FEMS Microbiology Letters Advance Access published December 4, 2014 1 Identification and catalytic residues of the arsenite 2 methyltransferase from a sulfate-reducing bacterium, 3 Clostridium sp. BXM 4 Pei-Pei Wang1, Peng Bao1 and Guo-Xin Sun1* 5 6 7 1 8 Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing 100085, China. 9 *Corresponding author. Phone: 86-10-62849328, E-mail: [email protected] State Key Laboratory of Urban and Regional Ecology, Research Center for 10 11 Abbreviations: ArsM, arsenite S-Adenosyl-Methionine methyltransferase; As, 12 arsenic; SRB, sulfate-reducing bacterium; As(III), arsenite; Cys, cysteine; MMAs, 13 monomethylarsenic; 14 trimethylarsine oxide; IPTG, isopropyl β-D-thiogalactoside; TMAs, trimethylarsine; 15 DMAsH, dimethylarsine; GSH, glutathione; AdoMet, S-Adenosyl-Methionine; 16 MMAs(III), monomethylarsenite. DMAs, dimethylarsenic; 17 1 As(V), arsenate; TMAsO, 18 Abstract 19 Arsenic methylation is an important process frequently occurring in anaerobic 20 environments. Anaerobic microorganisms have been implicated as the major 21 contributors for As methylation. However, very little information is available 22 regarding the enzymatic mechanism of As methylation by anaerobes. In this study, 23 one novel sulfate-reducing bacterium isolate, Clostridium sp. BXM, which was 24 isolated from a paddy soil in our laboratory, was demonstrated to have the ability of 25 methylating As. One putative arsenite S-Adenosyl-Methionine methyltransferase 26 (ArsM) gene, CsarsM was cloned from Clostridium sp. BXM. Heterologous 27 expression of CsarsM conferred As resistance and the ability of methylating As to an 28 As-sensitive strain of E. coli. Purified methyltransferase CsArsM catalyzed the 29 formation of methylated products from arsenite, further confirming its function of As 30 methylation. Site-directed mutagenesis studies demonstrated that three conserved 31 cysteine residues at positions 65, 153, and 203 in CsArsM are necessary for arsenite 32 methylation, but only Cysteine 153 and Cysteine 203 are required for the methylation 33 of monomethylarsenic to dimethylarsenic. These results provided the characterization 34 of arsenic methyltransferase from anaerobic sulfate-reducing bacterium. Given that 35 sulfate-reducing bacteria are ubiquitous in various wetlands including paddy soils, 36 enzymatic methylation mediated by these anaerobes is proposed to contribute to the 37 arsenic biogeochemical cycling. 38 Keywords: arsenic; methylation; sulfate-reducing bacterium; methyltransferase; 39 conserved cysteine 2 40 41 Introduction 42 Arsenic (As) is a ubiquitous contaminant in the environment (Duker et al., 2005). 43 Anaerobic environments, such as sediments and wetlands, usually act as sinks or 44 secondary sources of As due to natural and anthropogenic activities. Some reducing 45 marine sediments might accumulate 3 mg g-1 As (Mandal and Suzuki, 2002). The 46 paddy soil system often accumulated relatively high concentration of As, particularly 47 in south Asia (Meharg and Rahman, 2003). It was estimated that about 1360 tons of 48 As are yearly added to arable soils in Bangladesh (Roberts et al., 2010). It has been 49 well established that anaerobic environments play an important role in the 50 transformation, mobilization and biogeochemical cycling of As (Brannon, 1987; 51 Ahmann et al., 1997; Bauer et al., 2008; Roberts et al., 2010; Vriens et al., 2013). 52 Arsenic methylation as an important process modulating As toxicity and 53 biogeochemical cycling is more prevalent under anaerobic conditions than aerobic 54 conditions. Arsenic methylation and volatilization have been observed in many paddy 55 soils (Mestrot et al., 2009; Mestrot et al., 2011; Huang et al., 2012; Jia et al., 2012). 56 Anaerobic microorganisms inhabited in these ecosystems have been regarded as 57 major contributors for As transformation including methylation (Bright et al., 1994). 58 It has been reported that methylated As species in rice plants originated from soil 59 microorganisms (Lomax et al., 2012; Jia et al., 2013). 60 Several microbial isolates and a microbial coenzyme called methylcobalamin are 61 capable of converting inorganic As to methylated forms (Zakharyan and Aposhian, 3 62 1999; Qin et al., 2006; Qin et al., 2009; Thomas et al., 2011; Yin et al., 2011; Ye et al., 63 2014), but the identification of the microorganisms that are actually responsible for 64 inorganic As methylation in anaerobic environments has rarely been clearly 65 demonstrated (Lomax et al., 2012; Jia et al., 2013; Zhao et al., 2013). In the past few 66 years, it has been identified that arsMs are the key microbial functional genes 67 responsible for As methylation (Qin et al., 2006; Ye et al., 2012). However, these 68 studies have mainly focused on aerobic bacteria or eukaryote, little attention was paid 69 to anaerobic microorganisms. The identification of As-methylating microorganisms 70 from anaerobic environments and their functional genes are of great importance in As 71 biogeochemistry. 72 Sulfate-reducing bacteria (SRB) are anaerobic microorganisms widely distributed 73 in the environment, including paddy soils, sea water, thermal springs, sediments and 74 human guts (Wakao and Furusaka, 1973; Leloup et al., 2007; Liu et al., 2009; Rey et 75 al., 2013). They are involved in numerous reactions of metal(loid)s (e.g., metal 76 reduction and precipitation) (Lloyd et al., 1998; Lloyd et al., 2001) and often 77 proposed as strategic microbes to treat water contaminated with a range of metals 78 (Chuichulcherm et al., 2001; Teclu et al., 2008). Numerous reports have showed that 79 SRB is the important methylator of mercury in natural sediments and soils (Compeau 80 and Bartha, 1985; King et al., 2000; Jay et al., 2002; Ekstrom et al., 2003), but it is 81 not clear if SRB is a significant As methylator so far. In this study, SRB Clostridium 82 sp. BXM previously isolated from a paddy soil in our laboratory was chosen as 83 anaerobic sedimentary microorganism to study As methylation (Bao et al., 2012). Our 4 84 main objectives were (1) to identity As methylation process in anaerobic 85 microorganism Clostridium sp. BXM, (2) to provide insight into the enzymatic 86 mechanism for As methylation in anaerobic SRB, (3) to identify catalytic residues of 87 ArsM enzyme and their function in As methylation. 88 89 Materials and methods 90 Organisms and cultivations 91 Clostridium sp. BXM was anaerobically grown in the medium (pH 7.2) contained 92 (g l-1): MgSO4•7H2O 0.5, CaCl2•2H2O 0.1, Na2SO4 0.75, NH4Cl 0.25, KH2PO4 0.3, 93 yeast extract 1.0, vitamin C 0.2, Na2S•9H2O 0.36, sodium lactate 3.5, at 30°C in the 94 dark. Standard anaerobic culturing techniques were used throughout the experiments 95 (Widdel and Bak, 1992; Bao et al., 2012). The medium was boiled and cooled to 96 room temperature under an atmosphere of highly pure N2 gas. Anaerobic medium was 97 dispensed into acid-cleaned serum bottles. Each serum bottle was sealed with a butyl 98 rubber stopper, covered with aluminum foil, and then autoclaved at 121°C for 20 min. 99 During incubation, the cultures were briefly shaken by hand once a day. 100 E. coli strains were grown aerobically at 37°C in LB medium, supplemented with 101 50 μg ml-1 kanamycin/ampicillin, or 0.3 mM IPTG as required. Strain DH5α 102 (Promega) was used for plasmid construction and replication. Strain AW3110(DE3) 103 [ΔarsRBC; ArsR-repressor; ArsB-As(III) efflux pump; ArsC-As(V) reductase] (Carlin 104 et al., 1995) was used for the expression and functional verification of arsM gene. 105 Strain BL21(DE3) was used for protein purification. 5 106 Arsenic methylation by Clostridium sp. BXM 107 Anaerobic medium in serum bottle was supplemented by 5.3 μM sodium arsenite 108 (NaAsO2) or sodium arsenate (Na3AsO4). The strain of Clostridium sp. BXM was 109 inoculated into the medium with 2% (v/v) inoculum. After the growth of 20 days, the 110 culture was centrifuged by 8000 r.p.m. The supernatant was filtrated by 0.45 μm 111 disposable filter, and oxidized by adding 10% (v/v) H2O2. All samples were kept in 112 the refrigerator at 4°C until analysis. Every experimental group was assayed for three 113 replicates. 114 Cloning of the arsM gene from Clostridium sp. BXM and its expression in E. coli 115 Genomic DNA was isolated from the culture of Clostridium sp. BXM by using 116 Genomic-Tip 20/G and Buffer set (Qiagen). Plasmid DNA was extracted with a 117 QIAPrep Spin Miniprep kit (Qiagen). To express the arsM from Clostridium. sp. 118 BXM in E. coli, a 813 bp fragment containing the ATG start codon and excluding the 119 TGA stop codon was PCR amplified from the genomic DNA of Clostridium sp. BXM 120 by using the forward primer: 5’-CGGAATTCATGGATAATATTCGAGAGGG-3’ 121 (EcoRI restriction endonuclease site underlined) and the reverse primer: 122 5’-CCCTCGAGTGCCGGCTTGGCTGCCCGAAT-3’ (XhoI restriction endonuclease 123 site underlined). PCR (94°C for 5 min, 94°C for 30 s, 58°C for 30 s, and 72°C for 1 124 min, 30 cycles) was performed with LA Taq DNA polymerase (Takara Bio). The PCR 125 product was cloned into PMD19T simple vector (Takara Bio) to create the plasmid 126 PMD19T-arsM. The sequence was verified by DNA sequencing. Then, after digestion 127 with EcoRI and XhoI, arsM fragment was again inserted into pET28a vector to create 6 128 the plasmid pET28a-arsM, in which arsM gene was controlled by T7 promoter. The 129 sequence was still verified by DNA sequencing. As a consequence, the His-tagged 130 ArsM was established composed of 314 amino acid residues, with a predicted 131 molecular mass of 33.95 kDa. 132 Plasmid pET28a or pET28a-arsM was transformed into E. coli strain 133 AW3110(DE3), which was As-hypersensitive. Transformed cells were grown in LB 134 medium containing 50 μg ml-1 kanamycin overnight at 37°C, then diluted 50-fold into 135 fresh LB medium containing 50 μg ml-1 kanamycin, 0.3 mM IPTG, and a series of 136 concentrations of As(III) (10, 20, 50 μM). After a growth of 20 h at 37°C, the culture 137 was centrifuged at 8000 r.p.m. The supernatant was filtrated by 0.45 μm disposable 138 filters, and oxidized by 10% (v/v) H2O2. All the samples were kept in the refrigerator 139 at 4°C until analysis. Every experimental group was assayed for three replicates. 140 Single colonies of E. coli AW3110 expressing pET28a or pET28a-arsM were 141 inoculated into LB medium (5 ml) contained 50 μg ml-1 kanamycin and cultured at 142 37°C overnight. Late exponential phase cells were diluted 100-fold into fresh LB 143 medium (50 ml) containing 50 μg ml-1 kanamycin, 0.3 mM IPTG and a series of 144 concentrations of As(III) (0, 20, 50, 100 μM). Cellular growths were monitored as 145 absorbance at 600 nm via UV-vis spectrophotometer (New Century, Model T6) and 146 continued until the cultures reached stationary phase. 147 Arsenic volatilization by E. coli AW3110 expressing arsM 148 Volatile As produced by E. coli expressing arsM was chem-trapped as described 149 (Huang et al., 2012). E. coli AW3110 expressing either pET28a-arsM or pET28a were 7 150 cultured in triangular flasks [250 ml volume; contained 100 ml LB medium with a 151 series of concentrations of As(III)]. Every flask was capped with a T-junction stopper 152 having a gas inlet and a gas outlet. The inlet was linked to a super silent adjustable air 153 pump (ACO-9601; 2-W power), to pump filtered air at a gas flow rate of 40 ml min-1 154 for refreshing the headspace of flask. The outlet of T-junction stopper was connected 155 to a glass trapping tube filled with AgNO3-impregnated silica gel beads. After 48 h 156 growth of E. coli, the total As absorbed by the trapping tube was eluted by 1% (v/v) 157 HNO3 (5 ml) in a microwave digestion system (Mars II, CEM, US). The eluted 158 solution was centrifuged at 6000 r.p.m. The supernatant was separated and filtrated by 159 0.45 μm disposable filter. The quantity of volatile As was tested by ICP-MS and the 160 As species was analyzed by HPLC-ICP-MS. 161 Purification of ArsM enzyme and As(III) methylation by purified enzyme in vitro 162 The strain E. coli BL21(DE3) expressing pET28-arsM was grown at 37°C in LB 163 medium (200 ml) to an A600 of 0.4-0.6, at which point 0.3 mM IPTG was added to 164 induce expression of His-tagged ArsM. After the 8 h growth, E. coli was harvested by 165 centrifugation (8000 r.p.m.) at 4°C for 20 min. The wet cells were suspended in 30 ml 166 of lysis buffer (buffer A: 50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0) 167 and lysed in ultrasonic cell disruption system (JY92-2D) at a program as follows: 168 working for 5 s followed a rest for 5 s, it continued for 20 min at 4°C. Membranes and 169 unbroken cells were removed by centrifugation at 8000 r.p.m. for 30 min. The 170 supernatant was separated, filtrated by 0.45 μm disposable sterile filter, and then 171 loaded onto a Ni(II)-NTA column (Qiagen; 5 ml) pre-equilibrated with buffer A. The 8 172 column was then washed with 200 ml of wash buffer (buffer B: 50 mM NaH2PO4, 173 300 mM NaCl, 20 mM imidazole, pH 8.0) and finally eluted with 5 ml of elution 174 buffer (buffer C: 50 mM NaH2PO4, 300 mM NaCl, 250 mM imidazole, pH 8.0) to 175 gain the purified ArsM protein. Solution containing ArsM was removed to a 10-kDa 176 ultrafiltration centrifuge tube (Sartorius) and concentrated by centrifugation at 8000 177 r.p.m. for 1 h. Finally, the buffer C bearing ArsM protein was replaced by MOPS 178 buffer (50 mM MOPS and 150 mM KCl, pH 7.4) using Micro Bio-SpinTM 179 Chromatography Column (Bio-Rad). ArsM was identified by sodium-dodecyl-sulfate 180 polyacrylamide gel electrophoresis (SDS-PAGE). Protein concentration was estimated 181 by the method of Bradford (Bio-Rad Protein Assay) (Bradford, 1976), using BSA 182 (Sigma) as a standard. 183 In vitro assay of As methylation was performed in the MOPS buffer containing a 184 certain concentration of ArsM protein, 8 mM GSH, 0.5 mM AdoMet and a series of 185 concentrations of As(III) (5, 10, 20 μM). The reactions were kept in water bath at 186 37°C for the different time (0.5, 1.5, 3, 4.5, 6, 7.5, 20 h). The reactions were 187 terminated by boiling for 5 min in the end. The reaction solutions were oxidized by 188 10% (v/v) H2O2 overnight, filtered by 0.45 μm filters. After a appropriate dilution, all 189 samples were analyzed for As species by HPLC-ICP-MS. 190 Preparation of CsArsM mutants 191 Substitutions of Cys65, Cys153, and Cys203 of the CsArsM for serine were 192 generated by site-directed mutagenesis through overlapping extension PCR with the 193 plasmid pET28a-arsM as the DNA template. The primers used for the site-directed 9 194 mutagenesis are listed in Table S1. PCR products were double-digested by EcoRI and 195 XhoI, and cloned into the prepared EcoRI/XhoI-digested pET28a vector. All of the 196 sequences of the arsM mutants were verified by DNA sequencing to ensure that no 197 errors had been introduced during amplification. E. coli BL21(DE3) was transformed 198 using vectors carrying different mutations of arsM gene. Protein expression, 199 purification, identification and concentration determination were performed as 200 described above. Three mutants of ArsM (C65S, C153S, C203S) were constructed. 201 Arsenic speciation analysis 202 Arsenic speciation was analyzed by HPLC-ICP-MS (7500a; Agilent Technologies) 203 as described (Zhu et al., 2008). Chromatographic columns were obtained from 204 Hamilton and consisted of a precolumn (11.2 mm; 12-20 μm) and a PRP-X100 10-μm 205 anion-exchange column (250 x 4.1 mm). The mobile phase consisted of 10 mM 206 diammonium hydrogen phosphate [(NH4)2HPO4] and 10 mM ammonium nitrate 207 [NH4NO3], adjusted to pH 6.2. The mobile phase was pumped through the column at 208 a flow rate of 1.0 ml min-1. 209 210 Results 211 Arsenic methylation by SRB Clostridium sp. BXM 212 When Clostridium sp. BXM was grown in the medium containing arsenite [As(III)] 213 or arsenate [As(V)] for 20 days, monomethylarsenic (MMAs) and dimethylarsenic 214 (DMAs) were detected (Fig. 1). About 9% of the total As in the medium has been 215 methylated to MMAs as well as about 1% to DMAs (Fig. S1). No methylated As was 10 216 detected in the control (no bacterial inoculation). This result suggested that 217 Clostridium sp. BXM have the capability of methylating As. 218 Cloning of the arsM gene from Clostridium sp. BXM 219 By homologous comparison with the As(III) methyltransferases previously reported 220 (Lin et al., 2002; Qin et al., 2006; Qin et al., 2009; Yin et al., 2011), a putative arsM 221 gene (813 bp) was cloned from the genome of Clostridium sp. BXM, and designated 222 as CsarsM. CsArsM protein encoded by CsarsM gene contained 270 residues, with a 223 predicted molecular mass of 29.06 kDa. 224 Comparative study based on protein sequences showed that CsArsM had the 225 highest similarity with the ArsM from anaerobic bacterium Rhodopseudomonas 226 palustris CGA009 (RpArsM) (53% identity and 84% similarity) (Qin et al., 2006). 227 With those aerobic cyanobacterial ArsMs (Yin et al., 2011), CsArsM shared lower 228 similarity (average 21% identity and 57% similarity). In addition, CsArsM also 229 exhibited significant, but lower similarity to mammalian AS3MT methyltransferase 230 (21% identity and 53% similarity) (Lin et al., 2002; Song et al., 2011), and to the 231 ArsM of eukaryotic alga Cyanidioschyzon sp. isolate 5508 (20% identity and 51% 232 similarity) (Qin et al., 2009). 233 CsArsM enzyme detoxified As(III) in vivo 234 CsarsM gene was expressed in an As-sensitive E. coli AW3110 (ΔarsRBC), which 235 had no orthologous arsM gene. Expression of arsM clearly conferred the strain 236 AW3110 with the resistance to As(III). Cells expressing CsarsM gene grew much 237 better than that bearing empty plasmid pET28a when exposed to 50 μM As(III) (Fig. 11 238 2). Although all bacteria exhibited a weak growth under 100 μM As(III), cells 239 expressing CsarsM gene showed a little better growth than that bearing empty vector 240 (Fig. 2). ArsM enzyme as the product of arsM gene maybe metabolize cellular As(III) 241 to less toxic methylated products for facilitating growth. In other words, ArsM 242 enzyme reduced the As toxicity in the cells, consistent with the idea that As 243 methyltransferase has an important physiological role in detoxifying As. 244 As(III) methylation and volatilization by E. coli AW3110 expressing arsM 245 DMAs and trimethylarsine oxide (TMAsO) except MMAs were observed in the 246 medium of E. coli expressing CsarsM gene by comparison with the control (Fig. 3A, 247 B). This result indicated that the enzyme encoded by CsarsM gene is indeed 248 responsible for As(III) methylation. The time-course of As methylation by the strain 249 AW3110 expressing CsarsM showed that TMAsO and DMAs have accumulated in 250 the medium after 3 h incubation and increased with the culture time increasing, 251 concomitant with a decrease of inorganic As (Fig. 3B). No detectable MMAs was 252 observed throughout the experiment (within 20 h). Since the expression of CsarsM 253 gene was controlled by T7 promoter, as well as with the induction of isopropyl 254 β-D-thiogalactoside (IPTG), abundant CsArsM protein may be produced and could 255 quickly convert MMAs to DMAs in the recombinant E. coli. About 10% of total As 256 was transformed into DMAs and another 10% into TMAsO by E. coli in the presence 257 of 10 μM As(III) (Fig. 3A). The total As in the medium of E. coli expressing CsarsM 258 is a bit lower than corresponding control (empty vector), probably attributed to As 259 volatilization in the former. 12 260 E. coli AW3110 expressing CsarsM gene effectively volatilized As when exposed 261 to different As(III) concentrations (Fig. 3C). The major gaseous product was TMAs 262 which was oxidized and identified as TMAsO, together with tiny amount of 263 dimethylarsine (DMAsH) detectable as oxidized DMAs (Fig. S2). The amount of As 264 volatilization in 100 μM As(III) was more than that in 50 μM As(III) (Fig. 3C), 265 though the cellular growth in the former was much weaker than that in the latter (Fig. 266 2). 267 Methylation of As(III) by purified ArsM enzyme in vitro 268 To further elucidate the function of CsarsM gene in As methylation, corresponding 269 CsArsM protein was purified from recombinant E. coli cytosol for its As methylation 270 activity analysis (Fig. 4A). Cofactor glutathione (GSH) as a necessary component was 271 used to form As–GSH complex, which was optimal substrate for ArsM enzyme. 272 S-Adenosyl-Methionine (AdoMet) was used as the methyl donor in ArsM-catalyzed 273 As(III) methylation reaction in vitro. CsArsM enzyme converted As(III) to MMAs 274 after 0.5 h, with small amount of DMAs appearing at 1.5 h (Fig. 4B). The 275 concentrations of DMAs and MMAs kept increasing during the experiment process, 276 concomitant with the decrease of inorganic As (Fig. 4B). At 20 h, DMAs became the 277 dominant organic As species. Only little MMAs have been produced within 20 h 278 compared to DMAs. TMAsO had not appeared until the time got to 20 h. 279 About 45% of the total As was converted to the organic As by CsArsM in the 280 presence of 5 μM As(III) (Fig. 4C). The total amount of methylated As increased with 281 the increasing As(III) concentrations in the reaction system (Fig. 4C), although the 13 282 percentage of that indeed decreased. In the presence of 20 μM As(III), about 23% of 283 inorganic As was methylated by CsArsM (Fig. 4C). In the absence of GSH or AdoMet, 284 no methylated species were observed (data not shown). 285 Conserved cysteine (Cys) residues Cys65, Cys153, and Cys203 of CsArsM 286 All ArsM proteins identified to date have three conserved cysteine residues 287 (Thomas et al., 2007; Hamdi et al., 2012; Ye et al., 2012), at positions 72, 174, and 288 224 in CmArsM of eukaryotic alga Cyanidioschyzon sp. 5508 (Marapakala et al., 289 2012), which were responsible for As methylation. The conserved cysteine residues in 290 CsArsM were Cys65, Cys153, and Cys203. To elucidate the function of three 291 conserved cysteines in As methylation, Cys65, Cys153, and Cys203 in CsArsM were 292 substituted for serines, respectively, creating the mutants of C65S, C153S and C203S. 293 All three mutants lost their activities of As(III) methylation completely (Fig. 5A). In 294 contrast, methylation of MMAs was completed by the C65S mutant but not by the 295 C153S or C203S (Fig. 5B). These results suggest that the three conserved cysteines 296 (Cys65, Cys153 and Cys203) are required for the first methylation step [from As(III) 297 to MMAs], while only Cys153 and Cys203 are required for the second methylation 298 step (from MMAs to DMAs) in the Challenger’s pathway (Challenger, 1945; Cullen 299 and Reimer, 1989). Note that Cys29, Cys30 and Cys262 in CsArsM were not 300 conserved in other ArsM orthologues and their single mutations did not affect 301 enzymatic activity of As methylation (data not shown). 302 303 Discussion 14 304 Due to the critical role of microorganisms in As biogeochemical cycling in wetland 305 and water environments, it is important to understand As transformation by anaerobic 306 bacteria (Tsai et al., 2009). The methylation of As is one of the key processes 307 governing the fate of As in the environment, and thus detailed understanding of the 308 mechanism of As methyltransferase is crucial. This study provided the insight into a 309 newly identified arsenite S-Adenosyl-Methionine methyltransferase from anaerobic 310 SRB, which play crucial roles in As transformation of anaerobic environments (Kirk 311 et al., 2004; Oremland et al., 2004). CsArsM enzyme encoded by CsarsM gene 312 cloned from SRB Clostridium sp. BXM conferred the ability of methylating and 313 volatilizing As to As-sensitive strain of E. coli, concomitant with an increase of 314 cellular tolerance to As. These results suggest that ArsM-mediated As methylation in 315 SRB is a mechanism for relieving cellular toxicity of As. 316 By the site-directed mutagenesis studies, we confirmed that three residues of 317 CsArsM, Cys65, Cys153, and Cys203 are required for As(III) methylation, while only 318 Cys153 and Cys203 are necessary for MMAs methylation. These cysteines are 319 conserved in all ArsM and AS3MT proteins identified to date (Thomas et al., 2007; 320 Ye et al., 2011; Ye et al., 2012). For example, they are homologous to Cys72, Cys174, 321 and Cys224 of CmArsM from eukaryotic alga Cyanidioschyzon sp. 5508 (Marapakala 322 et al., 2012). It was reported that the substitution of Cys72, Cys174, or Cys224 led to 323 loss of As(III) methylation, while the substitution of Cys174 or Cys224 abolished the 324 methylation of monomethylarsenite [MMAs(III)]. These cysteines affected the 325 binding of As(III) or MMAs(III) to CmArsM enzyme during the methylation process. 15 326 Similarly, the ArsM from Danio rerio has been identified to possess two conserved 327 residues, Cys160 and Cys210, which were suggested to be related to As(III) binding 328 (Hamdi et al., 2012). To the recombinant human AS3MT enzyme (Geng et al., 2009), 329 Cys72, Cys156 and Cys206 have been proved to be functionally conserved, any 330 substitution of which abolished enzymatic activity in As methylation (Song et al., 331 2009, 2011). 332 Inorganic As predominately undergoes successive oxidative and reductive 333 methylation reactions: As(III) → MMAs → DMAs → TMAs (Challenger, 1945). 334 Dimethylated As is the major product of purified CsArsM, with relatively less 335 amounts of MMAs and TMAsO produced (Fig. 4C). DMAs can bind to only a single 336 thiol of ArsM and readily dissociates from enzyme (Kitchin and Wallace, 2006). This 337 would cause that the third methylation step (from DMAs to TMAs) occurs difficultly 338 and less TMAsO is produced. The product MMAs of the first methylation step can 339 bind to two thiols of ArsM enzyme. The resulting complex is relatively stable and 340 prone to the second step of methylation (Kitchin and Wallace, 2006; Kitchin, 2011), 341 causing less MMAs accumulation and more DMAs production. DMAs accumulates 342 as the principal product in the reaction system. 343 Arsenic methylation in soils increased with the decrease of redox potential (Frohne 344 et al., 2011), suggesting that it may occur more easily in anaerobic microorganisms 345 than aerobic microorganisms (Wang et al., 2014). Wetlands, a typical submerged soil 346 with low redox potential, have been recognized as important sinks for As, and 347 typically play an important role in As transformation and mobilization (Vriens et al., 16 348 2013). Our results demonstrating the ability of As methylation by SRB may have 349 implications to other anaerobic microorganisms. Elucidating such processes is critical 350 in predicting the metabolic pathways and fate of As in the environment. For example, 351 As methylation in soil influences its accumulation by rice (Jia et al., 2013) and 352 methylated As in rice grains was greatly increased when rice was grown in anaerobic 353 soil compared with the corresponding aerobic soil (Xu et al., 2008; Arao et al., 2009). 354 This phenomenon was due to anaerobic microbial activities in paddy soil. It has been 355 implicated that SRB is among the key functional microorganisms in paddy soil and 356 they may contribute to the generation of methylated As (Liu et al., 2009; Lomax et al., 357 2012). The activities of SRB in paddy soil may reduce the ecological and health 358 effects of As pollution by transforming As from the more hazardous forms to less 359 toxic or volatile methylated forms. SRB have shown the potential for the use in the 360 remediation of environments contaminated with toxic metal(loid)s (Jong and Parry, 361 2003; Teclu et al., 2008). Considering its ubiquity in sediments and wetlands, it seems 362 that SRB could play a significant role in As remediation and biogeochemical cycling 363 in widespread anaerobic environments. 364 365 Acknowledgements 366 This project was financially supported by the Natural Science Foundation of China 367 (No. 41371459), the State Key Program of Natural Science Foundation of China (No. 368 41330853) and the National High Technology Research and Development Program of 369 China (863 Program, 2013AA06A209). 17 370 371 References 372 Ahmann D, Krumholz, LR, Hemond HF, Lovley, DR & Morel FMM (1997) 373 Microbial mobilization of arsenic from sediments of the Aberjona watershed. 374 Environ Sci Technol 31: 2923-2930. 375 Arao T, Kawasaki A, Baba K, Mori S & Matsumoto S (2009) Effects of water 376 management on cadmium and arsenic accumulation and dimethylarsinic acid 377 concentrations in Japanese rice. Environ Sci Technol 43: 9361-9367. 378 Bao P, Hu ZY, Wang XJ, Chen J, Ba YX, Hua J, Zhu CY, Zhong M & Wu CY (2012) 379 Dechlorination of p,p'-DDTs coupled with sulfate reduction by novel 380 sulfate-reducing bacterium Clostridium sp. BXM. Environ Pollut 162: 303-310. 381 Bauer M, Fulda B & Blodau C (2008) Groundwater derived arsenic in high carbonate 382 wetland soils: sources, sinks, and mobility. Sci Total Environ 401: 109-120. 383 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram 384 quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 385 72: 248-254. 386 387 Brannon JM (1987) Fixation, transformation, and mobilization of arsenic in sediments. Environ Sci Technol 21: 450-459. 388 Bright DA, Brock S, Reimer KJ, Cullen WR, Hewitt GM & Jafaar, J (1994) 389 Methylation of arsenic by anaerobic microbial consortia isolated from lake 390 sediment. Appl Organomet Chem 8: 415-422. 391 Carlin A, Shi W, Dey S & Rosen BP (1995) The ars operon of Escherichia coli 18 392 confers arsenical and antimonial resistance. J Bacteriol 177: 981-986. 393 Challenger F (1945) Biological methylation. Chem Rev 36: 315-361. 394 Chuichulcherm S, Nagpal S, Peeva L & Livingston A (2001) Treatment of 395 metal-containing wastewaters with a novel extractive membrane reactor using 396 sulfate-reducing bacteria. J Chem Technol Biot 76: 61-68. 397 Compeau GC & Bartha R (1985) Sulfate-reducing bacteria: principal methylators of 398 mercury in anoxic estuarine sediment. Appl Environ Microbiol 50: 498-502. 399 Cullen WR & Reimer KJ (1989) Arsenic speciation in the environment. Chem Rev 89: 400 401 402 713-764. Duker AA, Carranza EJM & Hale M (2005) Arsenic geochemistry and health. Environ Int 31: 631-641. 403 Ekstrom EB, Morel FMM & Benoit JM (2003) Mercury methylation independent of 404 the acetyl-coenzyme A pathway in sulfate-reducing bacteria. Appl Environ 405 Microbiol 69: 5414-5422. 406 Frohne T, Rinklebe J, Diaz-Bone RA & Laing GD (2011) Controlled variation of 407 redox conditions in a floodplain soil: Impact on metal mobilization and 408 biomethylation of arsenic and antimony. Geoderma 160: 414-424. 409 Geng Z, Song X, Xing Z, Geng J, Zhang S, Zhang X & Wang Z (2009) Effects of 410 selenium 411 S-adenosyl-L-methionine 412 methyltransferase in E. coli. J Biol Inorg Chem 14: 485-496. 413 on the structure and function dependent arsenic of recombinant human oxidation state) (+3 Hamdi M, Yoshinaga M, Packianathan C, Qin J, Hallauer J, McDermott JR, Yang HC, 19 414 Tsai KJ & Liu Z (2012) Identification of an S-adenosylmethionine (SAM) 415 dependent arsenic methyltransferase in Danio rerio. Toxicol Appl Pharmacol 262: 416 185-193. 417 Huang H, Jia Y, Sun GX & Zhu YG (2012) Arsenic speciation and volatilization from 418 flooded paddy soils amended with different organic matters. Environ Sci Technol 419 46: 2163-2168. 420 Jay JA, Murray KJ, Gilmour CC, Mason RP, Morel FMM, Roberts AL & Hemond HF 421 (2002) Mercury methylation by Desulfovibrio desulfuricans ND132 in the 422 presence of polysulfides. Appl Environ Microbiol 68: 5741-5745. 423 Jia Y, Huang H, Sun GX, Zhao FJ & Zhu YG (2012) Pathways and relative 424 contributions to arsenic volatilization from rice plants and paddy soil. Environ 425 Sci Technol 46: 8090-8096. 426 Jia Y, Huang H, Zhong M, Wang FH, Zhang LM & Zhu YG (2013) Microbial arsenic 427 methylation in soil and rice rhizosphere. Environ Sci Technol 47: 3141-3148. 428 Jong T & Parry DL (2003) Removal of sulfate and heavy metals by sulfate reducing 429 bacteria in short-term bench scale upflow anaerobic packed bed reactor runs. 430 Water Res 37: 3379-3389. 431 King JK, Kostka JE, Frischer ME & Saunders FM (2000) Sulfate-reducing bacteria 432 methylate mercury at variable rates in pure culture and in marine sediments. Appl 433 Environ Microbiol 66: 2430-2437. 434 Kirk MF, Holm TR, Park J, Jin Q, Sanford RA, Fouke BW & Bethke CM (2004) 435 Bacterial sulfate reduction limits natural arsenic contamination in groundwater. 20 436 Geology 32: 953-956. 437 Kitchin KT & Wallace K (2006) Dissociation of arsenite-peptide complexes: triphasic 438 nature, rate constants, half-lives, and biological importance. J Biochem Mol 439 Toxicol 20: 48-56. 440 Kitchin KT (2011) Arsenic’s interactions with macromolecules and its relationship to 441 carcinogenesis. In Biological Chemistry of Arsenic, Antimony and Bismuth. Sun, 442 H. 443 10.1002/9780470975503.fmatter. (ed). John Wiley & Sons, Ltd, Chichester, UK. Doi: 444 Leloup J, Loy A, Knab NJ, Borowski C, Wagner M & Jorgensen BB (2007) Diversity 445 and abundance of sulfate-reducing microorganisms in the sulfate and methane 446 zones of a marine sediment, Black Sea. Environ Microbiol 9: 131-142. 447 Lin S, Shi Q, Nix FB, Styblo M, Beck MA, Herbin-Davis KM, Hall LL, Simeonsson 448 JB & Thomas DJ (2002) A novel S-adenosyl-L-methionine:arsenic(III) 449 methyltransferase from rat liver cytosol. J Biol Chem 277: 10795-10803. 450 Liu XZ, Zhang LM, Prosser JI & He JZ (2009) Abundance and community structure 451 of sulfate reducing prokaryotes in a paddy soil of southern China under different 452 fertilization regimes. Soil Biol Biochem 41: 687-694. 453 Lloyd JR, Nolting HF, Solé VA, Bosecker K & Macaskie LE (1998) Technetium 454 reduction and precipitation by sulfate-reducing bacteria. Geomicrobiol J 15: 455 45-58. 456 Lloyd JR, Mabbett AN, Williams DR & Macaskie LE (2001) Metal reduction by 457 sulphate-reducing bacteria: physiological diversity and metal specificity. 21 458 Hydrometallurgy 59: 327-337. 459 Lomax C, Liu WJ, Wu L, Xue K, Xiong J, Zhou J, McGrath SP, Meharg AA, Miller 460 AJ & Zhao FJ (2012) Methylated arsenic species in plants originate from soil 461 microorganisms. New Phytol 193: 665-672. 462 Mandal BK & Suzuki KT (2002) Arsenic round the world: a review. Talanta 58: 463 201-235. 464 Marapakala K, Qin J & Rosen BP (2012) Identification of catalytic residues in the 465 As(III) S-adenosylmethionine methyltransferase. Biochemistry 51: 944-951. 466 Meharg AA & Rahman MM (2003) Arsenic contamination of Bangladesh paddy field 467 soils: implications for rice contribution to arsenic consumption. Environ Sci 468 Technol 37: 229-234. 469 Mestrot A, Uroic MK, Plantevin T, Islam MR, Krupp EM, Feldmann J & Meharg AA 470 (2009) Quantitative and qualitative trapping of arsines deployed to assess loss of 471 volatile arsenic from paddy soil. Environ Sci Technol 43: 8270-8275. 472 Mestrot A, Feldmann J, Krupp EM, Hossain MS, Roman-Ross G & Meharg AA (2011) 473 Field fluxes and speciation of arsines emanating from soils. Environ Sci Technol 474 45: 1798-1804. 475 476 Oremland RS, Stolz JF & Hollibaugh JT (2004) The microbial arsenic cycle in Mono Lake, California. FEMS Microbiol Ecol 48: 15-27. 477 Qin J, Rosen BP, Zhang Y, Wang G, Franke S & Rensing C (2006) Arsenic 478 detoxification and evolution of trimethylarsine gas by a microbial arsenite 479 S-adenosylmethionine methyltransferase. Proc Natl Acad Sci USA 103: 22 480 2075-2080. 481 Qin J, Lehr CR, Yuan C, Le XC, McDermott TR & Rosen BP (2009) 482 Biotransformation of arsenic by a Yellowstone thermoacidophilic eukaryotic alga. 483 Proc Natl Acad Sci USA 106: 5213-5217. 484 Rey FE, Gonzalez MD, Cheng J, Wu M, Ahern PP & Gordon JI (2013) Metabolic 485 niche of a prominent sulfate-reducing human gut bacterium. Proc Natl Acad Sci 486 USA 110: 13582-13587. 487 Roberts LC, Hug SJ, Dittmar J, Voegelin A, Kretzschmar R, Wehrli B, Cirpka OA, 488 Saha GC, Ali MA & Badruzzaman ABM (2010) Arsenic release from paddy soils 489 during monsoon flooding. Nat Geosci 3: 53-59. 490 Song X, Geng Z, Zhu J, Li C, Hu X, Bian N, Zhang X & Wang Z (2009) 491 Structure-function roles of four cysteine residues in the human arsenic (+3 492 oxidation state) methyltransferase (hAS3MT) by site-directed mutagenesis. 493 Chem-Biol Interact 179: 321-328. 494 Song X, Geng Z, Li X, Zhao Q, Hu X, Zhang X & Wang Z (2011) Functional and 495 structural evaluation of cysteine residues in the human arsenic (+3 oxidation 496 state) methyltransferase (hAS3MT). Biochimie 93: 369-375. 497 498 Teclu D, Tivchev G, Laing M & Wallis M (2008) Bioremoval of arsenic species from contaminated waters by sulphate-reducing bacteria. Water Res 42: 4885-4893. 499 Thomas DJ, Li JX, Waters SB, Xing WB, Adair BM, Drobna Z, Devesa V & Styblo 500 M (2007) Arsenic (+3 oxidation state) methyltransferase and the methylation of 501 arsenicals. Exp Biol Med 232: 3-13. 23 502 Thomas F, Diaz-Bone RA, Wuerfel O, Huber B, Weidenbach K, Schmitz RA & 503 Hensel R (2011) Connection between multimetal(loid) methylation in 504 methanoarchaea and central intermediates of methanogenesis. Appl Environ 505 Microbiol 77: 8669-8675. 506 507 508 Tsai SL, Singh S & Chen W (2009) Arsenic metabolism by microbes in nature and the impact on arsenic remediation. Curr Opin Biotechnol 20: 659-667. Vriens B, Lenz M, Charlet L, Berg M & Winkel LHE (2013) Natural wetland 509 emissions 510 10.1038/ncomms4035. 511 512 of methylated trace elements. Nat Commun DOI: Wakao N & Furusaka C (1973) Distribution of sulfate-reducing bacteria in paddy-field soil. Soil Sci Plant Nutri 19: 47-52. 513 Wang P, Sun G, Jia Y, Meharg AA & Zhu Y (2014) Completing arsenic 514 biogeochemical cycle: Microbial volatilization of arsines in environment. J 515 Environ Sci 26: 1-11. 516 Widdel F & Bak F (1992) Gram-negative mesophilic sulfate reducing bacteria. In: 517 Balows, A., Trüper, H.G., Dworkin, M., Harder, W., Schleifer, K.H. (Eds.), The 518 Prokaryotes. Springer, New York, pp. 3352-3378. 519 520 521 522 523 Xu XY, Mcgrath SP, Meharg AA & Zhao FJ (2008) Growing rice aerobically markedly decreases arsenic accumulation. Environ Sci Technol 42: 5574-5579. Ye J, Rensing C, Rosen BP & Zhu YG (2012) Arsenic biomethylation by photosynthetic organisms. Trends Plant Sci 17: 155-162. Ye J, Chang Y, Yan Y, Xiong J, Xue XM, Yuan D, Sun GX, Zhu YG & Miao W (2014) 24 524 Identification and characterization of the arsenite methyltransferase from a 525 protozoan, Tetrahymena pyriformis. Aquat Toxicol 149: 50-57. 526 Yin XX, Chen J, Qin J, Sun GX, Rosen BP & Zhu YG (2011) Biotransformation and 527 volatilization of arsenic by three photosynthetic cyanobacteria. Plant Physiol 156: 528 1631-1638. 529 Zakharyan RA & Aposhian HV (1999) Arsenite methylation by methylvitamin B12 530 and glutathione does not require an enzyme. Toxicol Appl Pharmacol 154: 531 287-291. 532 Zhao FJ, Harris E, Jia Y, Ma J, Wu L, Liu W, McGrath, SP, Zhou J & Zhu YG (2013) 533 Arsenic methylation in soils and its relationship with microbial arsM abundance 534 and diversity, and as speciation in rice. Environ Sci Technol 47: 7147-7154. 535 Zhu YG, Sun GX, Lei M et al. (2008) High percentage inorganic arsenic content of 536 mining impacted and nonimpacted Chinese rice. Environ Sci Technol 42: 537 5008-5013. 538 25 539 Figure legends 540 Fig. 1. Arsenic transformation by Clostridium sp. BXM. Clostridium sp. BXM was 541 cultured with 5.3 μM As(III) or As(V) for 20 days. The medium without bacteria 542 inoculation was as control. The As species in the medium were analyzed as described 543 in “Experimental procedures”. 544 545 Fig. 2. The growth curves of E. coli AW3110 (ΔarsRBC) expressing CsarsM or empty 546 vector when exposed to different concentrations of NaAsO2. E. coli bearing empty 547 vector pET28a or pET28a-arsM was cultured in LB medium with the indicated 548 concentrations of NaAsO2, 50 μg ml-1 kanamycin and 0.3 mM IPTG at 37°C. Cellular 549 growths were monitored by spectrophotometer at absorbance of 600 nm (A600) at the 550 indicated time points. The error bars indicate the standard errors of three triplicates. 551 552 Fig. 3. Arsenic methylation and volatilization by E. coli expressing pET28a-arsM. (A) 553 As(III) methylation by E. coli AW3110 (ΔarsRBC) expressing CsarsM. E. coli 554 expressing empty pET28a or pET28a-arsM was incubated in LB medium with the 555 indicated concentrations of As(III) (10, 20, 50 μM), 50 μg ml-1 kanamycin and 0.3 556 mM IPTG at 37°C for 20 h. The As species in the supernatants were analyzed by 557 HPLC-ICP-MS as described in “Experimental procedures”. C, control, which was E. 558 coli expressing empty vector pET28a; arsM, E. coli expressing CsarsM. The error 559 bars indicate the standard errors of three triplicates. (B) Time dynamics of As(III) 560 methylation by E. coli AW3110 (ΔarsRBC) expressing CsarsM. The strain was 26 561 incubated in LB medium with 20 μM As(III), 50 μg ml-1 kanamycin and 0.3 mM 562 IPTG at 37°C. At the indicated time points (3, 6, 9, 13, 16, 20 h), 1 ml samples of the 563 bacterial culture were taken and centrifuged at 8000 r.p.m. The supernatants were 564 appropriately diluted and analyzed for As species by HPLC-ICP-MS. (C) 565 Volatilization of As by E. coli AW3110 (ΔarsRBC) expressing CsarsM. E. coli with 566 CsarsM was grown in LB medium with a series of As(III) concentrations, 50 μg ml-1 567 kanamycin and 0.3 mM IPTG at 37°C for 48 h. Volatile As produced was 568 chemo-trapped as described in “Experimental procedures” and the total quantities of 569 volatile As were analyzed by ICP-MS. The error bars indicate the standard errors of 570 three triplicates. 571 572 Fig. 4. Purification of CsArsM protein and As(III) methylation by purified CsArsM. 573 (A) SDS-PAGE showing the purity of the soluble CsArsM. Lane 1, protein standards; 574 Lane 2, cell lysis solution; Lane 3, collection of the washing buffer (20 mM imidazole) 575 outflowing from Ni(II)-NTA column; Lane 4, collection of the washing buffer (50 576 mM imidazole) outflowing from Ni(II)-NTA column; Lane 5, concentrated 577 His-tagged CsArsM protein. (B) Time dynamics of As(III) methylation by purified 578 CsArsM enzyme. Each assay contained 10 μM As(III), 0.5 mM AdoMet, 8 mM GSH, 579 and 4 μM purified CsArsM in 500 μl MOPS buffer (pH 7.4). The reactions were kept 580 at 37°C. Arsenic species of the samples were analyzed at the indicated time points by 581 HPLC-ICP-MS as described in “Experimental procedures”. The error bars indicate 582 the standard errors of three triplicates. (C) The final products of As(III) methylation 27 583 by purified CsArsM enzyme at 37°C for 20 h. Each assay contained the indicated 584 concentrations of As(III) (5, 10, or 20 μM), 0.5 mM AdoMet, 8 mM GSH, and 10 μM 585 purified CsArsM in 500 μl MOPS buffer (pH 7.4). Arsenic species were analyzed by 586 HPLC-ICP-MS. The error bars indicate the standard errors of three triplicates. 587 588 Fig. 5. Methylation of As(III) or MMAs by wild-type or mutant CsArsM enzymes. 589 Methylation of As(III) or MMAs was tested in a reaction system (pH 7.4) with 10 μM 590 As(III) (A) or MMAs (B), 8 mM GSH, 0.5 mM AdoMet and 2 μM ArsM enzyme. 591 The reactions were kept at 37 °C for 20 h. The As species of the samples were 592 analyzed by HPLC-ICP-MS. 593 28 594 595 29 596 597 30 598 599 31 600 601 32 602 603 33 604 Graphical abstract 605 606 34 607 Paper-table of content2 608 609 610 35 611 612 Identification and its catalytic residues of the arsenite 613 methyltransferase from a sulfate-reducing bacterium, 614 Clostridium sp. BXM 615 616 Pei-Pei Wang, Yong-Guan Zhu, Peng Bao, and Guo-Xin Sun* 617 618 *Corresponding author, E-mail: [email protected]. 619 620 621 Fig. S1. The As speciation produced by Clostridium sp. BXM. Clostridium sp. BXM 622 was exposed to 5.3 μM As(III) for 20 days. The As species in the medium were 623 analyzed as described in “Experimental procedures”. The error bars indicate the 624 standard errors of three triplicates. 625 626 36 627 628 629 Fig. S2. The species of volatile As formed by E. coli AW3110 (ΔarsRBC) expressing 630 CsarsM. The E. coli expressing empty vector pET28a was as control. E. coli was 631 grown in LB medium with 100 μM As(III), 50 μg ml-1 kanamycin and 0.3 mM IPTG 632 at 37°C for 48 h. The volatile As produced was trapped and analyzed for species by 633 HPLC-ICP-MS as described in “Experimental procedures”. 634 635 636 37 637 638 Table S1 Primers used for the site-directed mutagenesis in enzyme CsArsM C65S C153S C203S Whole Primer Sequence + 5'CAATTCGTTTGGGTCTGGTAACCCCACTGC3' - 5'GCAGTGGGGTTACCAGACCCAAACGAATTG3' + 5'TATTATTTCAAACTCTGTAATTAATCTTTC3' - 5'GAAAGATTAATTACAGAGTTTGAAATAATA3' + 5'TTGCTTGGGCCGGATCTATTGCTGGAGCAA3' - 5'TTGCTCCAGCAATAGATCCGGCCCAAGCAA3' + 5'CGGAATTCATGGATAATATTCGAGAGGGAGTAA3' - 5'CCCTCGAGTGCCGGCTTGGCTGCCCGAATAAA3' 639 640 38
© Copyright 2026 ExpyDoc