owing to new bands at 1725 cm-1 (C=O stretching of COOH group), 1606 cm-1 (C=O asymmetric 68 stretch vibration) and 1384 cm-1 (C=O symmetric stretch vibration). The watersolubility of both chitosan derivatives, TMC60 and CM20-TMC60, was higher than 50 mg/mL. A B %T C 4000.0 3600 3200 2800 2400 2000 1800 1600 1400 1200 1000 800 600 450.0 cm-1 Figure 3: FTIR spectra of a) chitosan, b) TMC60 and c) CM20-TMC60. 3.3 Synthesis Pam3Cys-PEG-NH2 (7) The synthesis of the TLR-2 agonist 7 was performed by means of adapting already published methods (Metzger et al. 1991; Kleine et al. 1994). Compound 7 was obtained at high purity, as shown in 1H NMR (figure 5) and MALDI-Tof spectra (figure 6). Moreover, the diastereomeric purity was confirmed by 13C NMR spectroscopy (figure 4b). Finalized compound 7 was perfectly water-soluble after gently heating (40°C for 5 minutes) at concentrations up to 15 mg/mL. 69 3.4 Grafting of Pam3Cys-PEG-NH2 (7) to CM20-TMC60 In order to enable a covalent bond between amine moieties and carboxymethylated chitosans, a number of different condensing reagents have been examined in the past. Prabaharan et al. (Prabaharan et al. 2007) selected 1-ethyl-3-(3- dimethylaminopropyl)carbodiimide hydrochloride (EDC) and in a later publication a combination of EDC and N-hydroxysuccinimide (NHS) as condensing agents (Prabaharan and Gong 2007), whereas Jansma et al. (2003) decided to use EDC together with N-hydroxybenzotriazole (HOBt). O 24 23 H3C 14 O 25 O 22 21 CH3 23 25 24 O 20 14 S 19 O NH 13a 14 12 O O HO 6 1 + 3 N 8 O 8 N 6 2 C 7 9 9 10 1 CH3 H3C H3C H3C CH3 O O 13a+b 9 4 5 O HN CH3 8 CH3 H3C O O O HO 8 25 14 O 5 2 24 11 12 O 4 HO HO 72 O O 13b 16 CH3 17 NH CH3 17 16 O O 18 NH 16 15 7 O H3C 2 27 2 2 1 11 O 8 7 O 14 3,4, 10 CH3 141 3 6 3 1 1 2 5 O 5 S 12 6 8 9 B O H3C 1 9 4 NH 10 NH 2 11 NH2 12 O 11 14 12 72 O HO 12 13 HO 6 HO HO 2 N H3C 8 CH3 8 CH3 8 1 O O O 5 + 3 9 11 O 4 8 CH3 O O O O O HN O H3C 10 H3C 13 O HO N H3C 9 3 CH3 4 5 6 2 CH3 1 7 7 A Figure 4: 13C NMR spectra of a) CM20-TMC60 (D2O) b) Pam3Cys-PEG-NH2 (CDCl3) and c) copolymer CM20-TMC60-g-PEG-Pam3Cys (D2O). 70 In line with our study, we initially investigated the applicability of EDC/HOBt for grafting compound 7 to CM20-TMC60 (data not shown). However, after purification (via dialysis) we were not able to detect any grafting of Pam3Cys-PEG-NH2 to CM20-TMC60 by NMR spectroscopy. Therefore we moved to EDC/NHS and tested their suitability as condensing agents. In more detail, we added two mol equivalents (in correlation to COOH groups) of EDC and NHS to CM20-TMC60 and let the reaction proceed in the presence of 0.2 mol equivalents (in correlation to COOH groups) of Pam3Cys-PEG-NH2, to achieve a theoretical grafting ratio of 5%. Following this method we were able to determine a grafting success (%DG) of about 4.3%, as evidenced by 1H NMR spectroscopy (Fig. 5c). 8 HO 13 12 CH3 O 11 HO O 6 5 2 N 8 10 N H3C O H3C 8 O HO HN CH3 8 CH3 H3C O O O O 1 + 3 O O 4 HO HO O 9 CH3 12 CH3 H3C 3-6 7 1 O 7 CH3 141 3 11 O 6 3 1 2 A 9 2 5 O H3C 11 10 7 O 14 S B 8 O H3C 2 9 4 1 NH 11 10 NH 2 14 O O O 24 23 H3C 14 O 25 NH2 12 11 12 72 1 8 22 O 21 23 O 20 CH3 25 24 14 S 19 O 13a NH O HO 6 N H3C 8 1 + CH3 CH3 8 O O 8 O H3C O O HN H3C 10 N H3C 9 25 14 O O O HO 24 11 12 O 5 2 3 O 13b 4 HO HO 72 O CH3 17 NH CH3 17 16 O O 18 NH 16 15 14 12 O CH3 9 3-6 CH3 1 12 11 10 C 2 9 7 1 7 Figure 5: 1H NMR spectra of a) CM20-TMC60 b) Pam3Cys-PEG-NH2 and c) CM20-TMC60-gPEG-Pam3Cys (all in D2O at 80 °C). 71 Interestingly, in this 1H NMR spectrum of CM20-TMC60-g-PEG-Pam3Cys, a decrease of the peak integral at δ = 4.1 ppm (CH2-COO) was noticed. This change is likely the result of the formation of an amide bond between CM20-TMC60 and Pam3Cys-PEG-NH2. Adjacent Successive quantification of the DCM prior to and following the reaction depicts a decrease of 4.9%, which is in good agreement with the supposed DG of 4.3%. In addition, the 13C NMR spectrum of CM20-TMC60-g-PEG-Pam3Cys (Fig. 4c) underlines the functionalization of the polymeric backbone of CM20-TMC60 with the TLR-2 agonist. Although not all atom signals of Pam3Cys-PEG-NH2 (Fig. 4b) were also recovered in the spectrum of the copolymer, peaks at δ =22.3 and 36.1 ppm (Pam-CH2) as well as at ~ 69.8 ppm (PEG-CH2CH2) are pointing at an effective grafting reaction (Mao et al. 2005). A B A A Figure 6: MALDI-Tof spectra of a) α,ω-bis-amino poly(ethylene glycol) (MW ~ 3000 Da) and b) Pam3Cys-PEG-NH2 (7, MW 3990 Da). Besides, the peak at around 174.9 ppm was assigned to the new amide function together with C=O peak for unreacted carboxylic moieties. This is consistent with 13C NMR data reported by Jeong et al. (2008). However, Jansma et al. showed contrarily that an amide formation between oligomeric CM-TMO and tryptophan was observed at 167 ppm. 72 Considering this discrepancy together with the two facts that Pam3Cys-PEG-NH2 has already three carbonylic functions by itself (Fig. 4b) and that it was solely applied at a relatively low molar ratio to CM20-TMC60, a clear interpretation remains difficult. Furthermore, we analysed the copolymer with FTIR spectroscopy (Fig. 7). The introduction of PEG polymer was confirmed on the basis of associated bands at 847 cm-1, 950 cm-1 and 2917 cm-1 (Jeong et al. 2008). In addition, the absorption band at 1606 cm-1 (C=O asymmetric stretch of carboxylate anion) shifted to 1641 cm-1 (C=O stretch of amide), which reflects the formation of an amide bond (Prabaharan et al. 2007; Prabaharan and Gong 2008). A A B %T C A 4000.0 3600 3200 2800 2400 2000 1800 1600 1400 1200 1000 800 600 450.0 cm-1 Figure 7: FTIR spectra of a) CM20-TMC60, b) Pam3Cys-PEG-NH2 and c) CM20-TMC60-gPEG-Pam3Cys. 73 4. Conclusions Assembling all results presented, it is concluded that the synthesis of the TLR-2 agonist was accomplished at high purity. Secondly, Pam3Cys-PEG-NH2 in turn was successfully grafted to CM20-TMC60, although 13C NMR spectroscopy did not deliver clear results regarding the formation of an amide bond. However, 1H NMR and FTIR spectroscopy are of evidence of successful grafting taking place. In conclusion, this new copolymer merits further investigations as a delivery system of vaccines, such as protein or recombinant vaccines, due to its unique combination of immunomodulatory capacity and prominent mucosal vaccine delivery characteristics. Acknowledgments Ph.D. Student Exchange Project, Regione Abruzzo-Italy. References Baudner, C.B., Morandi, M., Giuliani, M. M., Verhoef, J C., Junginger, H. E., Costantino, P., Rappuoli R., Giudice, G. D., 2004. Modulation of immune response to group C meningococcal conjugte vaccine given intranasally to mice together with the LTK63 mucosal adjuvant and the trimethyl chitosan delivery sytem. J. Infect. Dis. 189, 828-832. Baudner, C.B., Verhoef, J.C., Giuliani, M.M., Peppoloni, S., Rappuoli R., Giudice, G.D., Junginger, H. E., 2005. Protectivce immune response to group C meningococcal conjugate vaccine after intranasal immunization of mice together with the LTK63 mutant plus chitosan or trimethyl chitosan chloride as novel delivery platform. J. Drug. Target. 13, 489-498. Bivas-Benita, M., van Meijgaarden, K.E., Franken, K.L.M.C., Junginger, H.E., Borchard, 74 G., Ottenhoff, T.H.M., Geluk, A., 2004. Pulmonary Delivery of chitosan-DNA nanoparticles enhances the immunigenicity of a DNA vaccine encoding HLAA*0201-restricted T-cell epitopes of Mycobacterium tuberculosis. Vaccine 22, 1609-1615. Chen, X., Park, H., 2003. Chemical characteristics of O-carboxymethyl chitosans related to the preparation conditions. Carbohydr. Polym. 53, 355-359. Chopra, S., Mahdi, S., Kaur, J., Iqbal, Z., Talegaonkar, S., Ahmad, F.J., 2006. Advances and potential applications of chitosan derivatives as mucoadhesive biomaterials in modern drug delivery, J. Pharm. Pharmacol. 58, 1021-1032. Florea, B.I., Thanou, M., Junginger, H.E., Borchard, G., 2006. Enhancement of bronchial octreotide by chitosan and N-trimethyl chitosan shows linear in vitro/in vivo correlation, J. Control. Rel. 110, 353-361. Hamman, J.H., Schultz, C.M., Kotzé, A.F., 2003. N-trimethyl chitosan chloride: optimum degree of quaternization for drug absorption enhancement across epithelial cells. Drug. Dev. Ind. Pharm. 29, 161-172 Iwasaki, A., Medzhitov, R., 2005. Toll-like receptor control of the adaptive immune responses. Nat. Immunol. 5 (10), 987-995. Jansma, C.A., Thanou, M., Junginger, H.E., Borchard, G., 2003. Preparation and characterization of 6-O-carboxymethyl-N-trimethyl chitosan derivative as a potential carrier for targeted polymeric gene and drug delivery. STP Pharma 13 (1), 63-67. Jeong, Y.I., Kim, D.G., Jang, M.K., Nah, J.W., 2008. Preparation and spectroscopic characterization of methoxy poly(ethylene glycol)-grafted water-soluble chitosan. Carbohydr. Res. 343, 282-289. 75 Jintapattanakit, A., Mao, S., Kissel, T., Junyaprasert, V.B., 2008. Physicochemical properties and biocompatibility of N-trimethyl chitosan: Effect of quaternization and dimethylation. Eur. J. Pharm. Biopharm. 70, 563-571. Kleine, B., Rapp, W., Wiesmüller, K.H., Edinger, M., Beck, W., Metzger, J., Ataulakhanov, R., Jung,. G., Bessler, W.G., 1994. Lipopeptide-polyoxyethylene conjugates as mitogens and adjuvants. Immunobiology 190 (1-2), 53-66. Lombardi, V., Van Overtvelt, L., Horiot, S., Moussu, H., Chabre, H., Louise, A., Balazuc, A.M., Mascarell, L., Moingeon, P., 2008. Toll-like receptor 2 agonist Pam3CSK4 enhances the induction of antigen-specific tolerance via the sublingual route. Clin. Exp. Allergy 38, 1819-1829. Mao, S., Shuai, X., Unger, F., Wittmar, M., Xie, X., Kissel, T., 2005. Synthesis, characterization and cytotoxicity of poly(ethylene glycol)-graft-trimethyl chitosan block copolymers. Biomaterials 26 (32), 6343-6356. Metzger, J., Wiesmüller, K.H., Schaude, R., Bessler, W.G., Jung, G., 1991. Synthesis of novel immunologically active tripalmitoyl-S-glycerylcysteinyl lipopeptides as useful intermediates for immunogen preparations. Int. J. Pept. Protein Res. 37, 46-57. Murata, J., Ohya, Y., Ouchi, T., 1996. Possibility of application of quaternary chitosan having pendant galactose residues as gene delivery tools. Carbohydr. Polym. 29, 69-74. Murata, J., Ohya, Y., Ouchi, T., 1997. Design of quaternary chitosan conjugate having antennary galactose residues as gene delivery tools. Carbohydr. Polym. 32, 105109. O´Hagan, D.T., Singh, M., Ulmer, J.B., 2004. Microparticle-based technology for vaccines. Methods 40, 10-19. Pashine A., Valiante N.M., Ulmer J.B., 2005. Targeting the innate immune response with 76 improved vaccine adjuvants. Nat. Med. 11, 63-68. Polnok, A., Borchard, G., Verhoef, J.C., Sarisuta, N., Junginger, H.E., 2004. Influence of methylation process on the degree of quaternization of N-trimethyl chitosan chloride. Eur. J. Pharm. Biopharm. 57, 77-83. Prabaharan, M., Reis, R.L., Mano, J.F., 2007. Carboxymethyl chitosan-graft-phosphatidylethanolamine: Amphiphilic matrices for controlled drug delivery. React. Funct. Polym. 67 (1), 43-52. Prabaharan, M., Gong, S., 2008. Novel thiolated carboxymethyl chitosan-g-β-cyclodextrin as mucoadhesive hydrophobic drug delivery carriers. Carbohydr. Polym. 73, 117125. Qin, C., Li. H, Xiao, Q., Liu, Zhu, J. Du, Y., 2006. Water-solubility of chitosan and itsst antimicrobial activity. Carbohydr. Polym. 63, 367-374. Sahni, J.K., Copra, S., Ahmad, F.J., Khar, R.K., 2008. Potential prospects of chitosan derivative trimethyl chitosan chloride (TMC) as a polymeric absorption enhancer: synthesis, characterization and applications. J. Pharm. Pharmacol. 60, 1111-1119. Schmitt, A., Li, L., Giannopoulos, K., Greiner J., Reinhardt, P., Wiesneth, M., Schmitt, M., 2008. Quantitative expression of Toll-like receptor-2, -4, and -9 in dendritic cells generated from blasts of patients with acute myeloid leukemia. Transfusion 48, 861-70. Schlosser, E., Mueller, M., Fischer, S., Basta, S., Busch, D.H., Gander, B., Groettrup, M., 2008. TLR ligands and antigen need to be coencapsulated into the same biodegradable microsphere for the generation of potent cytotoxic T lymphocyte responses. Vaccine 26, 1626-1637. Sieval, A.B., Thanou, M., Kotzé, A.F., Verhoef, J.C., Brussee, J., Junginger, H.E., 1998. 77 Preparation and NMR characterization of highly substituted N-trimethyl chitosan. chloride. Carbohydr. Polym. 36, 157-165. van der Lubben, I.M., Verhoef, J.C., Borchard, G., Junginger, H.E., 2001a. Chitosan and its derivatives in mucosal drug and vaccine delivery. Eur. J. Pharm. Sci. 14, 201-207. van der Lubben, I.M., Verhoef, J.C., Borchard, G., Junginger, H.E., 2001b. Chitosan for mucosal vaccination. Adv. Drug Deliv. Rev. 52, 139-144. Verheul, R.J., Amidi, M., van der Wal, S., van Riet, E., Jiskoot, W., Hennink, W.E., 2008. Synthesis, characterization and in vitro biological properties of O-methyl free N,N,N-trimethylated chitosan. Biomaterials 29, 3642-3649. Wedlock, D.N., Denis, M., Painter, G.F., Ainge, G.D., Vordermeier, H.M., Hewinson, R.G., Buddle, B.M., 2008. Enhanced protection against bovine tuberculosis after coadministration of Mycobacterium bovis BCG with a mycobacterial protein vaccine-adjuvant combination but not after coadministration of adjuvant alone. Clin. Vaccine Immunol. 15, 765-772. Wetzler, L.M., 2003. The role of Toll-like receptor 2 in microbial disease and immunity. Vaccine 21, 55-60. 78 Chapter 4 Stimulation of macrophages using Toll-like receptor-2 (TLR-2) agonist decorated nanocarriers S. Heuking1,2, S Adam-Malpel1,2, E. Sublet1,2, A. Iannitelli2,3, A. di Stefano3 and G. Borchard1,2,* Adapted from: Journal of Drug Targeting (2009) 17, 662-670. 1School of Pharmaceutical Sciences, University of Geneva, Switzerland 2Centre Pharmapeptides, Archamps, France 3Department of Drug Science, University ”G. D'Annunzio”, Chieti, Italy 79 Abstract: Chitosan from a vegetal source (Agaricus bisporus) and of GMP quality was used to synthesize the derivative 6-0-carboxymethyl-N,N,N-trimethylchitosan (CM-TMC). Tolllike receptor-2 (TLR-2) agonist, Pam3Cys, was synthesized and coupled to CM-TMC through a polyethylene glycol (PEG) spacer. Successively, Pam3Cys decorated nanocarriers were prepared by complexation with plasmid DNA (pDNA) expressing green fluorescence protein (GFP), and characterized with respect to their physicochemical properties and protection of the included plasmid against DNase I enzymatic degradation. GFP transfection studies demonstrated that TLR-2 agonist decorated chitosan derivatives were able to transfect A549 cells. Moreover, in vitro studies using phorbol 12-myristyl 13-acetate (PMA) stimulated macrophage-like THP-1 (mTHP-1) cells were focused on cytotoxicity of both polymers and particles, and their potential to stimulate IL-8 release via the TLR-2 pathway. Our results showed that the TLR-2 functionalized pDNA nanocarriers have the ability to complex and to protect pDNA against enzymatic degradation. pDNA nanocarriers were of around 400 nm in size, and displayed a positive zeta potential of 27.9 ± 1.6 mV. Chitosan, CM-TMC and Pam3Cys-functionalized CM-TMC polymers displayed cytotoxicity on mTHP1 cells in a concentration dependent manner, which decreased by 50-fold on complexation with pDNA. In addition, decorated pDNA nanocarriers induced IL-8 secretions by mTHP-1 macrophages, which were increased by 10-fold compared to non-decorated carriers. 1. Introduction Chitosan is typically produced in industry via alkaline N-deacetylation of chitin obtained from wastes of crab shells. With regard to mucosal vaccination, chitosan has been shown to be suitable as a carrier system due to its promising characteristics, such as adjuvant 80 activity (Lee et al., 2008), biodegradability, absorption enhancement of hydrophilic drugs and mucoadhesivity (van der Lubben et al., 2001). Due to safety considerations with respect to impurities of proteinaceous nature potentially present in chitosan of animal origin, efforts have been undertaken to identify alternative sources. Hereby, fungi (Agaricus bisporus) appeared to be of interest due to easy handling, harvesting and controlled production, yielding a chitosan of high quality and purity (Di Mario et al., 2008). As fungal chitosan shows no immunogenic contamination by animal proteins, it may be regarded as a suitable material for the design of vaccination carrier systems. Inhalation is considered an interesting route of vaccine application (Bivas-Benita et al., 2005), as was shown, e.g., in several clinical measles vaccination trials (Dilraj et al., 2000; Bennett et al., 2002). In addition, in previous animal studies it was shown that a DNA vaccine, expressing several epitopes of M. tuberculosis, condensed by chitosan (Bivas-Benita et al., 2004) or PLGA-PEI nanocarriers (Bivas-Benita et al., 2009) and applied by the pulmonary route, was able to elicit an immune response superior to intramuscular injection. In order to elicit a protective and long lasting immune response, a safe and potent non-specific stimulator of the immune system (adjuvant) should be considered (O`Hagan et al., 2006), especially for mucosal vaccination in the lung. To address the necessity of including an adjuvant in the same formulation as the pDNA vaccine, we recently described a method for the synthesis of a novel copolymer, CMTMC-g-PEG-Pam3Cys, based on chitosan from an animal source (Heuking et al., 2009). This copolymer is composed of the water-soluble chitosan derivative 6-0carboxymethyl-N,N,N-trimethylchitosan (CM-TMC), to which the water-soluble (PEGylated) Toll-like receptor-2 (TLR-2) agonist ω-amido-[Nα-palmitoyl-oxy-S-[2,3bis(palmitoyl-oxy)-(2R)-propyl]-[R]–cysteinyl]-α-amino poly (ethylene glycol) (abbreviated Pam3Cys-PEG-NH2) was grafted. 81 We selected this particular PEGylated TLR-2 agonist due to the following reasons: i) Kleine et al. (1994) demonstrated that conjugates of the lipophilic Pam3Cys moiety coupled to poly (ethylene glycol) (PEG) retain their immunological properties; ii) Pam3Cys-functionalized epitope peptides elicited strong local and systemic T-cell responses after intranasal (Zeng et al., 2000) or after intravaginal (Zhang et al., 2009) application; more interestingly, Zhang et al. (2009) were able to demonstrate that the vaginal application of peptide epitope vaccines conjugated to Pam3Cys moieties elicits protective immunity against Herpes simplex virus (HSV) in mice; iii) TLR-2 is abundantly expressed in antigen-presenting cells (APC), such as dendritic cells and macrophages (Muzio et al., 2000). In the framework of the pulmonary mucosal immune system, macrophages in orchestration with dendritic and epithelial cells (Blank et al., 2007), represent a first line of defence against invading pathogens due to their ability to phagocytose, process and present antigens. Recognition of non-self is partially mediated by pathogen recognition receptors (PRR), among which figures the family of Toll-like receptors (TLR) (Iwasaki and Medzhitov 2004). One member of this family, TLR-2, is expressed in the lung in macrophages, dendritic and epithelial cells (Nishimura and Naito, 2005; Muzio et al., 2000). Differentiated THP-1 cells (mTHP-1 cells) showed much promise as an in vitro model to elucidate the activation of the TLR-2 pathway in macrophages. This human leukemia cell line is well-established and broadly used for the investigation of the function of human macrophages (Schnoor et al., 2009). In view of the TLR-2 pathway, Sadik et al. (2008) demonstrated that mTHP-1 cells are strongly activated by the TLR-2 agonist Pam3Cys-Ser-(Lys)4. In more detail, they were able to assess the extent of cellular activation by measuring the release of the chemokine IL-8, which is an important regulator for successive leukocyte recruitment and trafficking to the mucosal infection site. 82 In our study, we evaluated the potential of the new TLR-2 agonist functionalized chitosan derivative for its application to mucosal vaccination. We prepared nanocarriers by complex coacervation of CM-TMC-g-PEG-Pam3Cys with a model pDNA expressing the reporter gene, green fluorescent protein (GFP). After physical characterization, and assessment of cytotoxicty, we examined the ability of these nanocarriers to induce IL-8 secretion from differentiated mTHP-1 macrophages in vitro. 2. Materials and methods 2.1 Materials N,N,N-trimethylated chitosan (trimethylation of 33.3%, abbreviated TMC35), prepared from vegetal chitosan (degree of deacetylation of 87.7% and molecular weight of 108 kDa), was a kind gift by Kitozyme S.A. (Belgium). Dialysis membrane Spectra/Por 4 (cutoff 12-14,000Da) was obtained from Spectrum (USA). N,N’- Bis(fluorenylmethoxycarbonyl)-[R]-cystine-bis-tert-butyl ester was purchased from Bachem (Switzerland). α,ω-bis-amino poly(ethylene glycol), PEG diamine of a molecular weight (MW) of approximately 3,000 Da was purchased from IRIS Biotech GmbH (Germany). Pam3Cys-Ser-(Lys)4 (Pam3CSK4) was obtained from Invivogen (France) and aliquoted in endotoxin-free water. RPMI 1640 cell culture medium, fetal calf serum (FCS), mercaptoethanol and phorbol 12-myristate 13-acetate (PMA) were obtained from Pan Biotech GmbH (Germany). Human IL-8 ELISA kit was from Assay Designs (France). Agarose powder was obtained from Bio-Rad (France). pIRES-hrGFP II, a 5.5 kbp plasmid, was received from Stratagene (France) and amplified by using an Endofree Plasmid Maxi Kit (Qiagen, France). DNase I (amplification grade) was from Invitrogen (France). All other reagents and solvents were of analytical grade and supplied by Sigma-Aldrich (Switzerland). 83 2.2 Methods 2.2.1 Preparation of CM25-TMC35-g-PEG-Pam3Cys 6-0-carboxymethylation of TMC35 was performed according to a recently published method (Heuking et al., 2009). Briefly, TMC35 was suspended in 1-methyl-2-pyrrolidone (NMP) and the pH was adjusted to a value of 10.0 ± 0.1 by using 15% aqueous NaOH solution. Next, chloroacetic acid (20 mol equivalents to TMC35 sugar monomers) was added, and the pH was kept constant at a value of 10.0 ± 0.1. After 3h of reaction at room temperature, the resulting 6-O-carboxymethyl-N,N,N-trimethylchitosan polymer (CM25TMC35) was precipitated with ethanol and diethylether (1:1 v/v) and centrifuged at 1850 x g for 15 minutes. CM25-TMC35 was then re-dissolved in MilliQ water and rendered water-soluble by adjusting the pH to a value of 5.0 ± 0.1. Finally, the solution was dialysed, sterile filtrated and lyophilized. CM25-TMC35 was successively functionalized with the TLR-2 agonist NH2-PEG-Pam3Cys (Heuking et al., 2009). Shortly, NH2-PEG-Pam3Cys was completely dissolved in MilliQ water by gently heating at 40°C for 5 minutes. Separately, CM25-TMC35 was dissolved in MilliQ water at room temperature and the pH adjusted to a value of 7.0 ± 0.1. Next, N-(3Dimethylaminopropyl)-N-ethylcarbodiimide hydrochloride (EDC) and N-hydroxysuccinimide (NHS) were added and the pH re-adjusted to neutrality. The solution containing NH2-PEG-Pam3Cys was then slowly added and the reaction was let stirring for 96 hours. Next, the solution was dialysed, sterile filtered and then freeze-dried. 2.2.2 Characterization of CM25-TMC35-g-PEG-Pam3Cys The degree of 6-0-carboxymethylation (%DCM) and the degree of grafting (%DG) were determined as described earlier (Heuking et al., 2009) by 1H NMR spectroscopy on a Varian VXR 300 MHz spectrometer (Varian, Switzerland). Chitosan derivatives were 84 dissolved in D2O and all other compounds in CDCl3. FTIR spectra were recorded on a Perkin-Elmer 100 FT-IR spectrometer (Perkin-Elmer, Switzerland) in the range of 4000– 400 cm-1 using KBr pellets (1% w/w of product in KBr). SEC-MALLS measurements were performed using a TOSOH TSK Gel G3000PWXL-CP size exclusion column (TOSOH Bioscience, Germany) with 0.2 M sodium acetate/0.3 M acetic acid (pH 4.4) as eluent (0.3 mL/min). Waters Alliance HPLC system coupled to a differential refractive index (RI) detector (Schambeck, Germany) and a light scattering detector (MiniDawn, Wyatt, USA) was used for sample handling. Pullan standards ranging from 47,000 g/mol to 710,000 g/mol (PSS, Germany) were used for calibration. In addition, the solubility of both chitosan derivatives (CM25-TMC35 and CM25-TMC35-g-PEG-Pam3Cys) was determined in physiological phosphate buffered saline (PBS, pH 7.4) at a concentration of 5.0 mg/mL. The transmittance (%T) of polymers was measured at λ = 600 nm by using a Cintra 404 UV/VIS spectrometer (Switzerland). Polymers were considered soluble for %T > 90% and very soluble for %T > 95 in comparison to the %T of PBS alone (marked with + and ++, respectively). 2.2.3 Particle preparation Polyplexes were formed according to the procedure described by Bivas-Benita et al. (2004) with some modifications. More precisely, CM25-TMC35-g-PEG-Pam3Cys (at 3.10 mg/mL, average molecular weight per sugar unit of 290.8 Da, 3.6 μmol/mL -N+(CH3)3, N) or CM25-TMC35 (at 2.21 mg/mL, average molecular weight per sugar unit of 207.1 Da, 3.6 μmol/mL -N+(CH3)3, N) were dissolved in MilliQ water. Separately, the plasmid pIRES-hrGFP II (abbreviated pDNA; 1 μg of pDNA being equal to 3.1 nmol of phosphate groups, P) was dissolved in 5 mM aqueous Na2SO4 at different concentrations in order to yield N/P ratios of 3:1, 10:1 and 30:1. Both solutions were heated for 5 minutes at 55°C. 85 Next, the polymer solution was slowly added (approximately 1 drop per second) to the pDNA solution and subsequently vortexed at high speed for 30 seconds. Attention was paid to keep the final volume at 400 μL in order to obtain a narrow particle size distribution. Particles were kept at room temperature for at least one hour prior to further use. 2.2.4 Characterization of particles 2.2.4.1 Electrophoretic mobility analysis and DNase I protection assay The ability of CM25-TMC35-g-PEG-Pam3Cys and CM25-TMC35 to bind and immobilize pDNA was examined by agarose gel electrophoresis. Hereby, CM25-TMC35-g-PEGPam3Cys pDNA, CM25-TMC35 pDNA carriers (at N/P ratios of 3:1 to 30:1) were mixed with bromophenol blue as loading dye. pDNA in the absence of polymers served as control as well as a 1 kbp pDNA ladder (BioLabs, England). 20 μL of each sample was applied in a 1.5 % agarose gel stained with 0.6 μg/mL of ethidium bromide. Electrophoresis was then performed at 100 V for 20-30 minutes using TBE buffer. pDNA migration was detected by means of an UV transilluminator (Bio-Rad, France). In addition, the capability of polyplexes to protect incorporated pDNA from enzymatic degradation via DNase I was assessed. pDNA in the absence of polymers, CM25-TMC35g-PEG-Pam3Cys pDNA and CM25-TMC35 pDNA carriers (both 20 μL, equivalent to 3 μg pDNA, N/P ratio of 3:1) were incubated with 4 μL of DNase I solution (1U/μL in DNase I buffer consisting of 200 mM TRIS-HCl (pH 8.4), 20 mM MgCl2 and 500 mM KCl) for 15 minutes at room temperature. The experiment was terminated by adding 4 μL of 25 mM EDTA solution to the reaction mixture. The integrity of pDNA was then determined by the electrophoretic mobility assay as described above. 86 2.2.4.2 Size and zeta potential of nanocarriers Hydrodynamic diameters were measured by Photon Correlation Spectroscopy (ZetaSizer 3000 HS, Malvern, Switzerland). For measurements, either 400 μL of polyplexes were diluted with MilliQ water to 1.4 mL, or diluted at a ratio of 1:15 in plain RPMI 1640 medium. Size distribution data were obtained by the number-averaged value of three independent groups of ten measurements. In addition, zeta potential was measured at least in triplicate via micro-electrophoresis by using an aqueous dip cell (ZetaSizer 3000 HS, Malvern, Switzerland). 2.2.4.3 Loading efficiency For the determination of encapsulated pGFP, 400 μL of nanoparticle suspension was centrifuged at 16,000 x g for 30 min (Centrifuge 5417C/R, Eppendorf, Germany). Unloaded pGFP in the supernatant was quantified with the PicoGreen assay (Invitrogen, Switzerland) according to the manufacturer's procedures. The fluorescence was measured with the FluoroMax spectrometer (Spex, Switzerland) at excitation and emission wavelengths of 480 and 522 nm, respectively. 2.2.5 Cell lines and culture All cell lines mentioned here are of human origin: A549, a cell line derived from a lung carcinoma; Caco-2, a colorectal cancer cell line; Calu-3, a submucosal cell line derived from a lung adenocarcinoma; HEK-293, an embryonic kidney cell line; SV-HUC-1, a normal urothelial cell line; T24, a bladder cancer cell line and THP-1, a monocyte cell line were purchased from ATCC (American Type Culture Collection, USA). 16HBE14o(HBE) cell line, passage number (PN) 80 was generously gifted by Dr. Carsten Ehrhardt, Trinity College, University of Dublin, Ireland. 87 All cell lines were grown in specific medium supplemented with 10% (v/v) fetal bovine serum and penicillin (100 U/mL) and streptomycin (100 µg/ml). Cells were cultured in an incubator at 37ºC, 95% relative humidity, 5% CO2 and passaged at approximately 80% confluency. All cell culture reagents were provided by Invitrogen and SigmaAldrich (France). THP-1 cells, a monocytic cell line, were cultured in RPMI 1640 medium, supplemented with 10% heat-inactivated fetal calf serum (FCS) and 0.05 mM mercaptoethanol. Cells were kept at a density below 106 cells/mL (PN<10) and were cultured as stated above. THP-1 cells were seeded at a density of 2 x 105 cells per well in a 96-well plate unless stated otherwise. For differentiation, PMA was added before seeding at a concentration of 50 ng/mL and cells were incubated for 48h. After differentiation to mTHP-1 cells and twice washing with phosphate buffered saline (PBS), cells were cultured for a recovery period of 3h in the above mentioned medium and used for further experiments (Sadik et al., 2008). 2.2.6 Isolation of TLR-2 mRNA, Reverse Transcriptase-Polymerase Chain Reaction (RTPCR) and Real Time Quantitative Polymerase Chain Reaction (qPCR) All cell lines mentioned in 2.2.5 were detached, separately collected and centrifuged for 5 min at 1000 x g. The supernatant was removed and cells were snap frozen at –80°C. Total RNA was isolated using the RNeasy Mini kit (Qiagen, France) according to manufacturer’s instructions. Isolated RNA was quantified using a ND-1000 spectrophotometer (Nanodrop, France). RNA (1μg) was reverse transcribed using the iScript cDNA Synthesis Kit (Bio-Rad, France) using conditions provided by the manufacturer. 2 μL of RNase free water was used to prepare the negative control. The reverse transcriptase was performed in a MyiQ apparatus (Bio-Rad, France) according 88 to the following protocol: 25°C for 5 minutes, 42°C for 30 minutes and 85°C for 5 minutes. In addition, qPCR analysis was performed in an MyIQ™ single-color Real-time PCR detection system (Bio-Rad, France) thermal cycler to quantify TLR-2 and β-actin mRNA levels. To validate each primer pair, a standard curve was plotted using known concentrations of DNA expressing the target sequence. Oligonucleotides were used as follows: hβ-actin forward TCCCTGGAGAAGAGCTACGA, hβ-actin reverse AGGAAGGAAGGCTGGAAGAG, hTLR-2 forward GGCCAGCAAATT ACCTGTGTG and hTLR-2 reverse AGGCGGACATCCTGAACCT. qPCR was performed in a total volume of 25 μl using the iQ SYBR Green Supermix (Bio-Rad, France) and 300nM of each primer. Cycle parameters were 95°C for 3 minutes, 40 times: 95°C for 10 seconds, 55°C to 60°C (depending on the primer pair) for 30 seconds. All samples from the dilution series were run in duplicates although a no-template control was prepared using Minversol water (Aguettant, France). Data were analyzed using the Optical system software. 2.2.7 In vitro toxicity Cytotoxicity in differentiated THP-1 cells (mTHP-1 cells) was evaluated using a colorimetric assay based on a cell proliferation reagent WST-1 (Roche, Switzerland). The rate of WST-1 cleavage by mitochondrial dehydrogenases correlates with the number of viable cells in the culture. This allows a non-radioactive, spectrophotometric quantification of cell viability. Following concentrations (100 µL per well) were applied after 1:15 dilution with plain RPMI 1640 medium: polymers at 10 and 100 µg/mL; NH2PEG-Pam3Cys at 0.12 mg/mL; CM25-TMC35 at 0.14 mg/mL (pDNA nanocarrier, N/P 3:1), CM25-TMC35-g-PEG-Pam3Cys at 0.2 mg/mL (pDNA nanocarrier, N/P 3:1) and pDNA at 40 μg/mL. 100 µL of each sample was incubated in a 96-well plate (at least in triplicates) for 6h at 37ºC. The optical density was then read using a universal microplate 89 spectrophotometer reader, Power Wave XS (Biotek, France) at 690 and 450 nm. The results were calculated by subtracting the absorbance at 690 nm from the one at 450 nm, thus data were expressed in δ OD values and corrected by the blank value. 2.2.8 GFP Transfection A549 and mTHP-1 cells were seeded at 1 x 105 cells per well (24-well plate) and cultured for 48h. After mTHP-1 cells were handled as above stated, the following DNA formulations (2 µg /well) in the appropriate plain medium (for NP) or full medium (for TransIT-LT1 formulation) were incubated with A549 and mTHP-1 cells: 1) CM25-TMC35 pDNA NP, 2) CM25-TMC35-g-PEG-Pam3Cys pDNA NP and 3) TransIT-LT1 pDNA preparation (used pursuant to the manufacturer’s recommendations). After five hours of exposure, formulations were removed (with the exception of TransITLT1 pDNA preparation) and full medium was added. Medium was then changed every second day. Starting with day two until day six, cells were analysed by fluorescence microscopy (Zeiss Axiovert 40 CFL, Germany) and pictures (Canon Powershot A640, France) were taken at 5x magnification. Number of GFP-positive cells (transfection efficiency) was assessed by using ImageJ 1.43 Software. 2.2.9 Interleukin-8 (IL-8) release by mTHP-1 cells Human IL-8 TiterZyme ELISA kit was obtained from Assay Designs (USA). The following concentrations (250 µL per well) were studied after 1:15 dilution with plain RPMI 1640 medium: Pam3Cys-Ser-(Lys)4 at 1.0 µg/mL, NH2-PEG-Pam3Cys at 2.6 µg/mL (equimolar to 1.0 µg/mL of Pam3Cys-Ser-(Lys)4), CM25-TMC35-g-PEG-Pam3Cys at 0.2 mg/mL (the amount of NH2-PEG-Pam3Cys grafted is equimolar to 1.0 µg/mL of Pam3Cys-Ser-(Lys)4), CM25-TMC35 at 0.14 mg/mL (equimolar to CM25-TMC35-g-PEG-Pam3Cys), both chitosan 90 derivatives were formulated with pDNA, either with CM25-TMC35 at 0.14 mg/mL or CM25-TMC35-g-PEG-Pam3Cys at 0.2 mg/mL (both at N/P 3:1) and as control pDNA alone (same amount as encapsulated in nanocarriers). A 96-well plate was incubated with above mentioned samples (250 µL) in duplicates for 6h at 37ºC. Next, cell supernatants of mTHP-1 cells were taken and used for quantification of human IL-8. The following analysis of samples was performed in duplicates according to the manufacturer´s instructions. Standard curve and sample concentrations were calculated with of the help of Graph Pad Prism 5.02 software by using a four-parameter logistic curve fitting. 2.2.9 Data analysis and statistics Obtained data were expressed as the mean ± standard error of the mean and compared by a two-tailed Student's t-test using Graph Pad Prism 5.02 software (Graph Pad Software, USA). Differences were considered significant at p<0.05. 3. Results and discussion 3.1 Synthesis and characterization of chitosan derivatives In order to combine the adjuvant activity of Pam3Cys moiety with the beneficial characteristics of chitosan polymers for mucosal pDNA vaccine delivery, we had previously synthesized a new chitosan derivative (Heuking et al., 2009). Moreover, and as described in this report, we applied the developed synthesis procedure to a chitosan from a vegetal source. Firstly, vegetal chitosan was trimethylated yielding N,N,Ntrimethyl chitosan (TMC). TMC (synthesized from chitosan of animal origin) demonstrated high water-solubility at physiological pH, as well as pronounced adjuvant properties (Baudner et al., 2004). 1H NMR spectroscopy of vegetal TMC synthesized here (Fig. 1B) revealed a degree of trimethylation (%DTM) of 33.3 % (abbreviated as TMC35), 91 whereas peaks can be assigned as published previously (Heuking et al., 2009). A B C Figure 1: 1H NMR spectra of A) Pam3Cys-PEG-NH2, B) TMC35 and C) CM20-TMC35-g-PEGPam3Cys (all in D2O at 80 °C). The DTM is a crucial parameter, as only TMC polymers of a DTM higher than 22% are able to open tight junctions of mucosal epithelia and are thus expedient for mucosal delivery (Hamman et al., 2003). In addition, we quantified the degrees of 3- and 6hydroxy-methylation (%D3OM and %D6OM, respectively), as well as dimethylation (%DDM) to be of 27.0, 30.0 and 54.4 %, respectively. These parameters were shown to affect strongly cytotoxicity and physicochemical properties of TMC. More specific, Jintapattanakit et al. (2008) reported that a ratio of %DDM / %DTM higher than 1 involves a decrease in mucoadhesivity and cytotoxicity. In addition, Verheul et al. (2008) pointed out that O-methylated (%D3OM and %D6OM) TMC polymers caused lower toxicity on Caco-2 cells when compared to O-methyl free TMC. 92 In a next step, we performed 6-0-carboxymethylation of TMC and determined the degree of carboxymethylation (%DCM) to be of 23.2% (data not shown; polymer henceforth abbreviated CM25-TMC35) by 1H NMR spectroscopy. In a next step, we conjugated the TLR-2 agonist Pam3Cys-PEG-NH2 to polymeric CM25-TMC35 by using condensing agents. Finally, we ascertained the degree of grafting (%DG) to be about 2.1% by 1H NMR spectroscopy (Fig. 1C, Heuking et al., 2009). FTIR spectroscopy confirmed the successful grafting (data not shown). Additionally, we analysed by SEC-MALLS for changes in the molecular weight and found a shift from 98,330 Da for CM25-TMC35 to 250,900 Da for CM25-TMC35-g-PEG-Pam3Cys, indicating that successful grafting occurred. Moreover, both chitosan derivatives were highly soluble in PBS (pH 7.4) at 5.0 mg/mL concentrations. 3.2 Nanocarrier preparation and characterization Nanocarriers were formed at pH 7 and at low ionic strengths owing to complex coacervation between negatively charged pDNA (phosphate groups, P) and positively charged chitosan derivative (trimethylated amines, N). More precisely, nanocarriers of CM25-TMC35 (used as control group) and CM25-TMC35-g-PEG-Pam3Cys were formed with pDNA at different N/P ratios, ranging from 3:1-30:1. Nanocarriers had a high encapsulation efficiency with 92.2 ± 1.6 % for CM25-TMC35 pDNA nanocarriers and 90.3 ± 2.3 % for CM25-TMC35-g-PEG-Pam3Cys pDNA nanocarriers. Agarose gel electrophoresis (Fig. 2) demonstrated the capacity of CM25TMC35 and CM25-TMC35-g-PEG-Pam3Cys nanocarriers (N/P ratio of 3:1) to retain pDNA (due to nanoparticle formation) and to protect pDNA against enzymatic degradation with DNase I. Similar results were obtained with nanocarriers at N/P ratios of 10:1, as well as 30:1 (data not shown). 93 Photon Correlation Spectroscopy (PCS) of nanocarriers pointed at narrow hydrodynamic diameter distributions (table 1). Compared to CM25-TMC35 nanocarriers, CM25-TMC35-g-PEG-Pam3Cys nanocarriers (at all N/P ratios studied) were slightly bigger in their hydrodynamic diameter, which may be related to the protrusion of the PEG polymers attached to the particle surface. In addition, conjugation of PEG polymers reduced the observed zeta potential (table 1). 1 2 3 4 5 6 7 8 Figure 2: Agarose gel electrophoresis of pDNA ladder (lane 1), pDNA (lane 2), pDNA incubated with DNase I (lane 3), CM25-TMC35 pDNA nanocarrier (lane 4), CM25-TMC35 pDNA nanocarrier incubated with DNase I (lane 5), CM25-TMC35-g-PEG-Pam3Cys pDNA nanocarrier (lane 6), CM25-TMC35-g-PEG-Pam3Cys pDNA nanocarrier incubated with DNase I (lane 7), pDNA ladder (lane 8). All nanocarriers were prepared at a N/P ratio of 3:1. 94 Interestingly, relating to the N/P ratio applied, the hydrodynamic diameter of nanocarriers changed in an indirect proportional way, while the zeta potential changed directly proportional. A comparable tendency was described by Mansouri et al. (2006) for a chitosan-folate pDNA carrier system. Table 1: Size distribution and zeta potential of nanocarriers (conjugate, CM25-TMC35-gPEG-Pam3Cys; 1after dilution 1:15 in plain RPMI 1640 medium). Polymer N/P Size [nm] ratio Zeta potential Poly- [mV] dispersity CM25-TMC35 3:1 354.1 ± 87.3 32.3 ± 1.5 0.351 CM25-TMC-351 3:1 421.2 ± 125.3 17.3 ± 3.5 0.544 (96.3%) 2201.9 ± 877.2 (3.7%) CM25-TMC35 10:1 291.1 ± 43.0 34.3 ± 7.3 0.531 CM25-TMC35 30:1 260.3 ± 75.2 36.8 ± 4.1 0.291 Conjugate 3:1 398.5 ± 112.1 27.9 ± 1.6 0.223 Conjugate1 3:1 452.1 ± 99.3 (97.8%) 15.2 ± 1.6 0.407 1901.4 ± 543.5 (2.2%) Conjugate 10:1 327.2 ± 78.5 31.2 ± 1.4 0.458 Conjugate 30:1 281.2 ± 101.7 34.7 ± 5.3 0.433 However, after suspension of both, CM25-TMC35 as well as CM25-TMC35-g-PEG-Pam3Cys nanocarrier systems 1:15 in RPMI 1640 medium (0.15 M ionic strength, pH 7.4), a bi- 95 modal hydrodynamic diameter distribution was detected. More than 90% of CM25TMC35 nanocarriers (N/P of 3:1) were of a size of 421.2 ± 125.3 nm, and showed a tendency to aggregate (2201.9 ± 877.2 nm). Likewise, more than 90% of CM25-TMC35-gPEG-Pam3Cys nanocarriers (N/P of 3:1) increased in hydrodynamic diameter to 452.1 ± 99.3 nm with slightly smaller aggregates of 1901.4 ± 543.5 nm. Gemershaus et al. (2008) observed similar characteristics of chitosan and chitosan derivative pDNA polyplexes in DMEM culture medium. In addition, values for the zeta potential of CM25-TMC35 and CM25-TMC35-g-PEG-Pam3Cys nanocarriers dropped nearly by half, probably due the higher ionic strengh applied, from 32.3 ± 1.5 mV to 17.3 ± 3.5 mV and 27.9 ± 1.6 mV to 15.2 ± 1.6 mV, respectively. Moreover, chitosan pDNA vaccine delivery systems may transfect epithelial cells (Hu et al., 2006; Huang et al. 2005). In the in vivo situation this translates into a transfection of the pulmonary epithelium, production and secretion of the antigen, and its uptake by antigen-presenting cells (cross-presentation). We therefore assessed the potential of CM25-TMC35 and CM25-TMC35-g-PEG-Pam3Cys pDNA nanocarriers to transfect a human alveolar epithelial cells, A549 (Forbes and Ehrhardt, 2005) and differentiated THP-1 macrophages. For comparison, we involved also the study of TransIT-LT1 (a commercially available transfection reagent)-mediated pGFP transfection. All three carrier systems had the ability to transfect A549 cells with the ranking of TransIT-LT1 > CM25-TMC35 = CM25-TMC35-g-PEG-Pam3Cys (figure 3). In more detail, the use of TransIT-LT1 induced at all time points (from day two until day six) a significant higher protein expression than CM25-TMC35 and CM25-TMC35-g-NH-PEG-Pam3Cys mediated transfection (p<0.05). No difference in transfection capacity was seen between CM25TMC35 and CM25-TMC35-g-NH-PEG-Pam3Cys pGFP delivery systems. It is noteworthy that all chitosan-based delivery systems initiated a later onset of GFP expression in 96 comparison to TransIT-LT1 transfection. Considering the GFP transfection of mTHP-1 cells, the amount of GFP-positive cells between day two and day six was very low (below 2%, data not presented) for all formulations applied. Similar findings were already published by Schnoor et al. (2009). * * * * * Figure 3: In vitro GFP transfection efficiency in A549 cells of CM25-TMC35 (red), TransIT-LT1 transfection reagent (blue) and CM25-TMC35-g-PEG-Pam3Cys (green) pGFP carrier systems. Statistical differences are denoted with * (p < 0.05) for TransIT-LT1 compared to LMC and CM25-TMC35-g-NH-PEG-8HA pGFP transfection, respectively. 3.3 mRNA expression of TLR-2 in different cell lines In order to evaluate the ability of the copolymer pDNA nanocarrier to interact with the TLR-2 receptor, we screened for the endogenous level of its expression by several epithelial and non-epithelial cell lines using qPCR. In general, TLR-2 is expressed at the cell surface in a large variety of cell types (Muzio et al., 2000). TLR-2 identifies its ligands as heterodimer either combined with TLR-1 or TLR-6, whereby TLR1/TLR2 combination enables recognition of triacylated lipoproteins and TLR-2/TLR-6 recognizes diacylated lipoproteins and peptidoglycans (Wetzer, 2003). 97 In our hands, mTHP-1 cells exhibited the highest level of expression of TLR-2 (1200-fold, normalized to β-actin expression, Fig. 4), when compared to Caco-2 or Calu-3 (250-fold) or T24 (50-fold). 16HBE14o-, HEK-293 as well as A549 cell lines did not express TLR-2. Similarly, Sadik et al. (2008) found also a strong expression of TLR-2 in mTHP-1 cells, which allowed them to study the stimulation of TLR-2 agonist Pam3Cys-Ser-(Lys)4 by measuring the release of the chemokine IL-8. Due to this study as well as the suitability of mTHP-1 cells as an in vitro model of human macrophages (Schnoor et al., 2009), we deployed this system for evaluating our TLR-2 agonist decorated pDNA nanocarrier. Figure 4: mRNA expression, normalized to β-actin mRNA levels, of Toll-like receptor-2 in different cell lines. 3.4 Cytotoxicity of chitosan derivatives and nanocarriers As quaternization of chitosan polymers in general entails an increase in cellular toxicity (Jintapattanakit et al., 2008), we evaluated the cytotoxicity of both new chitosan 98 derivatives (polymers and nanocarriers) as well as the TLR-2 agonist NH2-PEG-Pam3Cys in differentiated THP-1 cells. Cytotoxicity was measured using the cell proliferation assay, WST-1. Both chitosan derivatives showed cytotoxicity dependent on the concentration applied (IC50 > 10 µg/mL), however, when formulated with pDNA, the toxicity decreased by more than 50-fold (Fig. 5). 120,0 100,0 cell survival [%] 80,0 60,0 40,0 20,0 A iu m M ed pD N ju g at e C N C Co n CM TM ys N C m 3C N H2 -P E G -P a ug a te ² te ¹ C on j ug a 35 ² on j C -T M C M 25 C C M 25 -T M C 35 ¹ 0,0 Figure 5: Cytotoxicity of polymers and pDNA nanocarriers studied on mTHP-1 cells using the following concentrations: 1at 100 μg/mL; 2at 10 μg/mL; NH2-PEG-Pam3Cys at 0.12 mg/mL; pDNA nanocarrier (NC) CM25-TMC35 at 0.14 mg/mL (N/P 3:1); NC conjugate, CM25-TMC35-g-PEG-Pam3Cys at 0.2 mg/mL (N/P 3:1) and pDNA pDNA at 40 μg/mL. In addition, the TLR-2 agonist NH2-PEG-Pam3Cys (applied at a molar equivalent to 99 grafted moieties) had only minor influence on the proliferation of mTHP-1 cells (cell viability reduction of 25.4%). 3.5 IL-8 release upon stimulation of TLR-2 in mTHP-1 cells The chemokine IL-8 (CXCL 8) is a proinflammatory cytokine, playing an important role in the promotion of neutrophil recruitment (Baggiolini 2001). Interestingly, differentiated THP-1 cells release high levels of IL-8 upon TLR-2 stimulation with 1 µg/mL of Pam3Cys-Ser-(Lys)4 (Sadik et al., 2008). We applied this particular in vitro model in order to study our pDNA nanocarriers. Firstly, we investigated the potential of NH2-PEG-Pam3Cys to trigger IL-8 production by applying an equimolar quantity to 1 µg/mL of Pam3Cys-Ser-(Lys)4. The results of this study were needed to ensure the activity of the TLR-2 agonist grafted onto the surface of the nanocarriers by PEG spacer. ns 70 ** IL-8 (ng/mL) 60 ** 50 40 30 *** 20 *** 10 * 0 Medium 1.0 µg/mL of Pam3CSK4 NH2-PEGPam3Cys CM25-TMC35 Conjugate Figure 6: IL-8 release studied by ELISA in mTHP-1 cell supernatants following polymer exposure (conjugate, CM25-TMC35-g-PEG-Pam3Cys; Pam3CSK4, Pam3Cys-Ser-(Lys)4). Significance was controlled by two-tailed Student's t-test via comparison with values obtained from cell culture medium, unless indicated otherwise with horizontal bars. 100 Differences were considered significant for * p<0.05, ** p<0.01 and *** p<0.001. ns: not significant. As shown in Fig. 6, NH2-PEG-Pam3Cys elicited a strong IL-8 release (46.8 ng/mL), which was not significantly different (p>0.05) from the value obtained for the reference TLR-2 agonist Pam3Cys-Ser-(Lys)4 (59.6 ng/mL). Overall, we report here for the first time the immune stimulating effect of a PEGylated Pam3Cys moiety, NH2-PEG-Pam3Cys, on mTHP-1 cells measured by IL-8 release. Interestingly, Sadik et al. (2008) demonstrated that around 70% of IL-8 levels triggered by Pam3Cys-Ser-(Lys)4 on mTHP-1 cells can be blocked via TLR-2 antibody co-incubation. We assume therefore that the IL-8 inducing effect of NH2-PEG-Pam3Cys is also mainly regulated by the same TLR-2 pathway. In the past, the first study demonstrating immunogenic properties of PEGylated Pam3Cys moieties were carried out by Kleine et al. (1994), whereby the adjuvant activity in vitro in murine and human B lymphocytes as well as in vivo in mice was investigated. It was shown that the water-soluble conjugate maintained its immunogenic properties after PEGylation of the Pam3Cys moiety in vitro and in vivo when compared to Pam3Cys-Ser(Lys)4. However, as TLR-2 expression was unknown at the time, those results were not brought in correlation to the TLR-2 pathway. In line with our study, we found a significant (p<0.001), almost 4-fold increase in IL-8 production caused by the 2.1 % grafting of NH2PEG-Pam3Cys to CM25-TMC35 (CM25-TMC35-g-PEG-Pam3Cys: 11.9 ng/mL; CM25-TMC35: 3.2 ng/mL). Interestingly, CM25-TMC35 polymer on itself appears to be able to trigger release of IL-8, which is significantly different (p<0.05) from cell culture medium as the respective control group (Fig. 6). This property of chitosan polymers was also reported by Park et al. (2009). Herein, neutrophil-like HL60 cells were incubated with chitosan of 101 different degrees of acetylation and similarly to our study, the triggered secretion of IL-8 was analyzed. As a result, they measured an IL-8 release up to approximately 1.5 ng/mL, which is in good accordance with the level of IL-8 found (3.2 ng/mL) for CM25-TMC35 polymer exposure in our study. *** IL-8 (ng/mL) 20 *** 10 *** ** 0 Medium pDNA NP CM25-TMC35 NP Conjugate Figure 7: IL-8 release studied by ELISA in mTHP-1 cell supernatants following pDNA nanocarriers, as well as pDNA exposure (conjugate = CM25-TMC35-g-PEG-Pam3Cys). Significance was checked by two-tailed Student's t-test via comparison with values obtained from cell culture medium, unless indicated otherwise with horizontal bar. Differences were considered significant for * p<0.05, ** p<0.01 and *** p<0.001. ns: not significant. Furthermore, the TLR-2 agonist decorated pDNA nanocarriers were about 10-fold more potent than the CM25-TMC35 nanocarriers in view of eliciting IL-8 release from mTHP-1 cells (p<0.001, Fig. 7). 102 In our view, an explanation why this difference was not more pronounced lies in the structure of the nanocarriers. Due to the coacervation process between pDNA and the co-polymer, some of the TLR-2 targeting moieties may be buried inside the particles, and are thus not displayed on the surface to interact with their target receptor. 4. Conclusions The results obtained in this study point towards the possibility to synthesize TLR agonist functionalized co-polymers, based on a chitosan obtained from vegetal sources. Complexation with pDNA yielded decorated nanocarriers, which, by virtue of the TLR-2 agonist present at the particle surface, were able to induce IL-8 release in human macrophages in vitro. In successive in vivo studies, the adjuvant effect of the described nanocarriers will be evaluated. Moreover, we believe that TLR ligand functionalized polymers, and nanocarriers systems, represent a technology platform to address the modulation of TLR activity in a variety of diseases, including autoimmune and inflammatory diseases, and cancer. Studies pertaining to such applications are currently underway in our lab. Acknowledgments The authors would like to acknowledge Prof. Peter Speiser for the continuing inspiration he provides for generations of scientists working in the field of drug nanocarrier systems, and drug targeting. 103 References Baggiolini, M. (2001) “Chemokines in pathology and medicine”, J. Intern. Med. 250, 91104. Baudner, C.B., Morandi, M., Giuliani, M.M., Verhoef, J.C., Junginger, H.E., Costantino, P., Rappuoli, R. and Giudice, G.D., 2004. “Modulation of immune response to group C meningococcal conjugate vaccine given intranasally to mice together with the LTK63 mucosal adjuvant and the trimethyl chitosan delivery system”, J. Infect. Dis. 189, 828-832. Bennett, J.V., De Castro, F. J., Valdespino-Gomez, J.L., De Lourdes Garcia-Garcia, M., IslasRomero, R., Echaniz-Aviles, G., Jimenez-Corona, A. and Sepulveda-Amor, J. (2002) “Aerosolized measles and measles-rubella vaccines induce better measles antibody booster responses than injected vaccines: randomized trials in Mexican schoolchildren“, Bull. World Health. Organ. 80, 806–812. Bivas-Benita, M., van Meijgaarden, K.E., Franken, K.L.M.C., Junginger, H.E., Borchard, G., Ottenhoff, T.H.M. and Geluk, A. (2004) “Pulmonary Delivery of chitosan-DNA nanoparticles enhances the immunogenicity of a DNA vaccine encoding HLAA*0201-restricted T-cell epitopes of Mycobacterium tuberculosis”, Vaccine 22, 1609-1615. Bivas-Benita, M., Ottenhoff, T.H., Junginger, H.E. and Borchard, G. (2005) “Pulmonary DNA vaccination: concepts, possibilities and perspectives”, J. Control. Rel. 107, 129. Bivas-Benita, M., Lin, M.-Y., Bal, S., van Meijgaarden, K.E., Franken, K. L.M.C., Friggen, A.H., Junginger, H.E., Borchard, G., Klein, M.R. and Ottenhoff, T. H. M. (2009) “Pulmonary vaccination with DNA encoding Mycobacterium tuberculosis latency antigen Rv1733c associated to PLGA-PEI nanoparticles enhances T cell responses 104 in a DNA prime/protein boost vaccination regimen in mice“, Vaccine 27, 40104017. Blank, F., Rothen-Rutishauser, B. and Gehr, P. (2007) “Dendritic cells and macrophages form a transepithelial network against foreign particulate antigens”, Am. J. Respir. Cell Mol. Biol. 36, 669-677. Dilraj, A., Cutts, F.T., De Castro, J.F., Wheeler, J.G., Brown, D., Roth, C., Coovadia, H.M. and Bennett, J.V. (2000) “Response to different measles vaccine strains given by aerosol and subcutaneous routes to schoolchildren: a randomised trial“, Lancet 355, 798–803. Forbes, B. and Ehrhardt, C. (2005) “Human respiratory epithelial cell culture for drug delivery applications”, Eur. J. Pharm. Biopharm. 60, 193-205. Germershaus, O., Mao, S., Sitterberg, J., Bakowsky, U. and Kissel, T. (2008) “Gene delivery using chitosan, trimethyl chitosan or polyethylenglycol-graft-trimethyl chitosan block copolymers: establishment of structure-activity relationships in vitro”, J. Control. Rel. 125, 145-154. Hamman, J.H., Schultz, C.M. and Kotzé, A.F. (2003) “N-trimethyl chitosan chloride: optimum degree of quaternization for drug absorption enhancement across epithelial cells“, Drug. Dev. Ind. Pharm. 29, 161-172. O´Hagan, D.T., Singh, M. and Ulmer, J.B. (2006) “Microparticle-based technology for vaccines”, Methods 40, 10-19. Heuking, S., Iannitelli, A., Di Stefano, A. and Borchard, G. (2009) “Toll-like receptor-2 agonist functionalized biopolymer for mucosal vaccination” Int. J. Pharm. 17, 662670. 105 Hu, F.-Q., Zhao, M.D., Yuan, H., You, J., Du, Y.-Z. and Zeng, S. (2006) “A novel chitosan oligosaccharide-stearic acid micelles for gene delivery: properties and in vitro transfection studies“, Int. J. Pharm. 315, 158-66. Huang, M., Fong, C.W., Khor, E. and Lim, L.Y. (2005) „Transfection efficiency of chitosan vectors: effect of polymer molecular weight and degree of deacetylation“, J. Control. Rel. 106, 391-406. Iwasaki, A. and Medzhitov, R. (2004) “Toll-like receptor control of the adaptive immune responses”, Nat. Immunol. 5, 987-995. Jintapattanakit, A., Mao, S., Kissel, T. and Junyaprasert, V.B. (2008) “Physicochemical properties and biocompatibility of N-trimethyl chitosan: Effect of quaternization and dimethylation”, Eur. J. Pharm. Biopharm. 70, 563-571. Kleine, B., Rapp, W., Wiesmüller, K.H., Edinger, M., Beck, W., Metzger, J., Ataulakhanov, R., Jung,. G., and Bessler, W.G. (1994) “Lipopeptide-polyoxyethylene conjugates as mitogens and adjuvants”, Immunobiology 190, 53-66. Lee, C.G., Da Silva, C.A., Lee, J.Y., Hartl, D. and Elias, J.A. (2008) “Chitin regulation of immune responses: an old molecule with new roles”, Curr. Opin. Immunol. 20,684-689. van der Lubben, I.M., Verhoef, J.C., Borchard, G. and Junginger, H.E. (2001) “Chitosan and its derivatives in mucosal drug and vaccine delivery”, Eur. J. Pharm. Sci. 14, 201207. Mansouri, S., Cuie, Y., Winnik, F., Shi, Q., Lavigne, P., Benderdour, M., Beaumont, E. and Fernandes, J.C. (2006) “Characterization of folate-chitosan-DNA nanoparticles for gene therapy”, Biomaterials 27, 2060-2065. Di Mario, F., Rapanà., P., Tomati, U. and Galli, E. (2008) “Chitin and chitosan from Basidomycetes”, Int. J. Biol. Marcomol. 43, 8-12. 106 Muzio, M., Polentarutti, N., Bosisio, D., Prahladan, M.K. and Mantovani, A. (2000) “Tolllike receptors: a growing family of immune receptors that are differentially expressed and regulated by different leukocytes”, J. Leukoc. Biol. 67, 450-456. Nishimura, M. and Naito, S. (2005) “Tissue-specific mRNA expression profiles of human toll-like receptors and related genes”, Biol. Pharm. Bull. 28, 886-892. Park, C.J., Gabrielson, N.P., Pack, D.W., Jamison, R.D. and Johnson, A.J.W. (2009) “The effect of chitosan on the migration of neutrophil-like HL60 cells mediated by IL8”, Biomaterials 30, 436-444. Sadik, C.D., Hunfeld, K.-P., Bachmann, M., Kraiczy, P., Eberhardt, W., Brade, V, Pfeilschifter, J., and Mühl, H. (2008) “Systematic analysis highlights the key role of TLR2/NF-κB/MAP kinase signaling for IL-8 induction by macrophage-like THP-1 cells under influence of Borrelia burgdorferi lysates”, Int. J. Biochem. Cell Biol. 40, 2508-2521. Schnoor, M., Buers, I., Sietmann, A., Brodde, M.F., Hofnagel, O., Robenek, H. and Lorkowski, S. (2009) “Efficient non-viral transfection of THP-1 cells”, J. Immunol. Methods 344, 109-115. Verheul, R.J., Amidi, M., van der Wal, S., van Riet, E., Jiskoot, W. and Hennink, W.E. (2008) “Synthesis, characterization and in vitro biological properties of O-methyl free N,N,N-trimethylated chitosan”, Biomaterials 29, 3642-3649. Wetzler, L.M. (2003) “The role of Toll-like receptor 2 in microbial disease and immunity”, Vaccine 21, 55-60. Zeng, W., Jackson, D.C., Murray, J., Rose ,K. and Brown, L.E. (2000) “Totally synthetic lipid-containing polyoxime peptide constructs are potent immunogens”, Vaccine 18, 1031-1039. 107 Zhang, X., Chentoufi, A.A., Dasgupta, G., Nesburn, A.B., Wu, M., Zhu, X., Carpenter, D., Wechsler, S.L., You, S. and BenMohamed, L. (2009) “A genital tract peptide epitope vaccine targeting TLR-2 efficiently induces local and systemic CD8+ T cells and protects against herpes simplex virus type 2 challenge”, Mucosal Immunol. 2, 129-143. 108 Chapter 5 Functionalization with a TLR-7 agonist enhances the immunogenicity of chitosan DNA nanoparticles in human THP-1 macrophages S. Heuking1,2 and G. Borchard1,2 To be submitted 1School of Pharmaceutical Sciences, University of Geneva, Switzerland 2Centre Pharmapeptides, Archamps, France 109 Abstract In order to provide an adjuvant-equipped carrier system for plasmid DNA vaccines, we grafted a TLR-7 agonistic moiety (9-benzyl-8-hydroxyadenine, 8HA) through a PEG spacer onto a water-soluble chitosan derivative (CM-TMC). Successful grafting was confirmed by spectroscopic (1H NMR, Mass, UV/VIS and FTIR) and chromatographic (SEC-MALLS) methods. In the following, TLR-7 agonist functionalized nanoparticles (NP) were prepared by aggregation with pDNA. NP were around 400 nm in size with a positive surface charge and had the ability to transfect alveolar A549 cells. In addition, TLR-7 agonist functionalization was shown to increase the IL-8 and IL-12 specific immunogenicity in mTHP-1 macrophages significantly, when compared to nonfunctionalized NP. 1. Introduction Recently, we reported on the synthesis of a new TLR-2 agonist functionalized chitosan derivative (Heuking et al., 2009a), which was employed for the encapsulation of plasmid DNA (pDNA) resulting in positively charged NP. Interestingly, TLR-2 agonist decoration of pDNA nanoparticles (NP) enabled an approximately ten-fold higher induction (p< 0.001) of stimulatory cytokine IL-8 from differentiated human macrophages-like THP-1 cells (Heuking et al., 2009b). In an attempt to further study the potential of TLR ligands as adjuvants for chitosan particle-based DNA vaccination, 8-hydroxyadenine derivatives as TLR-7 agonists attracted our attention. Human TLR-7 located in the endosomal compartment of innate immune cells is highly expressed in the lung, placenta and spleen (Chuang and Ulevitch, 2000). Activation of TLR-7 involves the MyD88-dependent signaling cascade and elicits the production of IFN-α, TNF-α and IL-12, favoring a cellmediated immunity (Hemmi et al., 2002). Natural ligands of TLR-7 consist of single- 110 stranded RNA oligonucleotides (ssRNA; Heil et al., 2004). In addition, small chemical molecules, such as imidazoquinolines and 8-hydroxyadenine derivatives with significant TLR-7 agonistic capacity were discovered recently (Hemmi et al., 2002; Lee et al., 2006). In our study, a TLR-7 agonistic moiety, a 9-benzyl-8-hydroxyadenine derivative, was selected and rendered water-soluble by PEG chain attachment at its C-2 position. In turn, we grafted the TLR-7 targeting conjugate to a water-soluble chitosan derivative (CM-TMC) using procedures established previously (Heuking et al., 2009a). Subsequently, DNA incorporating nanoparticles were prepared, which were then analysed for their DNA transfection efficiency and immunogenicity in THP-1 macrophages. 2. Materials and methods 2.1 Materials N,N,N-trimethylated chitosan (trimethylation of 33.3%, abbreviated TMC35) was prepared from vegetal chitosan (degree of deacetylation of 87.7% and molecular weight of 108,000 Da), which was a kind gift by Kitozyme S.A. (Herstal, Belgium). Low molecular weight chitosan (molecular weight below 10,000 Da and degree of deacetylation of 85.3%) was obtained from Nicechem (Shanghai, China). Dialysis membrane Spectra/Por 4 (cut-off 12-14,000Da) and Spectra/Por 7 (cut-off 1,000 Da) were obtained from Spectrum (USA). α-amino-ω-t-butyloxycarbonylamino poly(ethylene glycol) was purchased from IRIS Biotech GmbH (Germany). 2-chloro-9-benzyl-8hydroxyadenine was received from Accely (China). RPMI 1640 cell culture medium, fetal calf serum (FCS), mercaptoethanol and phorbol 12-myristate 13-acetate (PMA) were obtained from Pan Biotech GmbH (Germany). Human IL-12p40 ELISA kit was from BD Biosciences (Switzerland). Human IL-8 ELISA kit was purchased from Assay Designs 111 (France). Agarose powder was obtained from Bio-Rad (France). pIRES-hrGFP II, a 5.5 kbp plasmid, was received from Stratagene (France) and amplified by using an Endofree Plasmid Maxi Kit (Qiagen, France). DNase I (amplification grade) was from Invitrogen (France). Heparin (175U/mg) was obtained from LKT labo (Switzerland). The transfection reagent TransIT-LT1 was purchased from Mirus (France). All other reagents and solvents were of analytical grade and supplied by Sigma-Aldrich (Switzerland). 2.2 Characterization of polymers 1H NMR spectra were recorded on a Varian VXR 300 MHz spectrometer (Varian, Switzerland). Chitosan was dissolved in 1% v/v DCl/D2O, chitosan derivatives in D2O and all other compounds in DMSO or CD3CN (concentrations of 20 mg/mL). Chemical shifts are indicated in parts per million (δ) downfield from the internal standard tetramethylsilane (Me4Si). Mass spectroscopy spectra were recorded on an API 150 EX LC/MS System (Switzerland). The MALDI-TOF mass spectrometry was conducted on an Axima CFR+, Shimadzu mass spectrometer (Switzerland). Homogeneity of synthesized compounds was confirmed by thin layer chromatography (TLC) on silica gel Merck 60 F254 aluminium plates. FTIR spectra were recorded on a Perkin-Elmer 100 FT-IR spectrometer (Perkin-Elmer, Switzerland) in the range of 4000–400 cm-1. SEC-MALLS measurements were performed using a TOSOH TSK Gel G3000PWXL-CP size exclusion column (TOSOH Bioscience, Germany) with 0.2 M sodium acetate/0.3 M acetic acid (pH 4.4) as eluent (0.3 mL/min). A Waters Alliance HPLC system coupled to a differential refractive index (RI) detector (Schambeck, Germany) and a light scattering detector (MiniDawn, Wyatt, USA) was used for sample handling. Pullan standards ranging from 47,000 g/mol to 710,000 g/mol (PSS, Germany) were used for calibration. 112 2.3 Synthesis of ω-amido-[9-benzyl-8-hydroxyadenine-2yl]α-amino poly(ethylene glycol) 2.3.1 Synthesis of α-amido-[9-benzyl-8-hydroxyadenine-2yl]-ω-t-butyloxycarbonylamino poly(ethylene glycol) 2 Synthesis of 2 was achieved according to Isobe et al. (2006) with some modifications. First, 22.97 mg (83.3 mmol, five times excess of free amines) of 2-chloro-9-benzyl-8hydroxyadenine (abbreviated 8HA, 1) were dissolved in 20 mL n-butanol at 120°C followed by the addition of 50 mg (16.7 mmol) of α-amino-ω-t-butyloxycarbonylamino poly(ethylene glycol) (abbreviated Boc-NH-PEG-NH2). After 16h of stirring at 120°C, the reaction mixture was cooled to room temperature and centrifuged at 1,850 x g for 15 minutes in order to remove unreacted (and at room temperature insoluble) 8HA. The supernatant was taken and the procedure was repeatedtwice. The resulting supernatant was then dialysed (cut-off 1,000 Da) over three days against deionized water (twice daily changed), sterile filtered and lyophilized. Yellowish powder. Yield 64 %. 1H NMR (300 MHz, CD3CN): δ 1.4 ((CH3)3-O); δ ~3.6 (PEG-CH2); δ 5.1 (NH2); δ 6.6 (PEG-NH); δ 7.3 (aromatic hydrogen); δ 8.1 (N-CH2). FTIR: 679, 770, 841, 908, 928, 1060, 1101, 1663, 1706, 2882, 3137, 3419. UV (λmax, 6M HCl): 259.9 nm. 2.3.2 Synthesis of ω-amido-[9-benzyl-8-hydroxyadenine-2yl]α-amino poly(ethylene glycol) 3 Compound 3 (abbreviated NH2-PEG-8HA) was obtained after deprotection of tert-butyl cabarbamat (Boc) group by using the method of Shendage et al. (2004). Briefly, 100 mg of 2 was dissolved in 20 mL of TFA:CH2Cl2 1:1 (v/v) and stirred at 1000 rpm for two hours at room temperature. After evaporation of solvents, the residue was dissolved in 10 mL of deionized water and dialysed (membrane cut-off of 1,000 Da) over three days (twice daily change of deionized water), sterile filtered and lyophilized. Yellowish 113 powder. Yield 94 %. 1H NMR (300 MHz, CD3CN): δ ~3.6 (PEG-CH2); δ 5.1 (NH2); δ 6.6 (PEG-NH); δ 7.3 (aromatic hydrogen); δ 8.1 (N-CH2). FTIR: 679, 770, 841, 908, 928, 1060, 1101, 1663, 1706, 2882, 3137, 3419. UV (λmax, 6M HCl): 258.8 nm. MS (API): expected m/z 3072.6 M+, found m/z 3070.2 M+. 2.4 Synthesis of CM-TMC-g-NH-PEG-8HA (4) TMC and CM-TMC were synthesized as described previously (Heuking et al., 2009a). NH2-PEG-8HA was grafted to CM-TMC by using EDC/NHS condensing agents. Briefly, CMTMC (20 mg; 0.089 mmol sugar units, 0.015 mmol COOH) was dissolved in MilliQ water (4 mL) at room temperature and the pH adjusted to a value of 7. Next, EDC (5.7 mg, 0.03 mmol, 2 mol equivalents to COOH) and NHS (3.5 mg; 0.03 mmol, 2 mol equivalents to COOH) were added. NH2-PEG-8HA (8.2 mg, 0.003 mmol) was added and reaction was performed during 120 hours, whereby the pH was maintained at neutrality. In the following, the solution was dialysed (membrane cut-off 12-14,000 Da) over the course of one week (medium changed twice daily), sterile filtered and then freeze dried. The finalized product (4) was then submitted to further investigation. The degree of grafting (DG) was assessed by using the following equation: %DG = ([PEG-CH2CH2] / (255.5 x [H]) ) x 100. In orthogonal manner, UV/VIS spectroscopy (λmax = 260 nm) was utilized for determination of %DG. 1H NMR (300 MHz, D2O): δ 2.0 (COCH3); δ 2.8 (N-(CH3)2); δ 3.3 (N+-(CH3)3); δ 3.4 (6O- CH3); δ 3.5 (3O-CH3); δ ~3.6 (CH2-CH2-CO); δ 4.1 (CH2-CO); δ 4.8-6.0 (H-1, CH). FTIR: 697, 770, 842, 908, 952, 1057, 1236, 1359, 1456, 1641, 1706, 2881, 3283. UV (λmax, 6M HCl): 259.9 nm. 114 2.5 Solubility measurements of chitosan polymers The solubility of both chitosan derivatives (CM-TMC and CM-TMC-g-NH-PEG-8HA) was determined in physiological phosphate buffered saline (PBS, pH 7.4) at a concentration of 5.0 mg/mL. The transmittance (%T) of polymers was measured at λ = 600 nm by using a Cintra 404 UV/VIS spectrometer (Switzerland). Polymers were considered soluble for %T > 90% and very soluble for %T > 95 in comparison to the %T of PBS alone (marked with + and ++, respectively). 2.6 Nanoparticle preparation Nanoparticles were formed according to the procedure described by Bivas-Benita et al. (2004) and Köping-Hoggård et al. (2003) with some modifications. Briefly, CM-TMC-gNH-PEG-8HA (at 2.7 mg/mL, average molecular weight per sugar unit of 254.2 Da, 3.6 μmol/mL -N+(CH3)3, N) or CM-TMC (at 2.2 mg/mL, average molecular weight per sugar unit of 207.1 Da, 3.6 μmol/mL -N+(CH3)3, N) were dissolved in Miniversol water (France). Low molecular weight chitosan (LMC, average molecular weight per sugar 185.3 Da, 12 μmol/mL -N+(CH3)3, N) was dissolved at 2.0 mg/mL in 25 mM sodium acetate buffer (pH5.2). Separately, the plasmid pIRES-hrGFP II (abbreviated pGFP; 1 μg of pGFP being equal to 3.1 nmol of phosphate groups, P) was dissolved in 5 mM aqueous Na2SO4 at a concentration of 390 μg/mL in order to yield N/P ratios of 3:1 (chitosan polymers) or 10:1 (LMC). Both solutions were heated for 5 minutes at 55°C. Next, the polymer solution was slowly added (approximately 1 drop per second) to the pGFP solution and subsequently mixed at low speed for 30 seconds. Attention was paid to keep the final volume below or at 400 μL in order to obtain a narrow particle size distribution. Particles were kept at room temperature for at least one hour prior to further use. 115 2.7 Nanoparticle characterization 2.7.1 Loading efficiency 400 μL of nanoparticle suspension was centrifuged at 16,000 x g for 30 min (Centrifuge 5417C/R, Eppendorf, Germany). Unloaded pGFP plasmid in the supernatant was quantified by PicoGreen assay (Invitrogen, Switzerland) according to the manufacturer's procedures. The fluorescence was measured with a FluoroMax spectrometer (Spex, Switzerland) at excitation and emission wavelengths of 480 and 522 nm, respectively. 2.7.2 Transmission electron microscopy (TEM) The morphology of CM-TMC and CM-TMC-g-NH-PEG-8HA pGFP NP was analyzed by TEM using an uranyl acetate staining. Samples were visualized by a FEI Tecnai G2 Sphera electron microscope (Switzerland) at 200 kV. 2.7.3 Electrophoretic mobility analysis First, the ability of CM-TMC and CM-TMC-g-NH-PEG-8HA to bind and immobilize pGFP was examined by agarose gel electrophoresis. Hereby, CM-TMC-g-NH-PEG-8HA pGFP andCM-TMC pGFP NP (N/P ratios of 3:1) were mixed with bromophenol blue as loading dye. 20 μL of each sample was applied in a 1.5 % agarose gel stained with 0.6 μg/mL ethidium bromide. Electrophoresis was then performed at 100 V for 35 minutes using 0.5x TBE buffer. pGFP migration was detected by an UV transilluminator (Bio-Rad, France). Second, the capability of NP to protect incorporated pGFP from enzymatic degradation via DNase I was assessed. pGFP in the absence of polymers, CM-TMC and CM-TMC-g-NHPEG-8HA pGFP NP (both 20 μL, equivalent to 3 μg pGFP, N/P ratio of 3:1) were incubated with 4 μL of DNase I solution (1U/μL in DNase I buffer consisting of 200 mM 116 TRIS-HCl (pH 8.4), 20 mM MgCl2 and 500 mM KCl) for 15 minutes at room temperature. The experiment was terminated by adding 4 μL of 25 mM EDTA solution to the reaction mixture. The integrity of pGFP was then determined by the electrophoretic mobility assay as described above. Third, the stability of DNA formulations was assessed by incubating CM-TMC and CMTMC-g-NH-PEG-8HA pGFP NP (20 μL, equivalent to 3 μg pGFP) with 5 μL/mL of heparin for two hours at room temperature (Köping-Höggård et al., 2004), followed by an electrophoretic mobility assay as described above. Moreover, we studied the in vitro release of pGFP from NP by incubation in phosphate buffered saline (PBS, pH 7.4) at 37°C (Csaba et al., 2009). After one day and one week, CM-TMC pGFP NP, CM-TMC-g-NHPEG-8HA pGFP and LMC pGFP NP in PBS were centrifuged at 16,000 x g for 30 minutes (Centrifuge 5417C/R, Eppendorf, Germany) and 15 μL of supernatant was submitted to gel electrophoresis. For all experiments, pGFP in the absence of polymers and a 1 kbp pDNA ladder (BioLabs, England) served as controls. 2.7.4 Size and zeta potential of nanoparticles Hydrodynamic diameters were measured by Photon Correlation Spectroscopy (ZetaSizer 3000 HS, Malvern, Switzerland). For each measurement, 400 μL of NP suspension were diluted in PBS (pH 7.4) to a total of 1.4 mL. Size distribution data were obtained by the number-averaged value of three independent groups of ten measurements. In addition, zeta potential was measured at least in triplicate via microelectrophoresis by using an aqueous dip cell (ZetaSizer 3000 HS, Malvern, Switzerland). 117 2.8 Cell culture THP-1 cells, a human monocytic cell line, and A549 cells, a cell line derived from a human lung carcinoma, were purchased from ATCC (American Type Culture Collection, USA). Cell lines were grown in specific medium supplemented with 10% (v/v) fetal bovine serum and penicillin (100 U/mL) and streptomycin (100 µg/ml). Cells were cultured in an incubator at 37°C, 95% relative humidity, 5% CO2 and passaged at approximately 80% confluency. All cell culture reagents were provided by Invitrogen and Sigma-Aldrich (France). For differentiation of THP-1 cells, seeding was performed at a density of 2 x 105 cells per well (96-well plate, unless stated otherwise) in the presence of PMA (50 ng/mL) followed by an incubation for 48h. After differentiation to mTHP-1 cells and twice washing with PBS, cells were cultured for a recovery period of 3h in the above mentioned medium and used for further experiments (Sadik et al., 2008). 2.9 GFP Transfection A549and mTHP-1 cells were seeded at 1 x 105 cells per well (24-well plate) and cultured for 48h. After mTHP-1 cells were handled as stated above, the following pGFP formulations (2 µg/well) in the appropriate plain medium (for NP) or full medium (for TransIT-LT1 formulation) were incubated with A549 and mTHP-1 cells: 1) CM-TMC pGFP NP, 2) CM-TMC-g-NH-PEG-8HA pGFP NP, 3) LMC pGFP NP and 4) TransIT-LT1 pGFP preparation (used pursuant to the manufacturer’s recommendations). After five hours of exposure, formulations were removed (with the exception of TransIT-LT1 pGFP preparation) and full medium was added. Medium was then changed every second day. Starting with day two until day six, cells were analyzed by fluorescence microscopy (Zeiss Axiovert 40 CFL, Germany) and pictures (Canon Powershot A640, France) were taken at 5x magnification. 118 The percentage of GFP-positive cells (transfection efficiency) was assessed by using ImageJ 1.43 software similar to Csaba et al. (2009). 2.10 hIL-12p40 and hIL-8 release by mTHP-1 cells mTHP-1 cells were cultured in a 96-well plate as stated above. The following samples (in duplicates, 250 µL per well) were studied after 1:15 dilution with plain RPMI 1640 medium: imiquimod (positive control) at 5 µg/mL (in 0.1% DMSO), 8HA at 5 µg/mL (in 0.1% DMSO), NH2-PEG-8HA at 55.5 µg/mL (equimolar amount of 8HA coupled to 5 µg/mL of 8HA), CM-TMC-g-NH-PEG-8HA at 0.21 mg/mL (the amount of NH2-PEG-8HA grafted is equimolar to 5 µg/mL of 8HA), CM-TMC at 0.15 mg/mL (equimolar to CM-TMCg-NH-PEG-8HA). In addition, both chitosan derivatives were used for the formation of DNA NP, either with CM-TMC at 0.15 mg/mL or CM-TMC-g-NH-PEG-8HA at 0.21 mg/mL (both at N/P 3:1). 0.1% DMSO solution, pGFP alone (same amount as encapsulated in NP) and 0.02% SDS (toxicity control) were used as further controls. After incubation during 24h at 37°C, microscopic pictures were taken at 5x magnification (Zeiss Axiovert 40 CFL, Germany; Canon Powershot A640, France) in order to monitor toxicity. Subsequently, cell supernatants of mTHP-1 cells were removed and stored at -80°C until further analysis. For quantification of human IL-12p40 and IL-8, sandwich ELISA was performed in triplicates (IL-12p40) or duplicates (IL-8) according to the manufacturer´s instructions. Standard curve was calculated by a log log regression (R>0.95) and sample concentrations were determined accordingly. Detection limits were 15.6 pg/mL for IL12p40 ELISA and 7.8 pg/mL for IL-8 ELISA. 119 2.12 Data analysis and statistics Obtained data were expressed as the mean ± standard error of the mean and compared by an one-way ANOVA using Origin 7.01 software. Differences were considered significant at p<0.05. 3. Results and discussion The aim of this study was to provide a water-soluble chitosan derivative being functionalized with an immune stimulatory and TLR-7 agonistic (9-benzyl-8hydroxyadenine) moiety as potential adjuvant. Moreover, we applied this novel polymer for the formation of NP delivering a model vaccine, in our case a plasmid DNA. The basis of this concept is the general observation that according to O’Hagan et al. (2006) and Schlosser et al. (2008), for an effective vaccination, the adjuvant (here: 9-benzyl-8hydroxyadenine moiety) and antigen (here: model plasmid DNA expressing GFP) needs to be co-located within the same particulate system (here: chitosan-based nanoparticles). 3.1 Synthesis of CM-TMC-g-PEG-8HA Hirota et al. (2002) synthesized a series of 2-substituted 9-benzyl-8-hydroxyadenine derivatives and analysed their capacity of inducing IFN-α in vitro and in vivo. Regarding Structure-Activity-Relationships (SAR) of the compounds synthesized, they concluded that: i) the 9-benzyl-position is essential for activity; ii) 9-benzyl-8-hydroxyadenine is the simplest structure with IFN-inducing activity; iii) the introduction of alkyl-chain substituents at the C-2 position strongly enhances the activity. In a follow-up study (Isobe et al., 2006), the same group suggested that such 9-benzyl-8-hydroxyadenine derivatives act through the TLR-7 signalling cascade, without presenting detailed 120 information in order to confirm this hypothesis. However, Lee et al. (2006) were able to correlate a TLR-7 activating mechanism to a 9-benzyl-8-hydroxyadenine derivative, namely 9-benzyl-8-hydroxy-2-(2-methoxy ethoxy)adenine (SM360320). In addition, a further 9-benzyl-8-hydroxyadenine derivative and TLR-7 agonist, 2-(4-((6-amino-2(butylamino)-8-hydroxy-9H-purin-9-yl)methyl)benzamido) acetic acid (CL264), was identified. Considering above mentioned information, we selected the simplest and potent TLR-7 agonistic moiety, 9-benzyl-8-hydroxyadenine, and coupled it through the use of a PEG spacer to a NP forming vaccine carrier (polymeric chitosan). The PEG spacer was thought to provide the TLR-7 agonist accessibility to its endosomal receptor and maintain its agonistic properties. In more detail, we synthesized a 9-benzyl-8hydroxyadenine derivative PEGylated at its C-2 position, compound 3 (abbreviated NH2PEG-8HA), according to the scheme in figure 1. Completeness of reaction was evidenced by 1H NMR (fig. 1) and in an orthogonal manner by UV/VIS spectroscopy at λmax = 260 nm (data not presented). Both methods indicated that complete amidation at the C-2 positon took place. 121 O NH2 H3C CH3 HO O H2N m NH n H3C O OCH3 O CH3 Chitosan OH Boc-NH-PEG-NH2 NMP, NaI, NaOHaq,CH3I 1. 8HA, n-butanol (60°C, 1h) (120°C, 16h) 2. TFA / DCM 1:1 (RT, 2h) + N NH2 HO N n H 3C N N O N NH OCH3 O HO TMC OH NH m 2 NMP, NaOHaq, ClCH2COOH NH2-PEG-8HA (RT, 3h) + N CM-TMC, EDC, NHS HO n H3 C (RT, 120h) O R1 R3 O n H3 C OCH3 O CM-TMC OH OCH 3 O R2 CM-TMC-g-NH-PEG-8HA R1= -OH, -OCH3, -OCH2COOH, -OCH2CO-NH NH O + N N n R2= -NHCOCH3, -NH(CH3)2, -N (CH3)3 OH N N R3= -OH, -CH3 NH2 Figure 1: Reaction scheme for the synthesis of CM25-TMC35-g-NH-PEG-8HA. In addition, NH2-PEG-8HA was obtained at high purity, as shown by 1H NMR spectroscopy (fig. 2C), TLC analysis and MALDI-TOF spectroscopy (data not shown). NH2-PEG-8HA was water-soluble at concentrations even above 10 mg/mL, in contrast to the unmodified 8HA. In a next step, we synthesized a CM-TMC polymer with a degree of trimethylation (%DTM) of 33.3% and carboxymethylation (%DCM) of 23.2%, as reported previously (abbreviated CM25-TMC35; see figure 2C; Heuking et al., 2009b). 122 A B C D Figure 2: 1H NMR spectra of A) 9-benzyl-2-chloro-8-hydroxyadenine (8HA, DMSO-d6), B) Boc-PEG-NH-8HA (CD3CN-d3) C) CM25-TMC35 and D) CM25-TMC35-g-NH-PEG-8HA (both in D2O-d2 at 80 °C). Finally, NH2-PEG-8HA was grafted to CM25-TMC35 by using EDC/NHS condensing agents as mentioned above (Heuking et al., 2009b). For the quantification of the degree of grafting (%DG), we firstly analysed using 1H NMR spectroscopy (Fig. 2D), but were only able to observe the PEG backbone of the finalized product at around 3.6 ppm. This phenomenon can be explained by the very low grafting ratio applied (< 3%), which makes it difficult to detect any aromatic peaks between 7 and 8 ppm. As alternative (orthogonal) method, we performed UV/VIS spectroscopy analysis (at λmax = 260 nm) of CM25-TMC35-g-NH-PEG-8HA (data not shown). Chan et al. (2007) as well as Mansuri et 123 al. (2006) similarly analysed their chitosan-folate conjugates. Following this method, we quantified a %DG of about 2.6%. Interestingly, after grafting the physical appearance changed to a yellowish color, probably due to the presence of the π-electrons of the aromatic ring system of 8HA in CM25-TMC35-g-NH-PEG-8HA (fig 3). In addition, SECMALLS measurements showed a unimodal distribution of molecular weight (MW) in the eluogram (data not presented), together with an increase in molecular weight (MW; table 1). Similar MW shifts were observed when PEG was grafted onto TMC polymers (Mao et al., 2005). Table 1: Aqueous solubility (SOL.), appearance of solution (AOS), molecular weight (MW), particle size, ζ potential (ZP), polydispersity index (PDI) and loading efficiency (LE) of chitosan-based DNA preparations used in this study. Chitosan SOLa AOSb derivative CM25-TMC35 ++ Trans- MW Size ZP (g/mol) (nm)a (mV)a 98,330 396.3 ± 17.2 ± 55.8 3.3 410.2 ± 19.5 ± 97.9 1.6 287.7 ± 16.5 ± 20.6 4.2 lucent CM25-TMC35-g- ++ Yellowish 273,800 NH-PEG-8HA LMC ++ Translucent aanalyses <10,000c PDIa LE (%)a 0.451 ± 92.2 ± 0.055 1.6 0.576 ± 89.4 ± 0.039 3.8 0.266 ± 99.3 ± 0.040 1.7 were performed in triplicates; bsee figure 3; cnot analysed by SEC-MALLS. Furthermore, we analyzed the co-polymer via FTIR spectroscopy (fig. 4D). Hereby, the PEG-grafting was ascertained considering newly introduced bands at 842 cm-1, 952 cm-1 and 2881 cm-1 (Jeong et al., 2008). The absorption band at 1606 cm-1 (C=O asymmetric 124 stretch of COO- anion) was altered to 1641 cm-1 (C=O stretch of amide), which indicates the formation of an amide bond (Prabaharan et al., 2007; Prabaharan and Gong, 2008). Further subtle differences can be noted in the fingerprint area at 697 cm-1, 770 cm-1 and 908 cm-1, which are assigned to the 8HA moiety (fig. 4C). Figure 3: Appearance of CM25-TMC35 (19.9 mg/mL, left) and CM25-TMC35-g-NH-PEG8HA (24.4 mg/mL, right) at equimolar concentrations. A B C D E Figure 4: FTIR spectra of A) NH2-PEG-8HA, B) Boc-NH-PEG-NH2, C) 8HA, D) CM25-TMC35g-NH-PEG-8HA and E) CM25-TMC35. 125 Taking all results together, the TLR-7 agonistic moiety 9-benzyl-8-hydroxyadenine was successfully grafted through a PEG spacer to the CM25-TMC35 chitosan derivative, yielding the water-soluble CM25-TMC35-g-NH-PEG-8HA co-polymer. 3.2 Characterization of CM25-TMC35-g-NH-PEG-8HA pGFP NP The novel co-polymer was used to formulate NP by complex coacervation with a plasmid DNA encoding for GFP (termed pGFP), employed as a model plasmid DNA (pDNA, 5,500 kbp) of medium size. It can be assumed that the application of prevalent, similar-sized DNA vaccines does not yield NP of too dissimilar physico-chemical properties. In our hands, pGFP NP formulations, either with CM25-TMC35 or CM25-TMC35-g-NH-PEG-8HA, resulted in particles of a size of about 400 nm and positive surface charge of 15-20 mV (table 1). The morphology of CM25-TMC35-g-NH-PEG-8HA pGFP NPs consisted mainly of heterogenous rod-like structures (figure 5A) and was not different from CM25-TMC35 pGFP NP (figure 5B) in terms of size and shape. 1000 nm A 1000 nm B Figure 5: TEM pictures of CM25-TMC35-g-NH-PEG-8HA pGFP NP (A) and CM25-TMC35 pGFP NP (B; both with a N/P ratio of 3:1). Horizontal bar indicates 1000 nm. 126 Rather polydisperse size distributions of polymeric chitosan pDNA NP were already noticed by others (Lee et al., 2008; Erbacher et al., 1998), and was in line with polydispersity indices (PDI) determined in our study (table 1). It was noticeable that diameters of NP studied by TEM were smaller than those found by Photon Correlation Spectroscopy (PCS), which might be explained by the fact that PCS is measuring the NP size in the hydrated state in contrast to the dried state during TEM analysis (Lee et al., 2008). Furthermore, we studied the capacity of CM25-TMC35-g-NH-PEG-8HA NP to release pDNA and applied a different pDNA NP system based on low molecular weight chitosan (LMC; see properties in table 1) for comparison. LMC pDNA NP, as well as LMC pDNA polyplexes were shown to release DNA easier and to transfect cells more efficiently, which was probably due to less pronounced electrostatic interactions between negatively charged pDNA and positively charged chitosan oligomer at acidic pH (KöpingHoggård et al., 2004; Strand et al., 2010). Ladder pGFP CO NP LMC NP 1 day Ladder pGFP CO NP LMC NP 1 week CO NP LMC NP * Figure 6: pGFP release study of CM25-TMC35-g-NH-PEG-8HA (CO) as well as LMC pGFP NP after one day and one week via electrophoretic mobility analysis. *Centrifuged NP of release samples were re-suspended by gently vortexing and used as controls. 127 As shown in figure 6, both LMC- and CM25-TMC35-g-NH-PEG-8HA-based carrier systems did not release significant amounts of pGFP in PBS medium at 37°C after one day and one week. However, when NP were challenged with anionic heparin (10-fold excess relative to positive charges of amines), only LMC pGFP NP were able to partially release plasmid DNA in supercoiled form, which indicates that the physical integrity of pGFP was not altered during NP preparation. Similar observations were reported by Köping-Hoggård et al. (2004) for LMC pDNA polyplexes. We can therefore assume that relatively stable CM25-TMC35-g-NH-PEG-8HA pGFP NP were formed owing to permanent positive trimethylamine charges in the co-polymer backbone. In addition, experiments with agarose gel electrophoresis demonstrated that LMC and CM25-TMC35-g-NH-PEG-8HA pGFP NP were able to protect pGFP against enzymatic degradation by DNase I (data not shown). Ladder pGFP pGFP CO NP CO NP + - + LMC NP LMC NP OC SC Heparin - - - + Figure 7: Anionic challenge of pGFP incorporating CO NP (CO, CM25-TMC35-g-NH-PEG8HA; N/P of 3:1) as well as LMC pGFP NP (N/P of 10:1) were exposed to heparin for 2h at room temperature followed by electrophoretic mobility analysis. 128 Besides, pGFP NP of the non-functionalized polymer, CM25-TMC35, demonstrated similar carrier properties in gel experiments as CM25-TMC35-g-NH-PEG-8HA (data not presented). 3.3 pGFP transfection After physico-chemical characterization of CM25-TMC35-g-NH-PEG-8HA pGFP NP, we evaluated their transfection efficiency in A549 cells and differentiated THP-1 macrophage-like (mTHP-1) cells. For comparison purposes, we included also the study of LMC- and TransIT-LT1 (a commercially available transfection reagent)-mediated pGFP transfection. All three carrier systems had the ability to transfect A549 cells with the ranking of TransIT-LT1 > LMC > CM25-TMC35-g-NH-PEG-8HA (figure 8 and figure 9). In more detail, application of TransIT-LT1 resulted at all time points (from day two until day six) in a significantly higher protein expression than LMC and CM25-TMC35-g-NHPEG-8HA (p<0.05). LMC was more efficient than CM25-TMC35-g-NH-PEG-8HA in transfecting A549 cells, which might be explained by its easier dissociation in a strong ionic environment (figure 7), as shown by the challenge incubation with heparin and recent reports (Köping-Hoggård et al. 2003; Strand et al., 2010). However, the difference between these pGFP delivery systems was not significant. CM25-TMC35 pGFP transfection was not different in extent from CM25-TMC35-g-NH-PEG-8HA mediated transfection (data not shown). It is worth mentioning that all chitosan-based delivery systems initiated a later onset of GFP expression when compared to TransIT-LT1 transfection. A similar tendency was already noted by Csaba et al. (2009). 129 25,0 * * 20,0 * GFP+ cells [%] * * 15,0 10,0 5,0 0,0 d2 d3 d4 d5 d6 Figure 8: In vitro GFP transfection efficiency in A549 cells of LMC (red), TransIT-LT1 transfection reagent (blue) and CM25-TMC35-g-NH-PEG-8HA (green) pGFP carrier systems. Statistical differences are denoted with * (p<0.05) for TransIT-LT1 compared to LMC and CM25-TMC35-g-NH-PEG-8HA pGFP transfection, respectively. Regarding the GFP transfection of mTHP-1 cells, the amount of GFP-positive cells was (from day two until day six) very low (below 2%, data not presented) for all applied formulations. Similar findings were already published by Schnoor et al. (2009), concluding that mTHP-1 cells are difficult to transfect by common non-viral gene delivery systems. In addition, light microscopy pictures of A549 cells and mTHP-1 cells after incubation were taken for all formulation groups and no toxic effects were observed in comparison to 0.02% sodium lauryl sulfate treatment as control (pictures not shown). Thus, we can assume that cytotoxicity of the CM25-TMC35-g-NH-PEG-8HA co-polymer does not play a major role. 130 CM25-TMC35-g-NH-PEG-8HA TransIT-LT1 LMC pGFP alone Figure 9: Fluorescence microscopy pictures (5x magnification) after six days of transfection with CM25-TMC35-g-NH-PEG-8HA, LMC, TransIT-LT1 pGFP carrier systems and pGFP alone as control. 3.4 IL-12p40 and IL-8 release from human THP-1 macrophages In order to analyse the immunogenicity of the novel pDNA carrier system functionalized with the 8HA moiety targeting TLR-7, we analysed at first the in vitro secretion of the T helper cells type 1 (Th-1) cytokine IL-12p40, which is strongly related to TLR-7 agonistic activity (Hemmi et al., 2002). In more detail, we selected the human macrophage-like cell line (mTHP-1) as cell culture model, because we (Adam-Malpel et al., unpublished observation) and others (Gantier et al., 2008; Yi et al., 2009) reported that THP-1 cells express the TLR-7. 131 In addition, mTHP-1 cells were shown to produce high amounts of the IL-12p40 cytokine (Feng et al., 2004). Furthermore, Salio et al. (2007) demonstrated that IFN-γ, a further Th-1 associated cytokine, is secreted from THP-1 cells after exposure to TLR-7 agonists (R-837 and R-848). By application of this in vitro model, we found a relatively weak (range of pg/mL concentrations), but still detectable immune response to our (co)polymers and pGFP containing NP (figure 10 and figure 11). At first, we observed that PEG coupling to the C-2 position of 8HA significantly enhanced the IL-12p40 stimulatory capacity (NH2-PEG-8HA: 37.7 ± 5.3 pg/mL; p<0.05). Successive grafting of NH2-PEG-8HA to CM25-TMC35 increased the IL-12p40 related immunogenicity (p<0.05) of the chitosan derivative to 17.7 ± 5.4 pg/mL (CM25-TMC35g-NH-PEG-8HA), although at this level no significance was found. Interestingly, the positive control and well-known TLR-7 agonist imiquimod induced the highest IL-12p40 secretion (147.8 ± 3.5 pg/mL), which was around four-fold higher than those triggered by NH2-PEG-8HA. In line with our further study, functionalization of pGFP NP with the TLR-7 agonistic moiety (9-benzyl-8-hydroxyadenine) caused a significant (p<0.05) increase in IL-12p40 secretion (CM25-TMC35 pGFP NP: 15.8 ± 1.0 pg/mL; CM25-TMC35-g-PEG-8HA: 34.0 ± 2.2 pg/mL). In addition, the plasmid pGFP alone caused also a relatively high IL-12p40 production (26.7 ± 0.3 pg/mL), which can be explained by its CpG motifs acting as TLR-9 agonist. 132 180,0 160,0 * IL-12p40 [pg/ml] 140,0 120,0 100,0 * 80,0 * 60,0 * 40,0 NS ND 20,0 0,0 Medium control 8HA NH2-PEG8HA CM25TMC35 Conjugate Imiquimod Figure 10: IL-12p40 release from mTHP-1 cells owing to polymer exposure (8HA, 2chloro-9-benzyl-8-hydroxyadenine; conjugate, CM25-TMC35-g-NH-PEG-8HA). Detection limit was 15,6 pg/mL and is marked with the horizontal bar (ND, not detectable). Significance was controlled by one-way ANOVA by comparison to values obtained from 0.1% DMSO cell culture medium (unless indicated otherwise). Differences were considered significant for * (p<0.05); NS, not significant. Once pGFP was encapsulated in CM25-TMC35 NP, IL-12p40 levels dropped below the limit of detection, but could be regained byNH2-PEG-8HA functionalization (figure 11). Due to the fact that we observed only minor levels of IL-12p40, we extended our immunogenicity study and analysed for IL-8 secretions. Primarily, the chemokine IL-8 is involved in the attraction of leukocytes and their successive guidance to the mucosal site of infection (chemotaxis). 133 50,0 NS IL-12p40 [pg/ml] 40,0 30,0 * * * NS 20,0 10,0 ND 0,0 Medium control pGFP CM25-TMC35 pGFP NP Conjugate pGFP NP Figure 11: IL-12p40 release from mTHP-1 cells as a result of NP (N/P ratio 3:1) exposure (conjugate, CM25-TMC35-g-NH-PEG-8HA). Detection limit was 15.6 pg/mL, indicated by the horizontal bar (ND, not detectable). Significance was checked by oneway ANOVA by comparison to values obtained from 0.1% DMSO cell culture medium (unless indicated otherwise). Differences were considered significant for * (p<0.05); ns: not significant. In terms of vaccine adjuvanticity, Sin et al. (2000) investigated the role of IL-8 in vivo by co-injection of an IL-8 encoding pDNA with a pDNA vaccine encoding for Herpes simplex virus type 2 (HSV-2). After lethal HSV-2 challenge, they observed an enhanced antigenspecific Th1 CD4+ T-cell response, which was correlated to a complete survival of mice found up to 30 days post infection. In contrast, mice vaccinated with HSV-2 pDNA vaccine alone died within ten days. In our laboratory, different epithelial cells lines (A549, Caco-2 and 16HBE14o-) were found to secret IL-8 upon stimulation with the TLR-7 agonist imiquimod (Adam-Malpel et al., unpublished observation). 134 In analogy, we presumed that also IL-8 secretions can be elicited from mTHP-1 macrophages owing to TLR-7 activation by 8HA derivatives. Consequently, we analysed the supernatant of mTHP-1 cells after (co)-polymer and pGFP NP exposure for IL-8 secretion, which was found to be more pronounced than the concentrations found for IL-12p40 (range of ng/mL concentrations, figure 12 and 13). 25,0 * IL-8 [ng/ml] 20,0 * 15,0 * NS 10,0 * * * 5,0 * 0,0 Medium 8HA NH2-PEG8HA CM25TMC35 Conjugate Imiquimod Figure 12: IL-8 release from mTHP-1 cells owing to polymer exposure (8HA, 2-chloro-9benzyl-8-hydroxyadenine; conjugate, CM25-TMC35-g-NH-PEG-8HA). Detection limit was 7.8 pg/mL. Significance was checked by one-way ANOVA by comparison to values obtained from 0.1% DMSO cell culture medium (unless indicated otherwise). Differences were considered significant for * (p<0.05); ns: not significant. In contrast to IL-12p40 results, PEG chain attachment at the C-2 position of 8HA did not enhance the IL-8 stimulatory capacity of NH2-PEG-8HA, which was slightly weaker than the one of 8HA (not significant). 135 Related to that, Weterings et al. (2009) noticed that modifications of the 2-chloro-9benzyl-8-hydroxyadenine molecule at its C-2 position with different 2-azidoalkoxy chains entail a decrease of IL-12p40 secretions from murine dendritic cellsin dependence of chain length. On the other hand, Hirota et al. (2002) reported for a similar molecule, 2hydro-9-benzyl-8-hydroxyadenine, relative low levels of IFN-α secretion in vitro and in vivo, when compared to molecules with a C2-modifications (2-alkyloxy and 2alkylamino). Therefore, it may be concluded that modification at the C-2 position of 2chloro-9-benzyl-8-hydroxyadenine is important for immunological activity, but has to be carefully performed in view of its effects on structure/activity relationship (SAR). 30,0 IL-8 [ng/ml] 25,0 * * 20,0 15,0 10,0 * * pGFP CM25TMC35 pGFP NP 5,0 0,0 Medium Conjugate pGFP NP Figure 13: IL-8 release from mTHP-1 cells owing to NP (N/P ratio 3:1) exposure (conjugate, CM25-TMC35-g-NH-PEG-8HA). Detection limit was 7.8 pg/mL. Significance was checked by one-way ANOVA by comparison to values obtained from 0.1% DMSO cell culture medium (unless indicated otherwise). Differences were considered significant for * (p<0.05); ns: not significant. 136 Functionalization of CM25-TMC35with NH2-PEG-8HA significantly (p<0.05) enhanced IL8 secretions from mTHP-1 macrophages (CM25-TMC35: 2.86 ± 0.11 ng/mL versus CM25TMC35-g-NH-PEG-8HA: 10.06 ± 0.93 ng/mL). Imiquimod as a positive control induced highest IL-8 secretions (16.4 ± 1.2 ng/mL), which were around three times higher than those triggered by NH2-PEG-8HA. Considering the IL-8 related immunogenicity of pGFP NP formulations, a comparable tendancy to IL-12p40 secretions was noticed. Plasmid pGFP alone enabled a relatively high IL-8 production (8.81 ± 0.95 pg/mL), but once the pGFP was encapsulated into CM25-TMC35 pGFP NP a slight decrease was remarked (CM25-TMC35 pGFP NP: 6.77 ± 0.99 ng/mL, not significant). A similar trend regarding pGFP encapsulation and reduction of IL-8 secretion was already noted previously (Heuking et al., 2009b). Interestingly, functionalization of pGFP NP with the TLR-7 agonistic moiety (9-benzyl-8hydroxyadenine) gave rise to a significant (p<0.05) increase in IL-8 secretions (CM25TMC35-g-PEG-8HA: 17.96 ± 2.37 ng/mL), which can be related to a higher immunogenicty. In conclusion, results presented in this study clearly indicate the possibility of grafting a TLR-7 agonistic moiety through a PEG spacer to a water-soluble chitosan derivative. Subsequent aggregation with the plasmid pGFP resulted in nano-sized and positively charged NP, which were able to transfect alveolar A549 cells. Moreover, TLR-7 agonist functionalization was shown to increase significantly the IL-8 and IL-12 specific immunogenicity in mTHP-1 macrophages, when compared to unfunctionalized NP. Consequently, the novel CM25-TMC35-g-PEG-8HA carrier system merits further investigation towards its application for mucosal DNA vaccination. 137 References Bivas-Benita, M., van Meijgaarden, K.E., Franken, K.L.M.C., Junginger, H.E., Borchard, G., Ottenhoff, T.H.M. and Geluk, A. Pulmonary Delivery of chitosan-DNA nanoparticles enhances the immunigenicity of a DNA vaccine encoding HLAA*0201-restricted T-cell epitopes of Mycobacterium tuberculosis. Vaccine (2004) 22, 1609-1615. Chan, P., Kurisawa, M., Chung, J.E. and Yang, Y.Y. Synthesis and characterization of chitosan-g-poly(ethylene glycol)-folate as a non-viral carrier for tumor-targeted gene delivery. Biomaterials ( 2007) 28,540-549. Chuang, T.H. and Ulevitch, R.J. Cloning and characterization of a sub-family of human toll-like receptors: hTLR7, hTLR8 and hTLR9. Eur. Cytokine Netw. (2000) 11, 372-378. Csaba, N., Köping-Höggård, M. and Alonso, M.J. Ionically crosslinked chitosan/ tripolyphosphate nanoparticles for oligonucleotide and plasmid DNA delivery. Int. J. Pharm. (2009) 382, 205-214. Erbacher, P., Zou, S., Bettinger, T., Steffan, A.M. and Remy, J.S. Chitosan-based vector/DNA complexes for gene delivery: biophysical characteristics and transfection ability. Pharm. Res. (1998) 15, 1332-1339. Feng, Y.H., Zhu, Y.N., Liu, J., Ren, Y.X., Xu, J.Y., Yang, Y.F., Li, X.Y. and Zou J.P. Differential regulation of resveratrol on lipopolysaccharide-stimulated human macrophages with or without IFN-gamma pre-priming. Int. Immunopharmacol. (2004) 4, 713720. Gantier, M.P., Tong, S., Behlke, M.A., Xu, D., Phipps, S., Foster, P.S. and Williams, B.R. TLR7 is involved in sequence-specific sensing of single-stranded RNAs in human macrophages. J. Immunol. (2008) 180, 2117-2124. 138 Hemmi, H., Kaisho, T., Takeuchi, O., Sato, S., Sanjo, H., Hoshino, K., Horiuchi, T., Tomizawa, H., Takeda, K. and Akira, S. Small anti-viral compounds activate immune cells via the TLR7 MyD88-dependent signaling pathway. Nat. Immunol. (2002) 3, 196-200. Heuking, S., Iannitelli, A., Di Stefano, A. and Borchard, G. Toll-like receptor-2 agonist functionalized biopolymer for mucosal vaccination. Int. J. Pharm. (2009) 381, 97105. Heuking, S., Adam-Malpel, S., Sublet, E., Iannitelli, A., Stefano, A. and Borchard, G. Stimulation of human macrophages (THP-1) using Toll-like receptor-2 (TLR-2) agonist decorated nanocarriers. J. Drug Target. (2009) 17, 662-670. Hirota, K., Kazaoka, K., Niimoto, I., Kumihara, H., Sajiki, H., Isobe, Y., Takaku, H., Tobe, M., Ogita, H., Ogino, T., Ichii, S., Kurimoto, A. and Kawakami, H. Discovery of 8hydroxyadenines as a novel type of interferon inducer. J. Med. Chem. (2002)45, 5419-5422. Isobe, Y., Kurimoto, A., Tobe, M., Hashimoto, K., Nakamura, T., Norimura, K., Ogita, H. and Takaku, H. Synthesis and biological evaluation of novel 9-substituted-8hydroxyadenine derivatives as potent interferon inducers. J. Med. Chem. (2006) 49, 2088-2095. Jeong, Y.I., Kim, D.G., Jang, M.K. and Nah, J.W. Preparation and spectroscopic characterization of methoxy poly(ethylene glycol)-grafted water-soluble chitosan. Carbohydr. Res. (2008) 343, 282-289. Köping-Höggård, M., Mel'nikova, Y.S., Vårum, K.M., Lindman, B. and Artursson, P. Relationship between the physical shape and the efficiency of oligomeric chitosan as a gene delivery system in vitro and in vivo. J. Gene Med. (2003) 5, 130-141. 139 Köping-Höggård, M., Vårum, K.M., Issa, M., Danielsen, S., Christensen, B.E., Stokke, B.T. and Artursson, P. Improved chitosan-mediated gene delivery based on easily dissociated chitosan polyplexes of highly defined chitosan oligomers. Gene Ther. (2004) 11, 1441-1452. Lee, P.W., Peng, S.F., Su, C.J., Mi, F.L., Chen, H.L., Wei, M.C., Lin, H.J. and Sung, H.W. The use of biodegradable polymeric nanoparticles in combination with a low-pressure gene gun for transdermal DNA delivery. Biomaterials (2008) 29, 742-751. Mansouri, S., Cuie, Y., Winnik, F., Shi, Q., Lavigne, P., Benderdour, M., Beaumont, E. and Fernandes, J.C. Characterization of folate-chitosan-DNA nanoparticles for gene therapy. Biomaterials (2006) 27, 2060-2065. Mao, S., Shuai, X., Unger, F., Wittmar, M., Xie, X. and Kissel, T. Synthesis, characterization and cytotoxicity of poly(ethylene glycol)-graft-trimethyl chitosan block copolymers. Biomaterials (2005) 26, 6343-6356. Lee, J., Wu, C.C., Lee, K.J., Chuang, T.H., Katakura, K., Liu, Y.T., Chan, M., Tawatao, R., Chung, M., Shen, C., Cottam, H.B., Lai, M.M., Raz, E. and Carson, D.A., Activation of anti-hepatitis C virus responses via Toll-like receptor 7. Proc. Natl. Acad. Sci. USA (2006) 103, 1828-1833. O´Hagan, D.T., Singh, M. and Ulmer, J.B. Microparticle-based technology for vaccines. Methods (2006) 40, 10-19. Prabaharan, M., Reis, R.L. and Mano, J.F. Carboxymethyl chitosan-graft-phosphatidylethanolamine: Amphiphilic matrices for controlled drug delivery. React. Funct. Polym. (2007) 67, 43-52. Prabaharan, M. and Gong, S. Novel thiolated carboxymethyl chitosan-g-β-cyclodextrin as mucoadhesive hydrophobic drug delivery carriers. Carbohydr. Polym. (2008) 73, 117-125. 140 Sadik, C.D., Hunfeld, K.P., Bachmann, M., Kraiczy, P., Eberhardt, W., Brade, V, Pfeilschifter, J., and Mühl, H. Systematic analysis highlights the key role of TLR2/NF-κB/MAP kinase signalling for IL-8 induction by macrophage-like THP-1 cells under influence of Borrelia burgdorferi lysates. Int. J. Biochem. Cell Biol. (2008) 40, 2508-2521. Salio, M., Speak, A.O., Shepherd, D., Polzella, P., Illarionov, P.A., Veerapen, N., Besra, G.S., Platt, F.M. and Cerundolo, V. Modulation of human natural killer T cell ligands on TLR-mediated antigen-presenting cell activation. Proc. Natl. Acad. Sci. USA (2007) 104, 20490-20495. Schnoor, M., Buers, I., Sietmann, A., Brodde, M.F., Hofnagel, O., Robenek, H. and Lorkowski, S. Efficient non-viral transfection of THP-1 cells, J. Immunol. Methods (2009) 344, 109-215. Schlosser, E., Mueller, M., Fischer, S., Basta, S., Busch, D.H., Gander, B. and Groettrup, M. TLR ligands and antigen need to be coencapsulated into the same biodegradable microsphere for the generation of potent cytotoxic T lymphocyte responses. Vaccine (2008) 26, 1626-1637. Shendage, D.M., Fröhlich, R. and Haufe, G. Highly efficient stereoconservative amidation and deamidation of alpha-amino acids. Org. Lett. (2004) 6, 3675-3678. Sin, J., Kim, J.J., Pachuk, C., Satishchandran, C. and Weiner, D.B. DNA vaccines encoding interleukin-8 and RANTES enhance antigen-specific Th1-type CD4(+) T-cellmediated protective immunity against herpes simplex virus type 2 in vivo. J. Virol. (2000) 74, 11173-11180. Strand, S.P., Lelu, S., Reitan, N.K., de Lange Davies, C., Artursson, P. and Vårum, K.M. Molecular design of chitosan gene delivery systems with an optimized balance 141 between polyplex stability and polyplex unpacking. Biomaterials (2010) 31, 97587. Yi, J.Y., Jung, Y.J., Choi, S.S., Hwang, J. and Chung, E. Autophagy-mediated anti-tumoral activity of imiquimod in Caco-2 cells. Biochem. Biophys. Res. Commun. (2009) 386, 455-458. 142 Part III In vitro and in vivo evaluation of TLR-agonist functionalized nanoparticles for pulmonary DNA vaccination 143 Chapter 6 Fate of TLR-2 agonist functionalized pDNA nanocarriers upon deposition at the bronchial epithelium in vitro S. Heuking1,2,3, B. Rothen-Rutishauser3, P. Gehr3 and G. Borchard1,2 To be submitted 1School of Pharmaceutical Sciences, University of Geneva, Switzerland 2Centre Pharmapeptides, Archamps, France 3Institute of Anatomy, University of Bern, Switzerland 144 Abstract A TLR-2 agonist functionalized pDNA nanoparticle (NP) system for potential pulmonary DNA vaccination was studied by using a three-dimensional (3D) cell model of the human lung barrier. pDNA loaded NP were administered via microsprayer onto the 3D cell culture model and uptake of NP by epithelial and immune cells (blood monocyte-derived dendritic cells (MDDC) and macrophages (MDM)) was visualized by confocal laser scanning microscopy (CLSM). We were able to detect pDNA NP transfer to MDDC located at the basolateral side of the epithelium. Although no significant difference in uptake pattern was observed for TLR-2 agonist modified and unmodified NP systems studied, ELISA of IL-8 and TNF-α demonstrated clearly that TLR-2 agonist functionalization induces a higher immune response with the ranking of CM25-TMC35-g-PEG-Pam3Cys pGFP NP > CM25-TMC35 pGFP NP > unloaded CM25-TMC35 NP. Consequently, the novel TLR-2 agonist functionalized DNA carrier merits further investigation as novel material for DNA vaccination. 1. Introduction In general, plasmid DNA (pDNA) vaccines consist of a bacterial plasmid vector, which contains the genetic information encoding for one or more antigenic protein(s). Plasmid DNA vaccines are usually produced in bacteria (e.g., Escherichia coli), purified and injected into the host (Huygen, 2005). When compared to gene therapy, vaccination using pDNA is thought to be effective already at relatively low levels of gene expression achieved. Today, the present strategy for the formulation of pDNA vaccines is to include highly purified synthetic adjuvants, which are able to activate distinct parts of the immune system, augmenting the vaccine´s immunogenicity. In terms of effective 145 vaccination, the adjuvant should be encapsulated together with the vaccine within the same delivery vector (O´Hagan et al., 2006). In order to address this necessity, we recently synthesized a novel copolymer, CM-TMCg-PEG-Pam3Cys, based on a chitosan polymer (Heuking et al., 2009a). To a new chitosan derivative, 6-0-carboxymethyl-N,N,N-trimethylchitosan (CM-TMC), the Toll-like receptor-2 (TLR-2) agonist, Pam3Cys, an adjuvant activating the innate immune system, was grafted through a polyethylene glycol (PEG) spacer. In a second step, Pam3Cys functionalized nanoparticles (NP) were prepared by aggregation of CM-TMC-g-PEGPam3Cys with pDNA expressing the green fluorescence protein (GFP) (Heuking et al., 2009b). Regarding the immunogenicity of the new carrier system, we observed that TLR-2 agonist functionalized pDNA nanocarriers induced IL-8 secretion from differentiated THP-1 human macrophages, which were increased by 10-fold compared to non-functionalized carriers (Heuking et al., 2009b). Aerolization deposition of vaccines is regarded as a promising route of immunization (Bivas-Benita et al., 2005) owing to several clinical trials with measles vaccines (Dilraj et al., 2000; Bennett et al., 2002), one of which in clinical phase II/III (Simon et al., 2010). It is generally assumed that mimicking the natural way of infection by applying vaccines to the respiratory tract represents an auspicious strategy for the prevention of lung infections (e.g., influenza, measles and tuberculosis). Further advantages are: i) delivery of vaccines into the respiratory tract elicits the secretion of local antibodies (IgA), which in turn are capable of crossing epithelia and preventing further entrance of pathogens (Brandtzaeg, 2007); ii) the particular non-invasive nature of pulmonary antigen delivery circumvents the common use of needles, which are the major cause for unsafe injections especially in developing countries (Miller et al., 1998); 146 iii) use of pulmonary dry powder vaccines may circumvent the common imperative of an intact cold chain for vaccine storage; iv) no specially trained medical personnel is required for the administration of vaccines by inhalers. Next to these benefits, pulmonary delivery of pDNA vaccines in nanoparticulate form gave rise to immune responses in vivo superior to intramuscular injection (Bivas-Benita et al., 2004; Bivas-Benita et al., 2009). Considering the above, we intended to evaluate our TLR-2 agonist functionalized carrier system further for pulmonary pDNA vaccination. Hereby, next to animal and ex vivo models, a three-dimensional (3D) cell model of the human lung barrier tract was shown to be a valuable tool for the study of the human airway system (Rothen-Rutishauser et al., 2005; Rothen-Rutishauser et al., 2008). This cell culture model allows in particular the study of particle uptake by immune cells, i.e. human blood monocyte-derived dendritic cells (MDDC) and macrophages. We administered pDNA loaded nanoparticles via microsprayer onto this 3D cell culture model and examined the uptake of NP by epithelial and immune cells. In addition, we monitored changes in immune responses after NP exposure by measuring secretion of IL-8 and TNF-α. 2. Materials and methods 2.1 Triple cell culture The triple cell culture system was set up as previously published (Rothen-Rutishauser et al., 2005; Blank et al., 2007). Briefly, bronchial 16HBe14o- (HBE) cells (passage numbers 2.45–2.80) were maintained in MEM 1x, with Earle's Salts, 25 mM HEPES, without LGlutamine (Gibco BRL Life Technologies Invitrogen AG, Basel, Switzerland) supplemented with 1% L-Glutamine (LabForce AG, Nunningen, Switzerland), 1% 147 penicillin/streptomycin (Gibco BRL, Switzerland), and 10% fetal calf serum (PAA Laboratories, Lucerna-Chem AG, Lucerne, Switzerland) on transparent BD Falcon cell culture inserts (pores with 3.0 µm diameter, PET membranes for 6-well plates; BD Biosciences) treated with fibronectin coating solution containing bovine serum albumin, 0.1 mg/ml (Sigma, Fluka Chemie GmbH, Buchs, Switzerland) with 1% bovine collagen, Type I (BD Biosciences, Basel, Switzerland) and 1% human fibronectin (BD Biosciences) in LHC Basal Medium (Lucerna Chemie AG, Switzerland). MDM and MDDC were derived from human blood monocytes as already described (Rothen-Rutishauser et al., 2005). Briefly, peripheral blood monocytes were isolated from buffy coats (Blood Donation Service, Bern, Switzerland) and cultured in the same medium as used for the epithelial cells except for the supplementation of 5% human serum (Blood Donation Service) instead of 10% fetal calf serum. Regarding the generation of MDDC, monocytes were cultured for seven days in medium supplemented with 34 ng/ml of IL-4 (Sigma, Fluka Chemie GmbH, Switzerland) and with 50 ng/ml of GM-CSF (R&D Systems, Oxon, UK), whereas MDM were obtained without any additional supplements. Epithelial cells were then cultured for seven days before MDM were added at the apical and MDDC at the basolateral side of the epithelial monolayer. Next, the triple cell co-cultures were kept overnight in medium supplemented with 1% L-Glutamine, 1% penicillin/streptomycin, and 5% heat-inactivated (pooled) human serum (= full medium) at 37°C in a 5% CO2 humidified atmosphere. The following day the medium was removed completely from the apical chamber while 1.2 ml of medium were kept in the basolateral well to feed the cultures from the basal side of the insert. The cells were exposed to air for 24 h at 37°C in a 5% CO2 humidified atmosphere. 148 2.2 NP preparation and characterization Synthesis of 6-0-carboxymethyl-N,N,N-trimethylchitosan with a degree of carboxymethylation of 23.2% and degree of trimethylation of 33% (abbreviated CM25TMC35) and subsequent synthesis of CM25-TMC35-g-PEG-Pam3Cys was performed as described earlier (Heuking et al., 2009b). In addition to our previous publication, we analyzed the molecular weight of the chitosan derivative by SEC-MALLS. Hereby, measurements were performed using a TOSOH TSK Gel G3000PWXL-CP size exclusion column (TOSOH Bioscience, Germany) with 0.2 M sodium acetate/0.3 M acetic acid (pH 4.4) as eluent (0.3 mL/min). A Waters Alliance HPLC system coupled to a differential refractive index (RI) detector (Schambeck, Germany) and a light scattering detector (MiniDawn, Wyatt, USA) was used for sample handling. Pullan standards ranging from 47,000 g/mol to 710,000 g/mol (PSS, Germany) were used for calibration. Next, in order to fluorescently label NP, we selected an Alexa Fluor 488 sulfodichlorophenol dye (A30052, Invitrogen, France). The Alexa Fluor 488 dye was coupled to free amine moieties of CM25-TMC35 and CM25-TMC35-g-PEG-Pam3Cys (at 1% molar ratio of sugar units), respectively, according to manufacturer´s recommendation. Emission spectra (excitation at λ = 495 nm) of labeled chitosan derivative were taken using a FluoroMax spectrometer (Spex, Switzerland) and no quenching was seen. Successively, nanoparticles were formed according to our published method (Heuking et al., 2009b). Briefly, CM25-TMC35-g-PEG-Pam3Cys (at 3.10 mg/mL, average molecular weight per sugar unit of 290.8 Da, 3.6 μmol/mL -N+(CH3)3, N) or CM25-TMC35 (at 2.21 mg/mL, average molecular weight per sugar unit of 207.1 Da, 3.6 μmol/mL -N+(CH3)3, N) were dissolved in Miniversol water. Separately, the plasmid pIRES-hrGFP II (abbreviated pGFP; 1 μg of pGFP being equal to 3.1 nmol of phosphate groups, P) was dissolved in 5 mM aqueous sodium sulfate solution at a concentration of 390 μg/mL in order to yield 149 N/P ratios of 3:1. Both solutions were heated for 5 minutes at 55°C. In the following, the polymer containing solution was slowly added (approximately 1 drop per second) to the pGFP solution and vortexed at low speed for 30 seconds. Attention was paid to keep the final volume below or at 400 μL in order to obtain a narrow particle size distribution. Moreover, "empty" CM25-TMC35 nanoparticles (control group) were prepared with the help of the cross-linking agent pentasodium tripolyphosphate (TPP) at a molar ratio of 3:1 (positive amines N+(CH3)3 to TPP molecules) at room temperature via dropwise addition of TPP solution (0.58 mg/mL) to slowly vortexed polymer solution. The final volume was similarly kept at ≤ 400 μL. All particle formulations were kept at room temperature for at least one hour prior to further use. After preparation, hydrodynamic diameters of labelled NP were measured by Photon Correlation Spectroscopy (ZetaSizer 3000 HS, Malvern, Switzerland). For each set of measurements, 400 μL of nanoparticle suspensions were diluted in PBS (pH 7.4) to a total of 1.4 mL. Size distribution data were obtained by the number-averaged value of three independent groups of ten measurements. In addition, the zeta potential was measured at least in triplicate via micro-electrophoresis by using an aqueous dip cell (ZetaSizer 3000 HS, Malvern, Switzerland). The loading efficiency of NP was determined by centrifugation of 400 μL of nanoparticle suspension at 16,000 x g for 30 min (Centrifuge 5417C/R, Eppendorf, Germany) and quantification of the unloaded pGFP in the supernatant by PicoGreen assay (Quant-iT PicoGreen, Invitrogen, France) according to the manufacturer's specifications. Fluorescence was measured with a FluoroMax spectrometer (Spex, Switzerland) at excitation and emission wavelengths of 480 and 522 nm, respectively. 2.5 Exposure For exposure, NP suspensions were diluted 1:4 in plain cell culture medium in order to 150 yield 4 μg of pGFP in 150 μL medium. After exposure of cell cultures to air for 24 h, for each exposure, the respective insert was taken out and placed shortly into another 6well plate (filled with 1.2 mL of full medium). The diluted NP suspensions (150 μL per 6well plate) were then sprayed on the apical surface of the co-culture by using a MicroSprayer (model IA-1C, 10" long 0.64-mm tube, PennCentury, USA). After exposure, the insert was placed back into its original position within the 6-well plate, cultured for another 24h and fixated for microscopic analysis. 2.6 Cell labeling and CLSM Co-cultures were fixed and stained as previously reported (Rothen-Rutishauser et al., 2005). Antibodies were diluted in PBS as follows: mouse anti human CD14 1:20 (Clone UCHM-1, C 7673, Sigma, Switzerland), mouse anti-human CD86 1:20 (Clone HB15e, 36931A, PharMingen, BD Biosciences, Switzerland), goat anti-mouse cyanine 5 1:50 (AP124S, Chemicon, Switzerland), DAPI at 1 μg/mL (Molecular Probes, Switzerland) and rhodamine phalloidin 1:50 (R-415; Molecular Probes, Switzerland). A Zeiss LSM 510 Meta with an inverted Zeiss microscope (Axiovert 200M, lasers: HeNe 633 nm, HeNe 543 nm, and Ar 488 nm; Carl Zeiss AG, Switzerland) was used. Image processing and visualization was performed using IMARIS (Bitplane AG, Switzerland), a three-dimensional multi-channel image processing software for CLSM images. 2.7 ELISA of IL-8 and TNF-α Following 24h of particle incubation, the cell culture media of the apical chamber of triple cell co-cultures were collected separately and stored at −80°C until further use. After centrifugation, TNF-α and IL-8 concentrations were quantified by a DuoSet ELISA Development kit (DY 210 and DY 208, R&D Systems, UK) performed according to the 151 manufacturer's recommendations. The assay was performed in triplicates. An aliquot of 100 µl of the diluted capture antibody (mouse anti-human TNF-α or IL-8, concentration of 4 µg/ml PBS) was incubated overnight in a 96-well immunoassay plate (NUNC, MaxiSorp, Switzerland) at room temperature. Differing from the producer's protocol, the plate was blocked with PBS supplemented with 1 % bovine serum albumin (BSA) and 0.05 % NaN3 for 1 h at room temperature. After washing with buffer, supernatants from samples and the standards (0–10 ng/mL of recombinant human TNF-α and 0–2 ng/mL of recombinant human IL-8) were pipetted into the wells and incubated at room temperature for 2 h. After washing, the detection antibody (biotinylated goat antihuman TNF-α or IL-8, respectively) diluted in reagent diluent was added. The plate was covered with an adhesive strip and incubated again for 2 h. Washing was followed by the addition of horseradish peroxidase-conjugated streptavidin to the plates and incubation for 20 min at room temperature in the dark. Finally, the substrate solution (tetramethylbenzidine/H2O2; DY 999, R&D Systems, UK) was added. After 20 min in darkness, the color development was stopped by adding 50 μL of 1 M H2SO4 and the plate was put on a shaker (differing from the protocol) for 2 minutes. The absorbance was then read at 450 nm using an ELISA reader (Benchmark Plus Microplate Spectrophotometer, Switzerland). The concentration of the cytokine or chemokine was determined by comparing the absorbance of the samples with standard samples using log log regressions. 2.8 Statistics Data from ELISA experiments were expressed as the mean ± standard error of the mean and were compared by one-way ANOVA using Origin 7.01 software. Differences were considered significant at p<0.05. 152 3. Results and discussion 3.1 Plasmid DNA NP enter human macrophages and dendritic cells Regarding vaccination, uptake of antigenic materials into antigen-presenting cells (APC) is the very first and mandatory step towards the induction of a specific immune response. In general, there are three types of APC: dendritic cells (DC), macrophages (M) and B-cells. Among these three cell types, DC play the most prominent role. In contrast to lymphocytes, DC have during evolution maintained many of the so-called pattern recognition receptors (PRR) and thus possess the ability of sensing invasion of bacterial and viral pathogens (Lambrecht et al., 2001; Foged et al., 2002). After encountering such antigens, immature DC are activated, initiate antigen internalization and transform into a mature state with high T cell stimulating capability. Thereafter, mature DC can migrate to local lymph nodes and present antigen(s) to resident T cells (Randall, 2010). After successful antigen presentation, T cells become activated and migrate back to the site of antigen exposure within the lung and eliminate infected cells. In that interplay, pulmonary DC were shown to be imperative for the maintenance of T cell activity as well as for a constant stimulation of T cells, even after their migration to infected lung tissues (McGill et al., 2008). In view of pulmonary vaccination, human DC are difficult to study, because they are sparse and make up only a small percentage of the pulmonary cell population (Holt et al., 2005). In order to study the uptake of particulate matter into pulmonary DC, as well as to follow their interplay with macrophages and epithelial cells in vitro, a triple cell culture model of the airway barrier was developed over recent years (Rothen-Rutishauser et al., 2005). Within the scope of our study, we applied a potential NP carrier system for DNA vaccines onto mentioned triple cell culture model of the respiratory tract and analyzed by means of CLSM and ELISA of immunogenicity related cytokines (IL-8 and TNF-α). 153 In more detail, we involved three different categories of chitosan-based NP: 1) empty CM25-TMC35 NP, 2) pGFP-loaded CM25-TMC35 NP and 3) pGFP-loaded CM25-TMC35-gPEG-Pam3Cys NP. Properties of NP can be found in table 1 and reflect previous findings in our laboratory (Heuking et al., 2009b) Table 1: Characteristics of chitosan derivatives: molecular weight (MW) and NP: particle size, ζ potential (ZP), polydispersity index (PDI) and loading efficiency (LE) of chitosan-based DNA preparations used in this study. Formulation Empty CM25-TMC35 NP pGFP-loaded CM25-TMC35 NP pGFP-loaded CM25-TMC35-gPEG-Pam3Cys NP aanalyses PDIa MW Size ZP (g/mol) (nm)a (mV)a 98,330 378.8 ± 10.8 ± 0.341 ± 52.1 1.2 0.028 404.7 ± 17.5 ± 0.522 ± 92.5 ± 164.1 1.6 0.041 2.5 421.1 ± 15.8 ± 0.576 ± 89.4 ± 173.0 1.6 0.059 3.8 98,330 259,000 LE (%)a n/a were performed in triplicates; n/a, not applicable In the following, we sprayed these three different NP suspensions onto the described triple cell culture model by using a microsprayer device, which is commonly used for intratracheal administrations. This microsprayer creates a fine plume of aerosolized liquid (Bivas-Benita et al., 2005) and gives therefore a more realistic way of NP administration than the simple addition of NP suspensions into the cell culture medium. After exposure, we were able to visualize uptake of NP in all cell types of the co-culture system by using CLSM techniques. Regarding the overall assessment of NP capture into 154 the particular cell types, we were able to estimate the percentage of internalized NP with the help of XY- and XZ-projections as well as IMARIS reconstruction images. As a result, we found that MDM (at the apical side of the culture model) phagocytosed most of the NP (60-65%). MDDC located at the basolateral side were found to have internalized 1015% of NP, and epithelial cells (HBE) ingested only a minor percentage of NP of 5-10%. Moreover, the extent of NP uptake was irrespective of pGFP-loading or TLR-2 agonist functionalization, because all NP types gave similar percentages. In previous investigations involving virosomes (0.1 - 0.2 μm in size) and polystyrene particles (0.2 μm and 1.0 μm in size), similar uptake patterns were observed (Blank et al., 2007; Hofer et al., 2009). Empty CM25-TMC35 NP CM25-TMC35 pGFP NP Conjugate pGFP NP MDM MDM MDM 20 μm 20 μm 20 μm Figure 1: CLSM micrographs of phagocytosed NP (green) by MDM (blue). XY and XYprojections clearly indicate that NP are mostly taken up by MDM (lozenge). Extracellular NP are marked with an arrowhead. The horizontal bar represents 20 μm (Conjugate, CM25-TMC35-g-PEG-Pam3Cys). Considering different functions of each cell type in this triple in vitro model, MDM constitute clearly the first line of defence and are constantly exposed to the entry of 155 antigenic materials into the human lung. MDM have also the ability to inhibit virus growth and eliminate infected cells. Moreover, activated macrophages can produce antiviral factors, (e.g., TNF-α and IFN-α/β) and chemokines, which are able to activate additional cell types in the fight against infections (Murphy et al., 2004). Although MDM possess only a minor antigen-presenting capacity, a direct cross-talk by exchanging NP with MDDC was proposed (Blank et al., 2007). In line with our study, CLSM images of human CD14-positive MDM demonstrate that a pronounced phagocytosis of NP took place (lozenge-marked, figure 1). XY- and XZ-projections also allowed for the recognition of non-phagocytosed NP for comparative purposes (arrowheads, figure 1). Furthermore, we reconstructed the apical part of the co-culture by imaging software (figure 2), where NP internalization was detected in all three experimental groups. Secondly, considering the important function of DC as APC, we investigated the capturing of NP by MDDC (located in and beneath the epithelium). Generally, it was proposed that MDDC extend pseudopodia even in the absence of apical particles through the epithelium towards the luminal side (Blank et al., 2007). Once particles are deposited, MDDC can rapidly induce internalization (within minutes) followed by transport to the apical side of the epithelium (Blank et al., 2007). In our study, we observed clearly the uptake of all chitosan-based pGFP NP into MDDC after 24h by CLSM (figure 3). 156 A B C Figure 2: Visualization of NP uptake in the apical part of the triple cell culture model (actin, red; macrophages, blue; nanoparticles, green), with A) empty CM25-TMC35 NP, B) CM25-TMC35 pGFP NP and C) CM25-TMC35-g-PEG-Pam3Cys pGFP NP. Lozenge marks indicate internalized NP into MDM; extracellular NP are marked with an arrowhead. White bar (lower left corner) represents a 20 μm scale. 157 In addition, software reconstruction of the basal part of the co-culture model was performed (figure 4). Empty CM25-TMC35 NP CM25-TMC35 pGFP NP Conjugate pGFP NP MDDC MDDC 20 μm MDDC 20 μm 20 μm Figure 3: CLSM micrographs of phagocytosed NP (green) by MDDC (blue). XY and XYprojections clearly indicate that NP are internalized by MDDC (lozenge). Horizontal bar represents 20 μm (Conjugate, CM25-TMC35-g-PEG-Pam3Cys). From these images it becomes clear that MDDC were capable of taking up all three types of chitosan-based NP. Interestingly, Blank et al. (2007) proposed different mechanisms of particle transport through the epithelium by MDDC: i) uptake of particles through cellular extensions of MDDC across the epithelium, ii) crossing of MDDC through the entire epithelium followed by particles uptake, iii) particle exchange between MDDC, iv) transfer of particles from MDM to MDDC via cell–cell contacts and v) transfer of particles through interactions of MDM with MDDC located in or at the basolateral side of the epithelium. 158 A B C Figure 4: Visualization of different NP in the basal compartment of triple cell culture model (actin, red; macrophages, blue; nanoparticles, green) with A) empty CM25-TMC35 NP, B) CM25-TMC35 pGFP NP and C) CM25-TMC35-g-PEG-Pam3Cys pGFP NP. Lozenge marks internalized NP into MDM; extracellular NP are marked with an arrowhead. White bar represents a 20 μm scale (lower left corner). 159 Although we were not able to reveal the exact way of migration of NP towards MDDC followed by their uptake, we found a certain percentage of NP (10-15%) internalized by MDDC after 24h of exposure. It is highly possible that during the exposure to NP, MDDC, but also MDM, were stimulated by our chitosan-based pGFP NP. We therefore analyzed for the secretion of two different immune mediators, IL-8 and TNF-α. 3.2 TLR-2 agonist functionalization of NP augments the immune response In order to investigate a potential higher immunogenicity of CM25-TMC35-g-PEGPam3Cys pGFP NP due to the inclusion of an adjuvant moiety, the TLR-2 agonist Pam3Cys, we studied the expression of IL-8 and TNF-α in the basal compartment of the co-culture system. In general, IL-8 has a role as an essential regulator for the recruitment of leukocytes and their successive trafficking to the mucosal site of infection. In our study, we remarked a significantly (p<0.05) higher release of IL-8 owing to the exposure of pGFP-loaded CM25-TMC35 and CM25-TMC35-g-PEG-Pam3Cys NP (9.21 ± 0.36 pg/mL and 13.72 ± 0.76 ng/mL, respectively), when compared to the use of medium alone (5.17 ± 0.54 ng/mL; figure 5). Hereby, CM25-TMC35-g-PEG-Pam3Cys pGFP NP elicited a significantly (p<0.05) higher IL-8 related immune response than CM25-TMC35 pGFP NP. Spohn et al. (2004) and Sadik et al. (2008) already described the IL-8 eliciting capacity of the Pam3Cys moiety on stably TLR-2 transfected HEK cells and differentiated THP-1 macrophages, respectively. Interestingly, unloaded CM25-TMC35 NP had a weak ability to trigger IL-8 levels (8.68 ± 1.06 ng/mL), although the difference was not significant in comparison to the control. An IL-8 inducing property of chitosan was already mentioned by Park et al. (2009). The general trend of this IL-8 ELISA goes in line with our previous report (Heuking et al., 2009b), in which we noted a ten-fold higher induction of IL-8 chemokine from differentiated human-like macrophages (THP-1) by TLR-2 agonist 160 functionalization (CM25-TMC35-g-PEG-Pam3Cys pGFP NP versus CM25-TMC35 pGFP NP). 20,0 * 18,0 16,0 * IL-8 [ng/ml] 14,0 12,0 NS * CM25-TMC35 NP CM25-TMC35 pGFP NP 10,0 8,0 6,0 4,0 2,0 0,0 Medium control Conjugate pGFP NP Figure 5: IL-8 release in the apical compartment from co-culture model due to exposure to empty CM25-TMC35 NP, CM25-TMC35 pGFP NP and Conjugate (CM25-TMC35-g-PEGPam3Cys) pGFP NP. Presented data are the mean ± standard error of the mean of three independent experiments. Differences were considered significant for * (p<0.05), in comparison to cells treated with culture medium; NS, not significant. As a second indicator for an immune response, we examined the release of TNF-α from the co-culture model. Generally speaking, TNF-α is involved in the regulation of apoptotic cell death and tumorigenesis, but its main role consists in the regulation of immune cells. In our study, we found in response to NP exposure TNF-α responses with the ranking of CM25-TMC35-g-PEG-Pam3Cys pGFP NP > CM-25TMC35 pGFP NP > unloaded CM25-TMC35 NP > medium control (figure 6). It appears that again the functionalization with the TLR-2 agonistic moiety Pam3Cys was able to increase 161 significantly (p<0.05) a TNF-α specific immune response (2.30 ± 0.23 ng/mL), when compared to unmodified CM25-TMC35 pGFP NP (1.62 ± 0.16 ng/mL) and control medium (0.84 ± 0.15 ng/mL). Schjetne et al. (2003) reported that the Pam3Cys moiety stimulates CD14-positive monocytes as well as immature DC in a TLR-2 specific manner to produce high levels of TNF-α (around 1.5 – 2.0 ng/mL), which were comparable to those induced by bacterial LPS. TNF-alpha [ng/m l] 4,0 * 3,0 * NS 2,0 NS 1,0 0,0 Medium control CM25-TMC35 NP CM25-TMC35 pGFP Conjugate pGFP NP NP Figure 6: TNF-α release in the apical compartment from co-culture model due to exposure of empty CM-25TMC35 NP, CM25-TMC35 pGFP NP and Conjugate (CM25TMC35-g-PEG-Pam3Cys) pGFP NP. Presented data are mean ± standard error of the mean of three independent experiments. Differences were considered significant for * (p< 0.05), in comparison to cells treated with culture medium (control); NS, not significant. Similarly to the IL-8 results, empty CM25-TMC35 NP were also able to trigger some release of TNF-α, although the difference was again not significant. Otterlei et al. (1994) demonstrated that chitosan (depending on its molecular weight and degree of 162 deacetylation) can induce TNF-α production from human monocytes in a CD14dependent manner. In conclusion, we were able to detect MDDC transferred pGFP NP being located at the abluminal side of the HBE epithelium by CLSM. Although no significant difference in uptake pattern was observed for all three NP systems studied, ELISA of IL-8 and TNF-α demonstrated clearly that TLR-2 agonist functionalization facilitates an overall higher immune response with the ranking of CM25-TMC35-g-PEG-Pam3Cys pGFP NP > CM25TMC35 pGFP NP > CM25-TMC35 NP. Hence, the novel TLR-2 agonist functionalized DNA carrier merits further investigation as novel material for DNA vaccination. Acknowledgments The authors would like to thank B. Tschirren, A. Stokes, D. Raemy, A. Lehmann, L. Müller and C. Brandenberger from the Institute of Anatomy in Bern for their technical support in cell culture and immune analyses. References Bennett, J.V., De Castro, F. J., Valdespino-Gomez, J.L., De Lourdes Garcia-Garcia, M., IslasRomero, R., Echaniz-Aviles, G., Jimenez-Corona, A. and Sepulveda-Amor, J. Aerosolized measles and measles-rubella vaccines induce better measles antibody booster responses than injected vaccines: randomized trials in Mexican schoolchildren. Bull. World Health. Organ. (2002) 80, 806–812. Bivas-Benita, M., van Meijgaarden, K.E., Franken, K.L.M.C., Junginger, H.E., Borchard, G., Ottenhoff, T.H.M. and Geluk, A. Pulmonary Delivery of chitosan-DNA nanoparticles enhances the immunogenicity of a DNA vaccine encoding HLAA*0201-restricted T-cell epitopes of Mycobacterium tuberculosis. Vaccine (2004) 163 22, 1609-1615. Bivas-Benita, M., Ottenhoff, T.H., Junginger, H.E. and Borchard, G. Pulmonary DNA vaccination: concepts, possibilities and perspectives. J. Control. Rel. (2005) 107, 1-29. Bivas-Benita, M., Zwier, R., Junginger, H.E. and Borchard, G. Non-invasive pulmonary aerosol delivery in mice by the endotracheal route. Eur. J. Pharm. Biopharm. (2005) 61, 214-218. Bivas-Benita, M., Lin, M.-Y., Bal, S., van Meijgaarden, K.E., Franken, K. L.M.C., Friggen, A.H., Junginger, H.E., Borchard, G., Klein, M.R. and Ottenhoff, T. H. M. Pulmonary vaccination with DNA encoding Mycobacterium tuberculosis latency antigen Rv1733c associated to PLGA-PEI nanoparticles enhances T cell responses in a DNA prime/protein boost vaccination regimen in mice. Vaccine (2009) 27, 40104017. Blank, F., Rothen-Rutishauser, B. and Gehr, P. Dendritic cells and macrophages form a transepithelial network against foreign particulate antigens. Am. J. Respir. Cell Mol. Biol. (2007) 36, 669-677. Brandtzaeg, P. Induction of secretory immunity and memory at mucosal surfaces. Vaccine. (2007) 25, 5467-84. Dilraj, A., Cutts, F.T., De Castro, J.F., Wheeler, J.G., Brown, D., Roth, C., Coovadia, H.M. and Bennett, J.V. Response to different measles vaccine strains given by aerosol and subcutaneous routes to schoolchildren: a randomised trial. Lancet (2000) 355, 798–803. 164 Foged, C., Sundblad, A. and Hovgaard, L. Targeting vaccines to dendritic cells. Pharm. Res. (2002) 19, 229-38. O´Hagan, D.T., Singh, M. and Ulmer, J.B. Microparticle-based technology for vaccines. Methods (2006) 40, 10-19. Heuking, S., Iannitelli, A., Di Stefano, A. and Borchard G. Toll-like receptor-2 agonist functionalized biopolymer for mucosal vaccination. Int. J. Pharm. (2009) 381, 97105. Heuking, S., Adam-Malpel, S., Sublet, E., Iannitelli, A., Stefano, A., Borchard, G. Stimulation of human macrophages (THP-1) using Toll-like receptor-2 (TLR-2) agonist decorated nanocarriers. J. Drug Target. (2009) 17, 662-70. Holt, P.G. Pulmonary dendritic cells in local immunity to inert and pathogenic antigens in the respiratory tract. Proc. Am. Thorac. Soc. (2005) 2, 116-120. Hofer, U., Lehmann, A.D., Waelti, E., Amacker, M., Gehr, P. and Rothen-Rutishauser B. Virosomes can enter cells by non-phagocytic mechanisms. J. Liposome Res. (2009) 19, 301-309. Huygen, K. Plasmid DNA vaccination. Microbes Infect. (2005) 7, 932-938. Lambrecht, B.N., Prins, J.B. and Hoogsteden, H.C. Lung dendritic cells and host immunity to infection. Eur. Respir. J. (2001) 18, 692-704. McGill, J., Van Rooijen, N. and Legge, K.L. Protective influenza-specific CD8 T cell responses require interactions with dendritic cells in the lungs. J. Exp. Med. (2008) 205, 1635–1646. Miller, M.A. and Pisani, E. The cost of unsafe injections, Bull. World Health Organ. 77 (1999) 808-811. Mühlfeld, C., Rothen-Rutishauser, B., Blank, F., Vanhecke, D., Ochs, M. and Gehr P. Interactions of nanoparticles with pulmonary structures and cellular responses. 165 Am. J. Physiol. Lung Cell Mol. Physiol. (2008) 294, 817-829. Murphy, E.A., Davis, J.M., Brown, A.S., Carmichael, M.D., Van Rooijen, N., Ghaffar, A., Mayer E.P. Role of lung macrophages on susceptibility to respiratory infection following short-term moderate exercise training. Am. J. Physiol. Regul. Integr. Comp. Physiol. (2004) 287, 1354-1358. Otterlei, M., Vårum, K.M., Ryan, L. and Espevik, T. Characterization of binding and TNFalpha-inducing ability of chitosans on monocytes: the involvement of CD14. Vaccine (1994) 12, 825-32. Park, C.J., Gabrielson, N.P., Pack, D.W., Jamison, R.D. and Johnson, A.J.W. The effect of chitosan on the migration of neutrophil-like HL60 cells mediated by IL-8. Biomaterials (2009) 30, 436-444. Randall, T.D., Pulmonary dendritic cells: thinking globally, acting locally. J. Exp. Med. (2010) 207, 451-454. Rothen-Rutishauser, B.M., Kiama, S.G. and Gehr P. A three-dimensional cellular model of the human respiratory tract to study the interaction with particles. Am. J. Respir. Cell Mol. Biol. (2005) 32, 281-289. Sadik, C.D., Hunfeld, K.-P., Bachmann, M., Kraiczy, P., Eberhardt, W., Brade, V, Pfeilschifter, J., and Mühl, H. Systematic analysis highlights the key role of TLR2/NF-κB/MAP kinase signaling for IL-8 induction by macrophage-like THP-1 cells under influence of Borrelia burgdorferi lysates. Int. J. Biochem. Cell Biol. (2008) 40, 2508-2521. Schjetne, K.W., Thompson, K.M., Nilsen, N., Flo, T.H., Fleckenstein, B., Iversen, J.G., Espevik, T. and Bogen B. Cutting edge: link between innate and adaptive immunity: Toll-like receptor 2 internalizes antigen for presentation to CD4+ T cells and could be an efficient vaccine target. J. Immunol. (2003) 171, 32-36. 166 Simon, J.K., Levine, M.M., Weniger, B.G., Restrepo, A.M.H. Mucosal immunization and needle-free injection devices. New Generation Vaccines (2010) 4th edition, 405414. Spohn, R., Buwitt-Beckmann, U., Brock, R., Jung, G., Ulmer, A.J., Wiesmüller, K.H. Synthetic lipopeptide adjuvants and Toll-like receptor 2-structure-activity relationships. Vaccine (2004) 22, 2494-2499. 167 Chapter 7 Preliminary in vivo immunogenicity of TLR-2 agonist decorated chitosan nanoparticles encapsulating a plasmid DNA vaccine against Mycobacterium tuberculosis S. Heuking1,2,3, D. Hedhli3, K. Huygen3 and G. Borchard1,2 1School of Pharmaceutical Sciences, University of Geneva, Switzerland 2Centre Pharmapeptides, Archamps, France 3WIV-Pasteur Institut, Mycobacterial Immunology, Brussels, Belgium 168 Abstract Within the scope of our study, we prepared a water-soluble and TLR-2 agonist functionalized chitosan derivative (CM20-TMC20-60-g3.5%-PEG-Pam3Cys) of minor toxicity (IC50 of 919 μg/mL). This novel co-polymer was then utilized for the encapsulation of a plasmid DNA vaccine (pAg85A, encoding for the antigen 85A of Mycobacterium tuberculosis), resulting in nano-sized particles. The immunogenicity (measured as IL-2 and IFN-γ secretion) of pAg85A chitosan nanoparticles was then investigated after intramuscular (IM) and intranasal (IN) administration. Reliable and significant results were obtained for IM vaccinations only for pAg85A (without carrier) immunizations in view of IL-2 (spleen) and IFN-γ (spleen) secretions. With regard to IN immunizations, significant IFN-γ production was seen with the ranking pAg85A (without carrier) > TMC20-60 pAg85A nanoparticles (NP). In addition, Ag85A-specific antibodies were only detected by IM pAg85A (without carrier) vaccination. In a nutshell, pAg85A chitosan nanoparticles, with or without TLR-2 agonist functionalization, did not demonstrate a benefit over IM pAg85A vaccination. This observation might be related to low in vitro and in vivo transfection efficiency of the particles. 1. Introduction In general, a plasmid DNA (pDNA) vaccine can be defined as a bacterial plasmid vector into which a gene of interest is inserted encoding for one (or more) antigenic protein(s). Plasmid DNA vaccines are produced in bacteria (such as Escherichia coli) and after purification injected into the host (Huygen, 2005). Overall, DNA vaccination might be an answer for preventing infections caused by intracellular pathogens (such as tuberculosis, influenza, hepatitis or HIV/AIDS) due to its distinct ability of inducing a strong cytotoxic T lymphocyte (CTL) response in orchestration with CD4+ T helper cells 169 (cellular immunity) as well as the generation of antibodies (humoral immunity) (Kutzler and Weiner, 2008). Regarding the immunization against Mycobacterium tuberculosis (Mtb), several pDNA vaccines encoding, e.g., for the antigen 85A (Ag85A), Ag85B, 65 kDa heat-shock-protein, Mtb72F and others were examined at preclinical level and revealed different magnitudes of immunogenicity and protection (Huygen, 2005). However, a major drawback of pDNA vaccines is their low transfection efficacy and consequently only minor quantities of antigenic protein(s) are produced in situ leading to a weaker immune response. Moreover, at present, no pDNA vaccine causes protection superior to the common BCG vaccine. Therefore, improvements on pDNA immunization are indispensable and might be achieved by plasmid optimization, co-formulation with adjuvants or changing the route of administration, for instance to pulmonary vaccination (Kutzler and Weiner, 2008). Considering pulmonary vaccine delivery, it is worth mentioning that airborne bacterial and viral infections in the respiratory tract (especially pulmonary tuberculosis) are causing a high rate of deaths per year (Woodland et al., 2004). Consequently, pulmonary deposition of vaccines mimicking the natural way of infection might therefore be an appropriate way for their prevention. Promise of pulmonary vaccination as a feasible concept was indicated by several clinical trials using measles aerosol vaccines (Dilraj et al., 2000; Bennett et al., 2002). Interestingly, nasal vaccination with volumes > 10 μL in mice under anaesthesia was shown to facilitate effective delivery also to the lung (Alpar, et al., 2005). Secondly, nasal administration can be easily realized by simply pipetting small volumes (e.g., 50 μL) into nasal cavities. Within the scope of nasal/pulmonary DNA vaccination, we selected a pDNA vaccine encoding for the mycolyl-transferase protein Ag85A of Mtb (abbreviated pAg85A). The 170 plasmid pAg85A is among the most investigated pDNA vaccines against Mtb and demonstrated promise due to its strong Th1 response in vivo (Huygen et al., 1996). In order to protect pAg85A against nuclease degradation upon deposition at mucosal epithelia, we encapsulated pAg85A into chitosan-based nanoparticles (NP). Moreover, we equipped these pAg85A NP with an adjuvant moiety, the TLR-2 agonist Pam3Cys, as described earlier (Heuking et al., 2009a). In turn, Pam3Cys functionalized pAg85A nanoparticles were applied intranasally and intramuscularly into C57BL/6 mice. The proliferative capacity of leukocytes in spleen, lungs and cervical lymph nodes (intranasal) or solely spleen (intramuscular) was evaluated by measuring secretions of T-cell helper type 1 (Th1) cytokines (IL-2 and IFNγ) in response to antigen exposure in vitro. Finally, titration of Ag85A specific total antibodies in sera was performed by ELISA. 2. Materials and methods 2.1 Animals C57BL/6 mice (n=120) were provided from the breeding facilities of WIV-Pasteur Site in Ukkel (Belgium). Only female mice were used at an age of 6-8 weeks old at the start of vaccination. 2.2 Plasmid DNA construction Plasmid DNA encoding Ag85A (pAg85A) was prepared as previously reported (D’Souza et al., 2006) and propagated in Escherichia coli DH5α followed by large scale purification by GigaKit (Invitrogen, France). Correct propagation of pAg85A was controlled by incubation with the BgLII restriction enzyme (Invitrogen, France) followed by gel electrophoresis. Final concentration of pAg85A was 3.2 µg/µL in endotoxin-free TBE 171 buffer (Invitrogen, France). 2.3 Synthesis of and characterization of CM-TMC-g-PEG-Pam3Cys The water-soluble chitosan derivative CM-TMC-g-PEG-Pam3Cys was prepared as previously reported (Heuking et al., 2009b). Briefly, a N,N,N-trimethyl chitosan (TMC) with a degree of trimethylation (%DTM) of 20% and degree of dimethylation (%DDM) of 60% was synthesized. After successive carboxymethylation (CM-TMC), grafting of NH2-PEG-Pam3Cys to CM-TMC was performed aiming at a grafting success of 4.0 % (Heuking et al., 2009). The DTM, DDM, degree of 6-0-carboxymethylation (%DCM) and the degree of grafting (%DG) were determined as described earlier (Heuking et al., 2009b) by 1H NMR spectroscopy on a Varian VXR 300 MHz spectrometer (Varian, Switzerland). Chitosan derivatives were dissolved in D2O and all other compounds in CDCl3. 2.4 Nanoparticle preparation Nanoparticles encapsulating pAg85A were formulated according to published methods (Heuking et al., 2009a). More precisely, CM-TMC-g-PEG-Pam3Cys (at 7.49 mg/mL) or TMC (at 4.4 mg/mL) were dissolved in Minniversol water. Separately, the plasmid pAg85A (1 μg of pAg85A being equal to 3.1 nmol of phosphate groups) was dissolved in 5 mM aqueous Na2SO4 at appropriate concentrations in order to yield an N/P molar ratio of 3:1. Both solutions were heated for 5 minutes at 55°C and the polymer solution was then slowly added (approximately 1 drop per second) to the pAg85A solution and subsequently vortexed at low speed for 30 seconds. Attention was paid to keep the final volume ≤ 400 μL. Moreover, empty TMC nanoparticles (control group) were prepared by adding the cross-linking agent pentasodium tripolyphosphate (TPP) at a molar ratio of 172 3:1 (positive amines N+(CH3)3 to TPP molecules) at room temperature via drop-wise addition of TPP solution (0.58 mg/mL) to slowly vortexed polymer solution. The final volume was similarly kept at a volume of ≤ 400 μL. Thereafter, particles were kept at room temperature for at least one hour prior to further use. 2.5 Isotonicity The isotonicity of nanoparticle dispersions as well as pAg85A solution was adjusted to 300 mOsmmol/kg by using appropriate small volumes (< 20 μL) of NaCl solution (0.16 mg/mL). Isotonicity was controlled by a MicroOsmometer (Knauer, Germany). All measurements were done in triplicates. 2.6 Size and zeta potential Hydrodynamic diameters were measured by Photon Correlation Spectroscopy (ZetaSizer 3000 HS, Malvern, Switzerland). For measurements, 400 μL of isotonized nanoparticle suspensions were diluted with RPMI1640 plain medium to 1.4 mL. Size distribution data were obtained by the number-averaged value of three independent groups of ten measurements. In addition, zeta potential was measured in triplicate via micro-electrophoresis by using an aqueous dip cell (ZetaSizer 3000 HS, Malvern, Switzerland). 2.7 Vaccination All animal experiments were performed according to the regulations enforced by the local ethical committee. C57BL/6 mice (n=120) were anaesthetized by intraperitoneal injection of ketamine-xylazine and immunized three times intramuscularly (n=60) at three weeks intervals with 100 µL of formulations I, II or III containing 25 µg of pAg85A 173 (see table 1) or with the control formulation IV (no pAg85A). Moreover, further mice (n=60) were immunized intranasally with 50 µL of formulations I, II or III (containing 12.5 µg of pAg85A, respectively) or control formulation IV (no pAg85A). Table 1 – pAg85A formulations used for this study (conjugate = CM-TMC-g-PEGPam3Cys). Formulation Delivery form Content I Solution pAg85A II Suspension TMC20-60 pAg85A nanoparticles III Suspension Conjugate pAg85A nanoparticles IV Suspension TMC20-60 TPP nanoparticles 2.8 Cytokine measurements Three weeks after the last immunization mice were sacrificed by cervical dislocation. Spleens (intramuscular groups) or spleens, lungs and cervical lymph nodes (intranasal groups) were removed aseptically, crushed and cells were passed over a nylon wool column in order to eliminate debris. Leucocytes (4 × 106 cells/ml) from five mice per group and per delivery route were tested individually (spleen) or pooled (lungs and lymph nodes) for cytokine response to recombinant Ag85A (5 μg/ml), purified protein derivative (PPD) (10 μg/mL), Ag85A240-260 (10 μg/mL), Ag85A260-280 (10 μg/mL) and pokeweed mitogen (PWM, 5 μg/mL) as positive control. Non-stimulated cells were used as negative control. Next, supernatants were harvested after 24h or 48h for IL-2 analysis and after 72h for IFN-γ analysis as described earlier (D’Souza et al., 2003). IL-2 concentrations were determined by ELISA (antibodies were obtained from Bioscience, Belgium) and expressed in pg/mL. 174 Similarly, IFN-γ activity was quantified by sandwich ELISA as reported (Romana et al., 2006) and expressed in pg/mL. Data were regressed using log log regression with R > 0.95. The assay sensitivity for ELISA of IL-2 and IFN-γ was 3.1-39.1 pg/ml, depending on the standard concentrations used. 2.9 Antibody measurement Five mice per group were bled before the 1st, 2nd and 3rd immunization and sera were isolated from the clot and stored at 4 °C for antibody detection. The antibody responses to Ag85A was detected with an ELISA as specified earlier (Tanghe et al., 2000; Gartner et al., 2008). 2.10 Transfection of HEK293T cells and Western Blot Human embryonic kidney cells (HEK293T cells) were used for studying the transfection of pAg85A chitosan nanoparticles (Gartner et al., 2007). HEK293T cells were grown in Dulbecco's modified Eagle medium (DMEM) containing penicillin (100 U/ml), streptomycin (100 μg/ml) and 10% foetal bovine serum. One day before transfection, 2.5 × 105 cells per well were seeded in six-well plates. Per well and per transfection, 1 μg of pAg85A were applied with the following organization of controls and samples: 1) lipofectamine TransIT-LT1TM (Mirus, France) for pAg85A transfection (positive control); 2) TransIT-LT1TM was also applied for transfection of a control plasmid (without Ag85A sequence; negative control); 3) pAg85A alone; 4) TMC pAg85A nanoparticles; 5) CM20TMC20-60-g3.5%-PEG-Pam3Cys pAg85A nanoparticles. After 24 h of transfection cells were harvested by pipetting, washed with cold PBS and lysed on ice during 2 min in a lysis buffer containing 50 mM Tris–HCl pH 7.4, 250 mM sucrose, 1% (v/v) nonidet P-40 (NP-40) and complete protease inhibitor cocktail (Roche, Switzerland). 175 Protein concentration of each lysate was determined by Bradford assay (BioRad, France) and diluted accordingly. Next, lysates were boiled in loading dye under reducing conditions with 500 mM DTT for successive sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). Samples (25 μl per well) and the protein ladder Precision Plus KaleidoscopeTM (BioRad, France) were separated by SDS-PAGE using 12% gels. In the following, the mouse monoclonal Ag85-specific antibody TD17 (Drowart et al., 1992; Huygen et al., 1994) was used for revealing Ag85A expression followed by treatment with horseradish peroxidase coupled rabbit anti-mouse immunoglobulin (Ig) as secondary antibody (Sigma, Switzerland). Blots were analyzed by using the ChemiLuminescence Detection Kit (Applichem, Germany), Fuji Super RX films (Fuji, Switzerland) and a Fujifilm FPM-100A film developer (Fuji, Switzerland). 2.11 Data analysis and statistics Obtained data were expressed as the mean ± standard error of the mean and compared by a one-way ANOVA analysis using Origin 7.03 software. Differences were considered significant at p<0.05. 3. Results 3.1 CM-TMC-g-PEG-Pam3Cys synthesis and characterization In order to develop a water-soluble chitosan derivative for vaccine delivery, we opted for the synthesis of a TMC with 20% as DTM and 60% as DDM (named TMC20-60). Jantapinkit et al. (2008) reported that such a TMC20-60 polymer exhibits the least cytotoxicity on L929 fibroblasts (IC50 > 1000 µg/mL) in comparison to TMCs with higher DTMs or lower DDMs (having IC50 values of 10 µg/mL). Accordingly, we synthesized a TMC20-60, carboxymethylated the polymer (giving CM-TMC) and grafted then the TLR-2 176 agonistic moiety NH2-PEG-Pam3Cys to CM-TMC as already reported (Heuking et al., 2009). 1H NMR spectroscopy confirmed a DTM of 18.5 %, DDM of 55.3 %, DCM of 19.2 % and DS of 3.5 % for the finalized co-polymer, which will be abbreviated CM20-TMC20-60g3.5%-PEG-Pam3Cys (data not shown). In our hands, CM20-TMC20-60-g3.5%-PEG-Pam3Cys displayed a much lower cytotoxicity on alveolar A549 cells by WST assay (IC50 of 919 µg/mL) when compared to our previously investigated co-polymer (IC50 of < 20 µg/mL; Heuking et al., 2009). Moreover, we demonstrated (Heuking et al., 2009) that the formation of TMC and CM-TMC-g-PEG-Pam3Cys DNA nanoparticles decreased strongly the cytotoxicity by a factor of 50, so that we did not expect any cytotoxicity of CM20TMC20-60-g3.5%-PEG-Pam3Cys pAg85A nanoparticles (final concentration of CM20TMC20-60-g3.5%-PEG-Pam3Cys was 3.75 mg/mL). Consequently, we included CM20TMC20-60-g3.5%-PEG-Pam3Cys in further studies. 3.2 Characterization of pDNA nanoparticles Nanoaggregation of TMC20-60 as well as CM20-TMC20-60-g3.5%-PEG-Pam3Cys with pAg85A resulted in positively charged and nano-sized particles (see table 2). In comparison to empty TMC20-60 TPP nanoparticles, pAg85A loaded nanoparticles exhibited slightly higher polydispersities (see table 2), which might be explained by differences in molecular weight between TPP (MW 367.9 Da) and plasmid DNA (MW 3575 kDa), allowing a potentially more controlled and homogenous formation of TMC20-60 TPP nanoparticles. Interestingly, Csaba and colleagues (2010) noticed likewise that the explicit use of TPP for the preparation of chitosan DNA nanoparticles resulted in a more homogenous morphology of particles. 177 TABLE 2 Size distribution and zeta potential (ZE) values of pAg85A nanoparticles (Gr. = formulation group; conjugate = CM20-TMC20-60-g3.5%-PEG-Pam3Cys; n/a = non applicable; * = nanoparticles were prepared at a molar ratio of 3:1, +N(CH3)3:TPP). Gr. Chitosan derivative N/P Size ZE Poly- applied ratio [nm] [mV] dispersity I None n/a n/a n/a n/a II TMC20-60 3:1 429.5 ± 170.2 18.9 ± 2.3 0.534 III Conjugate 3:1 511.4 ± 166.5 15.8 ± 1.6 0.522 IV TMC20-60 n/a* 438.8 ± 82.1 10.8 ± 1.2 0.341 After the first vaccination step in mice and successive storage at 4-5°C, inconvenient precipitation of nanoparticles was detected by sight. The reason for this phenomenon might be the addition of concentrated sodium chloride solution in order to adjust the isotonicity to 300 mOsm/kg. Similar observations for pDNA containing chitosan nanoparticles were already reported by others (Medburry et al., 2004; Strand et al., 2008). Consequently, in an attempt to restore the initial nanoparticulate size, we applied soft ultrasonication (Branson ultrasonic bath, 5510, 40kHz) for disaggregation purposes. However, ultrasonication was shown to cause degradation of pDNA depending on time and frequency applied (Walter et al., 1999; Kuo et al., 2003). Thus, we controlled the integrity of plasmid pAg85A after ultrasonication treatment by gel electrophoresis. After 60 minutes of ultrasonication at room temperature, initial size and zeta potential values were maintained (data not shown) and even after 75 minutes of ultrasonication, no degradation of pAg85A was detected (see figure 1). Therefore, we set the time of ultrasonication of formulations II, III and IV to one hour at room temperature prior to second and third immunizations. 178 x 1 2 x 3 4 5 6 x x x x 7 8 9 10 Figure 1: Gel electrophoresis after 75 minutes of ultrasonic treatment (47 kHz, room temperature) with lane 1-2 CM20-TMC20-60-g3.5%-PEG-Pam3Cys pAg85A nanoparticles; lane 3-4 TMC20-60 pAg85A nanoparticles; lane 5-8 pAg85A alone; lane 9-10: 1kpb DNA ladder; x = treatment by ultrasonication. 3.3 Vaccination 3.3.1 Intramuscular immunizations As positive control to intranasal vaccination, we injected three times all four pAg85A formulations (group I, II, III and IV) into C57BL/6 mice intramuscularly (IM) and analyzed for antigen specific immune responses after a total of 12 weeks. Splenocytes from mice were challenged in vitro with the recombinant Ag85A protein (recAg85A), purified protein derivative from Mycobacterium tuberculosis (PPD), two selected CD4+ antigenic peptide sequences (Ag 85A240-260, Ag 85A260-280, Huygen et al., 1994) and pokeweed mitogen (PWM) as positive control. Subsequently, Th1-cytokines IL-2 and IFN-γ were measured. 179 Relating to IL-2 levels, we observed that only IM injection of plasmid pAg85A (group I, see figure 2a) triggered ascertainable, but weak IL-2 secretions. None of the chitosanbased pAg85A delivery systems (group II and III) induced any significant levels of IL-2. Spleen: IL-2 (24h) 600,0 NS IL-2 (pg/ml) 500,0 400,0 300,0 NS 200,0 100,0 * P25 P27 PPD CS II Ag85A P27 II CS P25 II PPD Ag85A I P27 CS I P25 PPD I Ag85A P27 I CS P25 I PPD Ag85A 0,0 II II III III III III III IV IV IV IV IV antigen/group Figure 2a: IL-2 secretions in supernatant of spleen cells after 24h exposure to the recombinant antigen 85A (recAg85A), purified protein derivative (PPD) Ag 85A240-260 (P25), Ag85A260-280 (P27) and non-stimulated cells (CS) (n=5 per group); bar = detection limit of 3.1 pg/mL; ANOVA analysis were performed via comparison to non-stimulated cells: *, p<0.05; NS, not significant. 180 1800,00 1600,00 IL-2 (pg/mL) 1400,00 1200,00 1000,00 800,00 600,00 400,00 200,00 0,00 PWM PWM PWM PWM I II III IV PWM/group Figure 2b: IL-2 secretions in supernatant of spleen cells after 24h exposure to pokeweed mitogen (PWM) (n=5 per group). Exposure to pokeweed mitogen (PWM) as positive control demonstrated a different onset of IFN-γ production (figure 2b), which renders a direct comparison of IL-2 results difficult as not the same proliferative capacity of leukocytes was given. In contrast to that, we observed the generation of IL-2 cytokines when splenocytes were exposed to the purified protein derivative (PPD). PPD is the total protein extract of Mycobacterium tuberculosis and contains, next to small amounts of Ag85A, all secreted, cytoplastic and membrane-based proteins. In our hands, we noticed PPD-specific IL-2 secretions with the tendency of CM20-TMC20-60-g3.5%-PEG-Pam3Cys pAg85A nanoparticles > TMC20-60 pAg85A nanoparticles (although obtained values were not significant). IL-2 levels for group I (pAg85A alone) and group IV (unloaded TMC20-60 nanoparticles) were below the limit of detection (see figure 2). Regarding the second Th1-cytokine, IFN-γ, only splenocytes from mice vaccinated with pAg85A alone (group I) demonstrated Ag85A181 specific IFN-γ levels (see figure 3). Again in contrast to that, PPD challenged splenocytes elicited IFN-γ secretions with the trend (although not significant) with CM20-TMC20-60g3.5%-PEG-Pam3Cys pAg85A NP > unloaded TMC20-60 NP > pAg85A in solution (see figure 3). To our surprise, unloaded TMC20-60 NP (as control group) enabled PPDrelated IFN-γ production, although not statistically significant, this results questions the validity of this particular IFN-γ assay. Spleen: IFN-g (72h) 900,0 800,0 * 700,0 IFN-g (pg/ml) 600,0 NS NS 500,0 400,0 NS NS 300,0 200,0 100,0 Ag85A P25 P27 PPD CS Ag85A P25 P27 PPD CS Ag85A P25 P27 PPD CS Ag85A P25 P27 PPD CS 0,0 I I I I I II II II II II III III III III III IV IV IV IV IV antigen/group Figure 3: IFN-γ secretions in supernatant of splenocytes after 72h exposure to the antigen 85A (recAg85A), purified protein derivative (PPD), Ag85A240-260 (P25), Ag85A260-280 (P27) and non-stimulated cells (CS) (n=5 per group); bar = detection limit of 39.1 pg/mL; ANOVA analysis were performed via comparison to non-stimulated cells: *, p<0.05; NS, not significant. 182 3.3.2 Intranasal immunizations Intranasal (IN) vaccination of C57BL/6 mice was performed by using 12.5 μg of pAg85A per vaccination (in contrast to 25 μg of pAg85A for IM vaccinations) and was analyzed for IL-2 (lung, lymph node and spleen) and IFN-γ secretions (spleen) in similar manner as reported for IM immunizations. Concerning the immune response in the lung, no proliferative IL-2 responses were detected at all from lung cells after antigen exposure in vitro (data not shown). However, we noted IL-2 secretions of leukocytes from cervical lymph nodes after antigen challenge (see figure 4). Lymph nodes: IL-2 (48h) 14,0 12,0 IL-2 (pg/ml) 10,0 8,0 6,0 4,0 2,0 Ag85A P25 P27 PPD CS Ag85A P25 P27 PPD CS Ag85A P25 P27 PPD CS Ag85A P25 P27 PPD CS 0,0 I I I I I II II II II II III III III III III IV IV IV IV IV antigen/group Figure 4: IL-2 response of pooled lymph node cells due to 48h exposure to the following antigens: antigen 85A (Ag85A), purified protein derivative (PPD), Ag85A240-260 (P25), Ag85A260-280 (P27) and non-stimulated cells (CS) (n=5 per group); bar = detection limit of 3.1 pg/mL. 183 Above the detection limit, TLR-2 decorated NP harbouring pAg85A (group III) mediated the strongest production of IL-2, which was specific to the antigen 85A, but not to PPD. No Ag85A-specific IL-2 was found for group I (pAg85A alone), however, to our astonishment, unloaded TMC20-60 nanoparticles (containig no pAg85A, control group IV) showed an Ag85A-specific IL-2 response, which is comparable to the IFN-γ assay for IM vaccinations questioning the assay´s validity (see figure 4). In addition, Ag85A- and PPD-related IL-2 response of spleen cells were very weak (<5 pg/mL; see figure 5) and only splenocytes of group III (TLR-2 agonist decorated pAg85A NP) vaccinated mice exhibited modest and not significant PPD-specific IL-2 secretions. Spleen: IL-2 (24h) 40,0 35,0 NS IL-2 (pg/ml) 30,0 25,0 20,0 15,0 10,0 5,0 Ag85A P25 P27 PPD CS Ag85A P25 P27 PPD CS Ag85A P25 P27 PPD CS Ag85A P25 P27 PPD CS 0,0 I I I I I II II II II II III III III III III IV IV IV IV IV antigen/group Figure 5: IL-2 response of splenocytes in response to 24h exposure to various antigens: antigen 85A (Ag85A), purified protein derivative (PPD), Ag85A240-260 (P25), Ag85A260-280 (P27) and non-stimulated cells (CS) (n=5 per group); bar = detection limit of 3.1 pg/mL; ANOVA analysis were performed via comparison to unstimulated cells: *, p<0.05; NS, not significant. 184 Regarding IFN-γ responses of splenocytes (see figure 6a), Ag85A exposure enabled IFNγ production with the trend of pAg85A alone (group I) > TMC20-60 pAg84A NP (group II) > CM20-TMC20-60-g3.5%-PEG-Pam3Cys pAg85A NP (group III, not significant). Unloaded TMC20-60 NP (group IV) as control showed no IFN-γ induction. Spleen: IFN-g (72h) 90,0 80,0 * 70,0 * IFN-g (pg/ml) 60,0 50,0 NS 40,0 NS 30,0 20,0 10,0 Ag85A P25 P27 PPD CS Ag85A P25 P27 PPD CS Ag85A P25 P27 PPD CS Ag85A P25 P27 PPD CS 0,0 I I I I I II II II II II III III III III III IV IV IV IV IV antigen/group Figure 6a : IFN-γ secretions of splenocytes in response to 72h exposure to various antigens: antigen 85A (Ag85A), purified protein derivative (PPD), Ag85A240-260 (P25), Ag85A260-280 (P27) and non-stimulated cells (CS) (n=5 per group); bar = detection limit of 15.1 pg/mL. ANOVA analysis were performed via comparison to non-stimulated cells: *, p <0.05; NS, not significant. 185 Exposure to pokeweed mitogen (positive control) showed different magnitude (figure 6b) of IFN-γ production, which renders a comparison of results difficult as not the same proliferative function of leukocytes was given. 3000,00 IFN-g (pg/mL) 2500,00 2000,00 1500,00 1000,00 500,00 0,00 PWM I PWM PWM PWM II III IV PWM/group Figure 6b: IFN-γ secretions of splenocytes in response to 72h exposure to pokeweed mitogen (PWM) (n=5 per group); bar = detection limit of 15.1 pg/mL. 3.3.3 Ag85A-specific antibodies In our hands, only mice vaccinated with pAg85A alone (group I) demonstrated significant Ag85A-specific IgG antibodies at 1:100 sera dilution (OD value of 0.69 ± 0.22, one-way ANOVA, p < 0.05) and were lower when compared to previous findings (1:2560 dilution, OD value of 0.611 ± 0.246, Romano et al., 2006). Chitosan-based pAg85A nanoparticles (group II and III) did not elicit significant Ag85A-specific immune responses (data not presented). Therefore, we questioned the polymer´s ability of transfection, which would impair the production of the antigenic protein 85A in vivo and subsequently Ag85A-specific immune responses. 186 pAg85A IM vaccination 1,2 1 Mice 1 Mice 2 DO 0,8 Mice 3 Mice 4 0,6 Mice 5 Mice 6 0,4 NC NC 0,2 0 100 200 400 800 1600 3200 6400 12800 25600 dilution steps Figure 7: Detection of anti-Ag85A IgG antibodies in sera of pAg85A-vaccinated mice (n=6 , group I); NC, negative control. 3.4 pAg85A transfection in HEK cells In order to investigate the transfection capacity of our chitosan derivatives, we aimed at transfecting human embryonic kidney 293T (HEK293T) cells with pAg85A by applying both chitosan derivative polymers, respectively. For comparison purpose, we also involved the commercially available transfection agent TransITTM. In figure 8 is shown that all negative controls (lanes 2 and 3) gave no protein signal. Lipofectamine TransITTM mediated pAg85A transfection resulted in a protein (lane 4) with a molecular weight of around 32 kDa, similar to the recombinant protein Ag85A as positive control (lane 1). 187 1 2 3 4 5 6 7 50 kDa 37 kDa 25 kDa Figure 8: Western blot detection of equal amounts of HEK cell lysates under reducing conditions: lane 1, recombinant protein Ag85A; lane 2, pAg85A alone; lane 3, control plasmid delivered by lipofectamine TransITTM; lane 4, pAg85A deliverd by TransITTM; lane 5, TMC20-60 pAg85A NP; lane 6: CM20-TMC20-60-g3.5%-PEG-Pam3Cys pAg85A NP; lane 7: cell culture medium. With regard to polymeric chitosan effectuated pAg85A delivery, both delivery systems gave a weak protein signal at a higher molecular weight of around 40 kDa. An explanation for that might be N-glycosylation of the protein Ag85A in eukaryotic HEK293T cells, what would increase in turn the molecular weight. However, the same phenomenon would occur for the pAg85A transfection using TransITTM lipofectamine and that was not observed (lane 4). In addition, we investigated the GFP transfection in alveolar A549 cells and found a relatively low transfection efficiency mediated by both polymer systems (TMC20-60: 6.3 ± 2.8 and CM20-TMC20-60-g3.5%-PEG-Pam3Cys: 6.4 ± 3.6) when fluoresence microscopy was used for an approximative quantification. 188 4. Discussion of results In order to elicit protective immunity against Mtb infection, Th1 associated cytokines (such as IL-2, IFN-γ or IL-12) are considered to play an important role. In that way, it is worth mentioning that IM Ag85A vaccinated IFN-γ knockout mice were able to produce significant amounts of Ag85A-specific antibodies and IL-2, but died quickly upon infection challenge with Mtb (O’Souza et al., 2000). It was consequently stated that the Th1 cytokine IFN-γ mediates the protective function of the pAg85A vaccine and IFN-γ´s critical role in controlling MtB infections is generally accepted (Giri, 2008). CD4+ and CD8+ T lymphocytes are the producers of IFN-γ, which in turn is strongly involved in the activation of macrophages followed by stimulation of microbicidal mechanisms. In addition to IFN-γ, induction of IL-4, a balanced Th1 versus Th2 response, local IgA antibodies, suppression of Treg cells and stimulation of a Th17 response might be helpful for achieving immunity against Mtb infection (Giri, 2008). Within the scope of our study, we analysed for IFN-γ and IL-2 secretions of leukocytes from spleen (IM vaccination) or spleen, lungs and lymph nodes (IN vaccination) in response to Mtb-related antigens. Exposure of leukocytes to the PWM antigen (positive control) showed comparable proliferative capacities (no intrinsic defect in cytokine production) within each cytokine assay for all formulations studied (IM and IN vaccinations). Exceptions were found for IN-splenocyte IFN-γ and IM-splenocyte IL-2 bioassays. Noteworthy, PPD and 85A antigen induced cytokine levels were in all cases below PWM triggered responses (positive control). Most measured IL-2 and IFN-γ concentrations were lower than the limit of detection or not significant in comparison to non-stimulated cells (one-way ANOVA). Moreover, leukocytes from the cervical lymph nodes produced Ag85A-specific IL-2 cytokines when exposed to unloaded TMC20-60 TPP NP (containing no pAg85A, control 189 group IV), which is questioning the informative value of this particular experiment. After all these exclusions, reliable and significant results were obtained for IM vaccinations only for pAg85A (formulation group I) immunizations in view of IL-2 (spleen) and IFN-γ (spleen) secretions. With regard to IN immunizations, significant IFN-γ production was seen with the ranking of pAg85A (group I) > TMC20-60 pAg85A NP. In addition, Ag85A-specific antibodies were only detected after IM pAg85A vaccination. In a nutshell, pAg85A chitosan nanoparticles, with or without TLR-2 agonist functionalization did not demonstrate a higher immunogenicity and benefit over IM pAg85A vaccination. A reason for this is probably the low transfection efficiency of chitosan DNA nanoparticles in vivo as indicated by Western blot experiment and GFP transfection studies in vitro. In terms of further vaccination studies, optimizations enabling a clear benefit of chitosan-based DNA vaccine delivery have to be demonstrated. Valuable concepts might be: i) the absorption of DNA vaccine onto unloaded TPP chitosan nanoparticles; ii) optimization of DNA transfection efficiency by modifying molecular weight and degree of acetylation; iii) modification of chitosan nanoparticles with targeting moieties that enhance DNA transfection in vivo; iv) the inclusion of highly DNA transfective polymers into chitosan nanoparticles. References Alpar, H.O., Somavarapu, S., Atuah, K.N. and Bramwell, V.W. Biodegradable mucoadhesive particulates for nasal and pulmonary antigen and DNA delivery. Adv. Drug Deliv. Rev. (2005) 57, 411-430. 190 Bennett, J.V., De Castro, F. J., Valdespino-Gomez, J.L., De Lourdes Garcia-Garcia, M., IslasRomero, R., Echaniz-Aviles, G., Jimenez-Corona, A. and Sepulveda-Amor, J. Aerosolized measles and measles-rubella vaccines induce better measles antibody booster responses than injected vaccines: randomized trials in Mexican schoolchildren. Bull. World Health. Organ. (2002) 80, 806–812. Csaba, N., Köping-Höggård, M. and Alonso, M.J. Ionically crosslinked chitosan/ tripolyphosphate nanoparticles for oligonucleotide and plasmid DNA delivery. Int. J. Pharm. (2009) 382, 205-214. Dilraj, A., Cutts, F.T., De Castro, J.F., Wheeler, J.G., Brown, D., Roth, C., Coovadia, H.M. and Bennett, J.V. Response to different measles vaccine strains given by aerosol and subcutaneous routes to schoolchildren: a randomised trial. Lancet (2000) 355, 798–803. Drowart, A., Launois, P., De Cock, M., Huygen, K., De Brujn, J., Yernault, J.C. and Van Vooren, J.P. An isoelectric focusing method for the study of the humoral response against the antigen 85 complex of Mycobacterium bovis BCG in the different forms of leprosy, J. Immunol. Methods. (1991) 145, 223-228. Gartner, T. Romano, M., Suin, V.,, Kalai, M., Korf, H., De Baetselier, P. and Huygen, K. Immunogenicity and protective efficacy of a tuberculosis DNA vaccine coexpressing pro-apoptotic caspase-3. Vaccine (2008) 26, 1458-1470. Giri, H. How could we have better vaccines against tuberculosis? Expert Opin. Biol. Ther. (2008) 8, 759-772. Heuking, S., Iannitelli, A., Di Stefano, A. and Borchard, G. Toll-like receptor-2 agonist functionalized biopolymer for mucosal vaccination. Int. J. Pharm. (2009) 17, 662670. 191 Heuking, S., Adam-Malpel, S., Sublet, E., Iannitelli, A., Stefano, A. and Borchard, G. Stimulation of human macrophages (THP-1) using Toll-like receptor-2 (TLR-2) agonist decorated nanocarriers. J. Drug Target. (2009) 17, 662-670. Huang H., Ostroff, G.R., Lee, C.K., Wang, J.P., Specht, C.A., Levitz, S.M. Distinct patterns of dendritic cell cytokine release stimulated by fungal beta-glucans and toll-like receptor agonists, Infect. Immun. (2009) 77, 1774-1781. Huygen, K., Lozes, E., Gilles, B., Drowart, A., Palfliet, K., Jurion, F., Roland, I., Art, M., Dufaux, M., Nyabenda, J., De Bruyn, J., Van Vooren, J.P. and De Lys, R. Mapping of TH1 helper T-cell epitopes on major secreted mycobacterial antigen 85A in mice infected with live Mycobacterium bovis BCG, Infect. Immun. (1994) 62, 363-370. Huygen, K., Content, J., Denis, O., Montgomery, D.L., Yawman, A.M., Deck, R.R., DeWitt C.M., Orme, I.M., Baldwin, S., D'Souza, C., Drowart, A., Lozes, E., Vandenbussche, P., Van Vooren, J.P., Liu, M.A. and Ulmer, J.Bet al., Immunogenicity and protective efficacy of a tuberculosis DNA vaccine, Nat. Med. (1996), 2, 893-8. Huygen, K.,. Plasmid DNA vaccination, Microbes Infect. 7 (2005) 932-938. Khan, S., Weterings, J.J., Britten, C.M., de Jong, A.R., Graafland, D., Melief, C.J., van der Burg, S.H., van der Marel, G., Overkleeft, H.S., Filippov, D.V. and Ossendorp, F. Chirality of TLR-2 ligand Pam3CysSK4 in fully synthetic peptide conjugates critically influences the induction of specific CD8+ T-cells. Mol. Immunol. (2008), 15, 765772. Kuo, J.H., Jan, M.S. and Sung, K.C. Evaluation of the stability of polymer-based plasmid DNA delivery systems after ultrasound exposure. Int. J. Pharm. (2003) 257, 75-84. Kutzler and Weiner, DNA vaccines: ready for prime time? Nat. Rev. Genet. (2008) 9, 776788. 192 Lozes, E., Huygen, K., Content, J., Denis, O., Montgomery, D.L., Yawman, A.M., Vandenbussche, P., Van Vooren, J.P., Drowart, A., Ulmer, J.B. and Liu, M.A. Immunogenicity and efficacy of a tuberculosis DNA vaccine encoding the components of the secreted antigen 85 complex. Vaccine (1997) 15, 830-833. Medberry, P., Dennis, S., Van Hecke, T. and DeLong, R.K. pDNA bioparticles: comparative heterogeneity, surface, binding, and activity analyses. Biochem. Biophys. Res. Commun. (2004) 319, 426-432. Redecke, V., Häcker, H., Datta, S.K., Fermin, A., Pitha, P.M., Broide, D.H. and Raz, E. Cutting edge: activation of Toll-like receptor 2 induces a Th2 immune response and promotes experimental asthma. J. Immunol. (2004) 172, 2739-2743. Romano, M., Roupie, V., Wang, X.M., Denis, O., Jurion, F., Adnet, P.Y., Laali, R. and Huygen, K. Immunogenicity and protective efficacy of tuberculosis DNA vaccines combining mycolyl-transferase Ag85A and phosphate transport receptor PstS-3. Immunology (2006) 118, 321-332. Sieling, P.A., Chung, W., Duong, B.T., Godowski, P.J. and Modlin, R.L. Toll-like receptor 2 ligands as adjuvants for human Th1 responses. J. Immunol. (2003), 170, 194-200. D'Souza, S., Denis, O., Scorza, T., Nzabintwali, F., Verschueren, H. and Huygen K. CD4+ T cells contain Mycobacterium tuberculosis infection in the absence of CD8+ T cells in mice vaccinated with DNA encoding Ag85A. Eur. J. Immunol. (2000) 30, 24552459. Strand, S.P., Issa, M.M., Christensen, B.E., Vårum, K.M. and Artursson, P. Tailoring of chitosans for gene delivery: novel self-branched glycosylated chitosan oligomers with improved functional properties. Biomacromolecules (2008) 9, 3268-3276. Wedlock, D.N., Denis, M., Painter, G.F., Ainge, G.D., Vordermeier, H.M., Hewinson, R.G. and Buddle, B.M. Enhanced protection against bovine tuberculosis after 193 coadministration of Mycobacterium bovis BCG with a Mycobacterial protein vaccine-adjuvant combination but not after coadministration of adjuvant alone. Clin. Va. Mol. Immunol. (2009) 46, 1084-1091. Woodland, D.L. and Randall, T.D. Anatomical features of anti-viral immunity in the respiratory tract. Semin. Immunol. 16 (2004), 163-170. 194 195 Chapter 8 Discussion and future perspectives 196 Pulmonary vaccination Most respiratory pathogens invade the human body through mucosal epithelia and cause a high rate of deaths per annum (Woodland et al., 2009). Fighting against lung infections, pulmonary delivery of vaccines represents an attractive alternative by mimicking the natural way of infection and therefore eliciting a local immunity. This immunity constitutes a first line of defense and prevent further entrance of pathogens. In animal models, aerosol delivery involves intratracheal instillation and insufflation or the use of exposure chambers, whereas for clinical trials a delivery device is required. Microsized particles (1-5 μm in size) are generated by dry-powder inhalers and aerosols from liquid suspended particles by nebulizers before being delivered into the respiratory tract (Lu and Hickey, 2009). In history, aerosol vaccination was applied in human subjects for more than a century and includes aerosol vaccines against anthrax, plaque, tularemia, smallpox, tetanus and botulism (Giudice et al., 2006). When compared to common parenteral immunization, the following benefits of aerosolized vaccines are being discussed: i) delivery of vaccines into the respiratory tract can trigger the secretion of local IgA antibodies being capable of crossing mucosal epithelia and preventing further entrance of pathogens; ii) the particular non-invasive nature of antigen delivery into the lungs circumvents the common use of needles and by these means the main reason for unsafe injections. According to WHO reports (World Global Burden of Disease Study, 2002), these unsafe injections cause 21,000,000 cases of hepatitis B, 2,000,000 cases of hepatitis C and 260,000 cases of HIV/AIDS around the world; iii) in contrast to conventional vaccines, the application of pulmonary dry powder vaccines could stop the common imperative of an intact cold chain for storage; iv) for the administration of vaccines via inhalers, no specially trained medical personnel would be required. 197 In addition, a recent systematic review about measles immunization in children (10 months and older) reported that aerosol measles vaccination was more immunogenic in comparison to subcutaneous vaccination (Low et al., 2008). A current phase II/III clinical trial with 2000 healthy infants (9 to 12 months old) initiated by the WHO will further investigate the safety and efficacy of aerosol measles vaccination (Simon et al., 2010). Aerosol delivery of plasmid DNA vaccines In order to embrace presented advantages of pulmonary immunization with DNA vaccines (see part I, general), pulmonary plasmid DNA vaccination was considered to be a promising concept of vaccination and might be applied in the future against intracellular pulmonary pathogens, such as Mycobacterium tuberculosis, respiratory syncytical virus (RSV) and severe acute respiratory syndrome coronavirus (SARS) (Bivas-Benita et al., 2005). Until now, most in vivo studies have focused primarily on gene therapy in the lung (Aneja et al., 2009) and raised expectations that the most efficient and safest pulmonary gene delivery systems will find their application also for the transport of DNA vaccines. In addition to common barriers in gene therapy (see part I, general), the delivery of plasmid DNA into the lung has to overcome further extracellular obstacles, e.g., withstanding shear forces during aerosolization and crossing the respiratory mucus layer, which is covering conducting airways or the liquid layer in the alveoli (Sanders et al., 2009). So far, pulmonary delivery of plasmid DNA vaccines was only reported for very few antigens (table 1). Until now, the only study of pulmonary DNA vaccination demonstrating protective immunity was reported by Orson et al. (2006). An influenza antigen hemagglutinin (HA; from viral strain A/PR8/34) expressing DNA (pHA) was incorporated into PEI particles 198 and aerosolized into mice. When compared to intravenous delivery of the same HA plasmid in macroaggregated albumin (MAA)-PEI particles, inferior virus neutralization antibodies were found two weeks post immunization. However, once adjuvant plasmids encoding the cytokines IL-12 and granulocyte-macrophage colony stimulating factor (GM-CSF) were co-aerosolized in the same PEI formulation, a significant increase in neutralizing antibody titers was detected together with protection against subsequent influenza challenge (Orson et al., 2006). Table 1: Overview of pulmonary DNA vaccination studies (Mycobacterium tuberculosis = MTb; poly(D,L-lactide-co-gylcolide = PLGA; polyethylenimine = PEI; NP = nanoparticles; RSV = respiratory syncytical virus). Encoded protein Delivery (pathogen) route Delivery system References Hepatitis B surface Intratracheal None Lombry et al., (hepatitis) (instillation) Eight epitopes Intratracheal (MTb) (microsprayer) Hemagglutinin Aerosol (influenza) (nebulizer) Rv1733c Intratracheal (MTb) (microsprayer) 2004 Chitosan NP Bivas-Benita et al, 2005 PEI NP Orson et al., 2006 PGLA-PEI NP Bivas-Benita et al., 2009 This result also reflects previous findings (O`Hagan et al., 2006; Schlosser et al., 2008; Heit et al., 2008), suggesting that the adjuvant has to be co-delivered within the same 199 particulate vector as the antigen in order to maximize a homogenous stimulation of antigen-presenting cells (APC) in vivo. Functionalization of chitosan DNA nanoparticles with TLR agonists for pulmonary vaccination The present strategy of finding a safe and potent APC stimulating adjuvant correlates with an understanding of the human innate immune system. Hereby, so-called Toll-like receptor (TLR) agonists have been lately considered as very auspicious due to their ability to elicit a potent innate immune response which, in turn, affects strongly the initiation of adaptive immunity (Iwasaki and Medzhitov, 2004). TLRs are a family of at least ten receptors able to recognize and discriminate highly conserved microbial structural motives of bacteria, viruses, fungi and protozoae. Their activation results in an immune response accompanied by increased levels of pro-inflammatory and immunerelated cytokines. Successively, maturation of dendritic cells and migration to regional lymph nodes followed by a facilitated presentation of antigens to T lymphocytes was described (Iwasaki and Medzhitov 2004). In order to ensure the ideal combination of adjuvant (e.g., Toll-like receptor agonist) and antigen or antigen producing unit (plasmid DNA vaccine) in the same vaccine formulation, we investigated the new strategy of coupling the adjuvant to the delivery system followed by particle preparation incorporating the plasmid DNA. As delivery system, we selected the polysaccharide chitosan (molecular weight ≥ 100,000 Da), which demonstrated promise for pulmonary DNA vaccination (Bivas-Benita et al, 2005). Starting from chitosan, we developed a new water-soluble polymeric chitosan derivative, 6-O-carboxymethyl-N,N,N-trimethyl chitosan (CM-TMC) possessing a distinct carboxylic moiety for further coupling/grafting of amine-based targeting ligands. 200 At first, we opted for an adjuvant with the Pam3Cys moiety (TLR-2 agonist), which demonstrated promise in several preclinical studies (see chapter 4). We established a new chemical synthesis for the grafting of Pam3Cys through a PEG spacer to CM-TMC (chapter 3). The successful grafting in CM-TMC-g-PEG-Pam3Cys was confirmed by using spectroscopic (1H and 13C NMR, mass, UV/VIS and FTIR) and chromatographic (SEC- MALLS) methods. Successively, Pam3Cys functionalized nanoparticles (NP) were prepared by complex coacervation with plasmid DNA (pDNA) expressing green fluorescence protein (GFP). pDNA NP were of around 400 nm in size, and displayed a positive zeta potential of 27.9 ± 1.6 mV. Furthermore, NP had the ability to protect against DNAse I enzymatic degradation and to transfect A549 cells. Regarding immunogenicity, in vitro studies using phorbol 12-myristyl 13-acetate (PMA) stimulated human macrophage-like THP-1 (mTHP-1) cells demonstrated that functionalization of pDNA NP induced IL-8 secretion by mTHP-1 macrophages, which was increased by 10fold compared to non-functionalized carriers. In the course of our studies, we subjected a further potential adjuvant to examination of adjuvant properties in a chitosan based vaccine delivery system: 9-benzyl-8hydroxyadenine (8HA), a TLR-7 agonistic moiety (see chapter 5). In analogy to our precedent study, we grafted 8HA by using a PEG spacer to carboxy functionalized CMTMC. The DNA carrier system CM-TMC-g-PEG-8HA was shown to exhibit comparable characteristics to CM-TMC-g-PEG-Pam3Cys in terms of size, charge, DNase I protection and transfection of A549 cells. With regard to immune stimulation, the CM-TMC-g-PEG8HA co-polymer and successive pDNA NP formulation were shown to elicit superior IL-8 and IL-12 related immune responses using mTHP-1 macrophages, when compared to their non-functionalized counterparts. As a summary of part II of this thesis, we have clearly demonstrated that functionalization of a vaccine delivery device (polymeric 201 chitosan) with TLR agonistic moieties is a chemically feasible procedure. In addition, pDNA NP based on these co-polymers have the ability to transfect A549 cells and to elicit a superior immune response in vitro. In part III of this thesis, we aimed at first to investigate in a more systematic manner the uptake of NP uptake upon deposition in the respiratory tract (chapter 6). Hereby, we applied a triple cell culture model being composed of bronchial epithelial cells, monocyte-derived macrophages (MDM) and monocyte-derived dendritic cells (MDDC). First, we focused on elucidating whether TLR-2 functionalized NP can reach MDDC being located beneath the epithelium. In our experiment, pDNA loaded NP were administered via microsprayer onto the in vitro model and cellular uptake of NP was visualized after 24h by staining of cell inserts followed by confocal laser scanning microscopy (CLSM). Interestingly, we noticed pDNA NP transfer into MDDCs independent of modification with the TLR-2 agonist Pam3Cys. On the other side, the functionalization of pDNA NP with the TLR-2 agonist Pam3Cys correlated with an enhanced induction of two proinflammatory cytokines, IL-8 and TNF-α, respectively. Hence, we can conclude that chitosan-based pDNA delivery systems had the ability to reach MDDC and that the inclusion of the Pam3Cys moiety enabled a higher immunogenicity being advantageous for pulmonary immunization. In order to study the potential of the CM-TMC-g-PEG-Pam3Cys co-polymer for pulmonary pDNA vaccination, we involved a pDNA vaccine encoding for the mycolyl-transferase protein Ag85A (abbreviated pAg85A) of Mycobacterium Tuberculosis (MTb). The plasmid pAg85A vaccine is among the most studied pDNA vaccines against MTb and showed promise due to its strong Th1 response in vivo (see chapter 7). In our study, Pam3Cys functionalized pAg85A NP were applied intranasally (IN) and intramuscularly (IM) into C57BL/6 mice. For IM immunizations, significant immune 202 responses were only obtained for IM vaccinations using pAg85A without chitosan formulation when IL-2 (spleen) and IFN-γ (spleen) secretions were analysed. With regard to IN immunizations, significant IFN-γ productions were seen with the ranking of pAg85A alone > TMC pAg85A NP. Ag85A-specific antibodies were only remarked by IM pAg85A vaccination. In a nutshell, pAg85A chitosan NP, with or without TLR-2 agonist functionalization, did not demonstrate superior immunogenicity over IM pAg85A vaccination. A reason for that is probable the relatively low transfection efficiency of chitosan DNA nanoparticles in vivo being indicated by Western Blot experiment and GFP transfection studies in A549 cells. In order to approach this problematic issue and improve DNA delivery, several factors affecting chitosan’s gene delivery efficiency were described. At first, in chapter 5 was revealed that the molecular weight influences DNA transfection in vitro. Mao et al. (2010) presented further decisive parameters affecting the DNA transfection in vitro and in vivo, such as chitosan’s degree of deacetylation, N/P ratio between positively charged polymer and negatively charged pDNA and pH of culture medium. Within the scope of further DNA vaccination studies, the following concepts might be helpful for the optimization of chitosan-based DNA delivery: i) the absorption of pDNA vaccine onto unloaded TPP-crosslinked chitosan nanoparticles, ii) optimization of DNA transfection efficiency by varying the molecular weight and degree of acetylation, iii) modification of chitosan nanoparticles with targeting moieties, that enhance DNA transfection in vivo, iv) the inclusion of highly DNA transfective polymers into chitosan nanoparticles, v) the use of chitosan or chitosan derivatives as coating material for other polymers (e.g., PLGA) in order to provide a versatile particle technology for DNA delivery. 203 References Aneja, M.K., Geiger, J.P., Himmel, A. and Rudolph, C. Targeted gene delivery to the lung, Expert Opin. Drug Deliv. (2009) 567-583. Bivas-Benita, M., van Meijgaarden, K.E., Franken, K.L., Junginger, H.E., Borchard, G., Ottenhoff, T.H. and Geluk, A. Pulmonary delivery of chitosan-DNA nanoparticles enhances the immunogenicity of a DNA vaccine encoding HLA-A*0201-restricted T-cell epitopes of Mycobacterium tuberculosis, Vaccine. (2004) 22, 1609-1615. Bivas-Benita, M., Ottenhoff, T.H., Junginger, H.E. and Borchard, G. Pulmonary DNA vaccination: concepts, possibilities and perspectives, J. Control. Rel. (2005) 107, 1-29. Bivas-Benita, M., Lin, M.Y., Bal, S.M., van Meijgaarden, K.E., Franken, K.L., Friggen, A.H., Junginger, H.E., Borchard, G., Klein, M.R. and Ottenhoff, T.H. Pulmonary delivery of NA encoding Mycobacterium tuberculosis latency antigen Rv1733c associated to PLGA-PEI nanoparticles enhances T cell responses in a DNA prime/protein boost vaccination regimen in mice, Vaccine (2009) 27, 4010-4017. Giudice, E.L. and Campbell, J.D. Needle-free vaccine delivery, Adv. Drug Deliv. Rev. 58 (2006) 68-89. O´Hagan, D.T., Singh, M. and Ulmer, J.B. Microparticle-based technology for vaccines. Methods (2006) 40, 10-19. Heit, A., Busch, D.H., Wagner, H. and Schmitz, F. Vaccine protocols for enhanced immunogenicity of exogenous antigens. Int. J. Med. Microbiol. (2008) 298, 27–32. Iwasaki, A. and Medzhitov, R. Toll-like receptor control of the adaptive immune responses. Nat. Immunol. (2005) 5, 987-995. 204 Lombry, C., Marteleur, A., Arras, M., Lison, D., Louahed, J., Renauld, J.C., Préatand, V. and Vanbever, R. Local and systemic immune responses to intratracheal instillation of antigen and DNA vaccines in mice, Pharm. Res. (2004) 21, 127-135. Low, N., Kraemer, S., Schneider, M. and Restrepo, A.M. Immunogenicity and safety of aerosolized measles vaccine: systematic review and meta-analysis. Vaccine (2008) 26, 383-398. Lu, D. and Hickey, A.J. Pulmonary vaccine delivery, Expert Rev. Vaccines 6 (2007), 213226. Mao, S., Sun, W. and Kissel, T. Chitosan-based formulations for delivery of DNA and siRNA. Adv. Drug Deliv. Rev. (2010) 62, 12-27. Miller, M.A. and Pisani, E. The cost of unsafe injections, Bull. World Health Organ. 77 (1999) 808-811. Orson, F.M., Kinsey, B.M., Densmore, C.L., Nguyen, T., Wu, Y., Mbawuike, I.N. and Wyde, P.R. Protection against influenza infection by cytokine-enhanced aerosol genetic immunization, J. Gene Med. (2006) 8, 488-497. Sanders, N., Rudolph, C., Braeckmans, K., De Smedt, S.C. and Demeester, J. Extracellular barriers in respiratory gene therapy, Adv. Drug Deliv. Rev. (2009) 61, 115-27. Schlosser, E., Mueller, M., Fischer, S., Basta, S., Busch, D.H., Gander, B., Groettrup, M. TLR ligands and antigen need to be coencapsulated into the same biodegradable microsphere for the generation of potent cytotoxic T lymphocyte responses. Vaccine (2008) 26, 1626-1637. Simon, J.K., Levine, M.M., Weniger, B.G. and Restrepo, A.M.H. Mucosal immunization and needle-free injection devices. New Generation Vaccines (2010) 4th edition, 405414. 205 Woodland, D.L and Randall, T.D. Anatomical features of anti-viral immunity in the respiratory tract, Semin. Immunol. 16 (2004), 163-170. 206 Chapter 9 Summary of thesis 207 The investigations described in this thesis aimed at the evaluation of novel adjuvant functionalized DNA carrier systems for pulmonary vaccination. Plasmid DNA vaccination confers the induction of a potent cytotoxic T lymphocyte response being required for the prevention of intracellular pathogens (e.g., Mycobacterium tuberculosis). Despite promising results of plasmid DNA immunizations in pre-clinical trials, studies in non-human primates and humans have failed so far in achieving protective immunity. The main reason for this drawback was related to the low transfection efficacy of plasmid DNA vaccines. Therefore amelioration strategies (in dependence of the targeted infectious diseases) were undertaken, ranging from plasmid DNA optimization, formulation into particles, inclusion of adjuvants to changing the route of administration, to e.g., aerosol vaccination. Aerosol delivery of vaccines is considered a promising route of immunization. The unique architecture of the human lung enables the induction of both, local and systemic immunity against pulmonary invading pathogens due to the presence of respiratory APC (macrophages and dendritic cells) and the bronchus-associated lymphoid tissue (BALT). A current clinical phase II/III trial involving an aerosol device for the administration of a measles vaccine into 2000 human objects underlines the potential of vaccination to the lung. Moreover, the common strategy to improve the effectiveness of vaccines is to formulate the antigen or antigen producing plasmid into particles together with the inclusion of a potent stimulator of the innate immune system (adjuvant) leading to an increased immunogenicity and adaptive immunity against subsequent infection challenge. We addressed the need of such a modified DNA delivery system and synthesized novel stimulators of innate immune receptors (Toll-like receport (TLR) agonists). 208 Successively, we used these adjuvants for the functionalization of DNA nanoparticles based on a chitosan polymer. In part II of this thesis, we synthesized at first different water-soluble TLR agonists: NH2PEG-Pam3Cys targeting the TLR-2 (chapter 3) and NH2-PEG-8HA targeting the TLR-7 (chapter 5). TLR agonisitic moieties we then grafted onto a novel water-soluble chitosan derivative, CM-TMC, respectively. The successful grafting in CM-TMC-g-PEG-Pam3Cys and CM-TMC-g-PEG-8HA was confirmed by using spectroscopic (NMR, mass, UV/VIS and FTIR) and chromatographic (SEC-MALLS) methods. Separately, these co-polymers were used for the preparation of DNA NP by complex coacervation. Both DNA carrier systems demonstrated the following physico-chemical and biological properties: i) particle size was around 400 nm; ii) positive surface charge; iii) ability to protect the DNA against DNAse I enzymatic degradation; iv) relative low cytotoxicity at concentrations employed for biological assays and v) transfection capability (5-10%) in A549 cells. Regarding immunogenicity of the CM-TMC-g-PEG-Pam3Cys DNA carrier, further in vitro studies using phorbol 12-myristyl 13-acetate (PMA) stimulated human macrophage-like THP-1 (mTHP-1) cells demonstrated that functionalization of DNA NP induced IL-8 secretion by mTHP-1 macrophages, which was increased by ten-fold compared to non-functionalized carriers (chapter 4). In addition, the inclusion of the TLR-7 agonistic moiety in CM-TMC-g-PEG-8HA DNA NP demonstrated gain in immune stimulation owing to superior IL-8 (two-fold) and IL-12 (two-fold) cytokine secretions from mTHP-1 macrophages, when compared to their unfunctionalized counterparts (chapter 5). In part III of this thesis, we investigated in a more systematic manner the uptake of CMTMC-g-PEG-Pam3Cys pDNA NP uptake by using a triple cell culture model of the human respiratory tract (chapter 6). Interestingly, we were able to detect internalization of 209 chitosan-based pDNA NP into monocyte-derived dendritic cells (MDDCs) irrespective of the functionalization with the TLR-2 agonist Pam3Cys. On the other side, the functionalization of pDNA NP with the TLR-2 agonist Pam3Cys correlated with an increased induction of two pro-inflammatory cytokines, IL-8 and TNF-α, respectively. This study allows the conclusion that chitosan-based pDNA carrier systems had the ability to reach MDDC and that the inclusion of the Pam3Cys moiety elicited a superior immunogenicity being advantageous for immunization. In addition, we examined the potential of the CM-TMC-g-PEG-Pam3Cys co-polymer for intranasal/pulmonary DNA vaccination in vivo (chapter 7). Hereby, we involved a pDNA vaccine (pAg85A) encoding for the mycolyl-transferase protein Ag85A of Mycobacterium Tuberculosis (MTb). We formulated CM-TMC-g-PEG-Pam3Cys pAg85A NP and applied them intranasally (IN) and intramuscularly (IM) into C57BL/6 mice. In view of cytokine secretions (IL-2, IFN-γ) from immune organs (spleen, lymph nodes) as well as titer of specific antibodies, we did not observe a superior immunogenicity of i) IN vaccinations and ii) TLR-2 agonist functionalization of pAg85A NP, when compared to IM pAg85A vaccination. An explanation might be the relative low transfection efficiency of chitosan DNA nanoparticles in vivo. Related to that, several strategies were proposed in order to solve this problem and to enhance the DNA transfection efficiency (chapter 8). 210 Chapter 10 Résumé de these 211 Ce travail de thèse vise à l´évaluation de nouvelles nanoparticules (NP) vectorisant un antigène sous forme d’acide nucléique, fonctionnalisées par de puissants adjuvants pour une vaccination par voie respiratoire. La vaccination par ADN est une nouvelle approche vaccinale pour induire une réponse immunitaire spécifique contre un agent pathogène. Suite à son administration, un vaccin à ADN permet la synthèse in vivo de l´antigène, puis sa présentation sous forme de peptides antigéniques par les molécules du complexe majeur d´histocompatibilité (CMH) de classe I. Par conséquent, les lymphocytes T CD8+ sont stimulés, et déclenchent une réponse cytotoxique dirigée contre l´antigène . Malgré des résultats pré-cliniques prometteurs de vaccination par ADN, les essais réalisés chez le primate ou chez l’Homme n´ont pas permis l’induction d’une réponse immunitaire protectrice. A cause de cela, plusieurs stratégies ont été proposées, comme le changement de la voie d’administration, la complexation de l’ADN avec un polymère sous forme (nano)particulaire ou l´ajout d´un adjuvant. La vaccination par la voie respiratoire est considérée comme prometteuse en vertu de plusieurs études portant sur des vaccins contre la rougeole, au niveau clinique. Actuellement, un vaccin contre la rougeole est en cours d´essai clinique (phase II/III) initié par l´OMS, qui va examiner l´efficacité et la sécurité de cette voie vaccinale. De plus, la stratégie prédominante pour améliorer l´efficacité des vaccins consiste en la formulation de l´antigène et de l´adjuvant dans le même vecteur de vaccination. Dans le cadre de nos études, deux adjuvants ont été choisis et synthétisés : un agoniste de Toll-like receptor-2 NH2-PEG-Pam3Cys (chapitre 3) et un agoniste de Toll-like receptor-7 NH2-PEG-8HA (chapitre 5). Nous avons ensuite greffé séparément ces deux molécules TLR agonistes sur un nouveau dérivé chimique de polymère chitosan (CMTMC). 212 La réussite de la greffe a été vérifiée avec des méthodes spectroscopiques (RMN, masse, UV/VIS, IR) et chromatogéniques (SEC-MALLS). Ce nouveau co-polymère est capable de former des NP par complexation avec l´ADN en donnant les propriétés suivantes : i) une taille de 400 nm environ ; ii) une charge de surface positive ; iii) la capacité de protéger l´ADN contre les dégradations enzymatiques par la DNAse I ; iv) une cytotoxicité relativement faible au vu des concentrations utilisées pour les essais biologiques et v) la capacité de transfection (5-10%) dans des cellules A549. Concernant l´immunogenicité de CM-TMC-g-PEG-Pam3Cys ADN NP, une étude in vitro utilisant des cellules THP-1, lignée de macrophages humains, a montré que la fonctionnalisation de l´ADN sous forme particulaire avec l´adjuvant Pam3Cys (TLR-2 agoniste) induisait une sécrétion d´IL-8 dix fois plus importante que celle induite par l´ADN vecteur non-modifié (chapitre 4). De la même façon, la fonctionnalisation de l´ADN NP avec le TLR-7 agoniste (8HA) a montré une immunogénicité supérieure en analysant la sécrétion de deux cytokines (IL-8, IL-12) par les cellules THP-1 (chapitre 5). Dans la deuxième partie expérimentale (partie III) de cette thèse, nous avons étudié l´internalisation de CM-TMC-g-PEG-Pam3Cys ADN NP dans un modèle in vitro de muqueuse bronchique reconstruite. Ce modèle « à trois étages » est composé de cellules épithéliales bronchiques, couvrant des cellules dendritiques dérivées de monocytes (CDDM) et recouvertes par des macrophages dérivés de monocytes (MDM, chapitre 6). Nous avons détecté l´internalisation de l´ADN NP dans des CDDM indépendamment de sa fonctionnalisation par le TLR-2 agoniste. En revanche, la fonctionnalisation de NP par le Pam3Cys est en corrélation avec une immunogenicité supérieure, due à des concentrations élevées de deux cytokines pro-inflammatoires, IL-8 and TNF-α. Enfin, nous avons examiné le potentiel adjuvant du co-polymère CM-TMC-g-PEGPam3Cys pour la vaccination à ADN par la voie intranasale/pulmonaire in vivo (chapitre 213 7), en utilisant le vaccin à ADN pAg85A, exprimant l´agent antigène 85A de Mycobacterium Tuberculosis (MTb). Le plasmide pAg85A a été vectorisé avec CM-TMC-gPEG-Pam3Cys sous forme nanoparticulaire, administré par voie intranasale (IN) et intramusculaire (IM) chez la souris C57BL/6. En analysant la sécrétion de cytokines (IL2, IFN-γ) par les cellules des organes immunitaires (rates, ganglions) et les titres d’anticorps spécifiques de l’antigène, aucun avantage immunogénique n’a été observé concernant i) la vaccination par la voie intranasale par rapport à la voir IM et ii) la fonctionnalisation ou non de pAg85A NP avec l´agoniste de TLR-2 (Pam3Cys). Une explication plausible pourrait être la relativement faible capacité des vecteurs dérivés de chitosan de transfecter des cellules in vivo. Plusieurs stratégies pour aborder ce problème et pour améliorer l´efficacité de la transfection sont présentées dans le chapitre 8. 214 List of Abbreviations AIDS acquired immunodeficiency syndrome APC antigen-presenting cells BALT broncho-alveolar lymphoid tissue CLSM confocal scanning laser microscopy CM-TMC 6-0-carboxymethyl-N,N,N-trimethylchitosan CO2 carbon dioxide CTL cytotoxic T lymphocyte EDC 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide ELISA enzyme-linked immunosorbent assay FCS foetal calf serum GFP green fluorescence protein GM-CSF granulocyte/macrophage colony-stimulating factor 8HA 2-chloro-9-benzyl-8-hydroxyadenine HBE bronchial 16HBe14o- cells HIV human immunodeficiency virus IFN interferon IL interleukin LE loading efficiency LMC low molecular weight chitosan LPS lipopolysaccharide MDDC monocyte-derived dendritic cells MDM monocyte-derived macrophages mTHP-1 macrophage-like THP-1 cells 215 NHS N-hydroxysuccinimide NH2-PEG-Pam3Cys amido-[Nα-palmitoyl-oxy-S-[2,3-bis(palmitoyl-oxy)-(2R)-propyl][R]–cysteinyl]-α-amino poly(ethylene glycol) NP nanoparticles mAB monoclonal antibody MHC major histocompatibility complex MTb Mycobacterium tuberculosis PAMP pathogen-associated molecular pattern PBS phosphate buffered saline pDNA plasmid deoxyribonucleic acid PEG poly(ethylene) glycol PEI polyethylene imine PLGA poly(D,L-lactide-co-glycolide) PMA phorbol 12-myristyl 13-acetate PN passage number PRR pattern-recognition receptor SARS severe acute respiratory syndrom rAg85A recombinant protein antigen 85A TEM transmission electron microscopy Th T helper cell TLR toll-like receptor TNF-α tumor necrosis factor alpha WHO World Health Organization 216 Publications 1. Esmaeili, F., Heuking, S., Junginger, H.E. and Borchard, G. Progress in chitosan-based vaccine delivery systems, Journal of Drug Delivery and Science Technology (2010) 20, 53-61. 2. Heuking, S., Iannitelli, A., Di Stefano, A. and Borchard, G. Toll-like receptor-2 agonist functionalized biopolymer for mucosal vaccination. International Journal of Pharmaceutics (2009) 381, 97-105. 3. Heuking, S., Adam-Malpel, S., Sublet, E., Iannitelli, A., di Stefano, A. and Borchard, G. Stimulation of macrophages using Toll-like receptor-2 (TLR-2) agonist decorated nanocarriers. Journal of Drug Targeting (2009) 17, 662-670. 4. Heuking, S. and Borchard, G. Functionalization with a TLR-7 agonist enhances the immunogenicity of chitosan DNA nanoparticles in human THP-1 macrophages. To be submitted 5. Heuking, S. ,Rothen-Rutishauser, B., Gehr, P. and Borchard, G. Fate of TLR-2 agonist functionalized pDNA nanocarriers upon deposition at the bronchial epithelium in vitro. To be submitted Oral Presentations 1. Heuking, S., Adam-Malpel, S., Sublet, E., Iannitelli, A., di Stefano, A. and Borchard, G. “Targeting of macrophages using Toll-like receptor-2 (TLR-2) agonist decorated nanocarriers”, June 23, 2009, PhD Day of the School of Pharmacy, Hermance, Switzerland. 2. Heuking, S., Adam-Malpel, S., Sublet, E., Iannitelli, A., di Stefano, A. and Borchard, G. “TLR agonists as adjuvants for the delivery of DNA vaccines into the lung”, July 24, 2009, WIV-Pasteur Institut, Mycobacterial Immunology, Brussels, Belgium. 217 3. Heuking, S., Adam-Malpel, S., Sublet, E., Iannitelli, A., di Stefano, A. and Borchard, G. “Functionalization of chitosan DNA nanoparticles with Toll-like receptor agonists for pulmonary vaccination”, November 3-5, 2009, Optimization of Inhaled Tuberculosis Therapies and Implications for Host-Pathogen Interactions, New Delhi, India. Awards Heuking, S., Adam-Malpel, S., Sublet, E., Iannitelli, A., di Stefano, A. and Borchard, G. “In vitro Evaluation of Toll-like Receptor-2 Agonist Functionalized Nanocarriers”, Swiss Pharma Science Day, Swiss Society of Pharmaceutical Sciences, September 2, 2009, Bern, Switzerland. 2nd poster price 218 Curriculum Vitae Simon Heuking Rue des Mouettes 9 CH-1227 Les Acacias Switzerland Phone (+41) 22 – 310 16 75 Fax: (+41) 22 – 379 65 67 Date of birth: 11/09/1978 Nationality: German WORK EXPERIENCE University of Geneva Geneva, Switzerland January 2006 – present Kreuz-Apotheke (Public Pharmacy) Dinslaken, Germany June – December 2005 Fontane-Apotheke (Public Pharmacy) Berlin, Germany November 2004 – April 2005 Pfizer Department of Pharmaceutical Research and Development, Sittingbourne, United Kingdom Project: Scale-down of small-scale coating machines. May – October 2004 Bayer AG Department of Pharmaceutical Analytics, Leverkusen, Germany Project: Release study of different pre-clinical compounds. August 2001 Klinikumsapotheke (Hospital Pharmacy) Duisburg, Germany March 2001 EDUCATION Study of Pharmacy University of Paris XI, Châtenay-Malabry, France (Erasmus Exchange Programme) February – July 2003 Study of Pharmacy Philipps – University of Marburg, Germany April 2000 – June 2005 Languages German English French Spanish Japanese Swedish native language fluent in speaking and writing (B2 level) fluent in speaking and writing (B2 level) intermediate knowledge (B1 level) basic knowledge (JLPT 4 exam) basic knowledge (A2 level) 219 Acknowledgements First and above all, my thanks go to Gerrit, who made this entire work possible. I remember well my very first days in Archamps in January 2006. As your first male PhD student in Archamps/Geneva, we had to create a lot of kinetic energy in order to set-up a working laboratory. There is a lot I would like to thank you for. Most important, I could always rely on your guidance and strong support throughout all these years we worked together. I learned a lot about science and how to organize myself due to many discussions and shared work. I was always appreciating your scientific way of thinking as well as your dedication for science and work. You are a great scientist and supervisor. Thank you a lot for all I could learn from you. I am especially grateful that you did not lose your faith in our projects, although primarily it took me quite some time for the synthesis and characterization of chitosan derivatives. In addition, I am exceedingly thankful for enabling the visit of international conferences (ITT, CRS, APV, GPEN, EUCHIS, …) and excellent laboratories (Imperial College, London; Pasteur-Institute, Brussels; Institute of Anatomy, Bern). These were enriching experiences giving me many insights about science from different perspectives. Besides work, I am very grateful for all your invitations to many great get-togethers. At this point, my warm thanks go as well to Christiane. She made every BBQ, dinner and get together to a remarkably delicious and exquisite event. I remember the many relaxed moments we laughed together and shared a beer either at Archamps or at your place. Life would not have been the same without my dear colleagues in Archamps. First, many thanks to Claudia for friendship and for your help, when I was confronting you with my crazy chemical and biological questions. We spent a lot of lab time together and I will be looking back to these days with a smile. It is an un-spoken secret that the best part of one´s thesis is done by technicians. My thesis was there no exeption and thus un grand 220 merci beaucoup to Emmanuelle for helping me with cell culture and cell biology. Also thanks to Sarah for setting up thoroughly our cell culture and cell biology labs. In addition, it is a further un-spoken secret in universities (probably also in other working structures) that the secretary is the unique heart of the institution. Merci beaucoup Valerie for welcoming me and your introduction into the french grammar, bonne vie pour toi. In Archamps, there was always time for a café outside, hence, motsahkern to Farnaz and tuck så mycket to Annasara for establishing savoir-vivre in Archamps. Namaste and dhanyawad to Akash for teaching me some hindi. A big merci to Charlotte for the edition of french summary; you are most welcome in Archamps. Many thanks/mille grazie to Antonio I. & Antonio di S. for your incredible help with all the very challenging chemical part of my PhD thesis. Thanks to all my bachelor and master students, I learned from you how in order to move our common projects forward. In Geneva (ScII), merci beaucoup to Olivier for you help with SEC-MALLS. Thanks to all members of the research groups “Pharmacie Galénique” and “Technologie Pharmaceutique” for welcoming me and philosophical discussions, e.g, about “bosón de higgs y sobre el sentido y la referencia” (¡gracias a Martha y Iván!). There is not enough space to name you all, however, I will express my gratitude as always with a fine confection of swiss chocolate. The neighbor lab of pharmaceutical biochemistry of Prof. Leonardo Scapozza was a second home for me. Grazie mille Leonardo S. for organizing our excellent PhD school. E´stato un vero piacere incontrarti. Herzlichen Dank/mille grazie to Remo, Ralitza, Leonardo L. and Patricia for your support for my DNA preparations and Western blots. Merci vielmal to Yvonne for your friendship; one day I will say Alegra and visit your Graubünden. Andrea, one day we have to play the “Kanon” de Johann Pachelbel. Shokran and hamdo illah to Majdeline. In addition, thanks to Elisabeth Rivara-Minten for your support with NMR spectroscopy. 221 Most interesting parts of PhD thesis consisted of visits of other excellent research labs. My stay at the Department of Mycobacterial Immunology (Pasteur-Institute, Brussels) was an eye-opener. My deepest gratitude goes to Kris Huygen. She has a great scientific mind. Shokran to Dorsaf for showing me how to manipulate mice and to perform successive immune analysis. I enjoyed the existentialist discussions with Olivier, Marta and Boussa and especially the guided tour through the mostly undiscovered second tower of the Pasteur-Institute. The Department of Histology (Instiute of Anatomy, Bern) was the second formidable event during my thesis. Special thanks go to Peter and Barbara B., who offered my the possibility to work in their labs. I felt at home and enjoyed plenty of support from this excellent research group. Herzliches Dankeschön to Barbara T. (cell culture), Andrea (staining), David R. (ELISA), Michael, David S. (canadian-swiss insights), Andrea (CLSM), Loretta, Christina (microsprayer), Dagmar, Mohammed (shokran) and Martin&Kirsten (scottish insights). From work to private, I am especially thankful for my friendship with Alex, who made my Genevian settling in much easier. I am looking forward to spend more time with you and your young wonderful familiy (Aurélie and Joanna). To me, the most important meaning in life are my families. To my parents in Germany, Werner and Hildegard, my deepest gratitude comes to you. I am also very fortunate to have two unique siblings, Lukas and Angela with family (Markus, Benjamin, Johannes and Moritz). Family moments are the most precious in my life and I am therefore very happy to have now a second family in Sweden: Eva, Rainer and Inga. Hjärtliga hälsningar och kramar och tack så mycket for your support and I am looking to move much closer to you. My beloved Pernilla, words are not enough for saying thank you and fortunately there will be plenty of other means to do that. I am full of joy for our own family with Emma Sophie. We have a life together. 222
© Copyright 2026 ExpyDoc