JVI Accepts, published online ahead of print on 26 February 2014 J. Virol. doi:10.1128/JVI.00022-14 Copyright © 2014, American Society for Microbiology. All Rights Reserved. 1 Title: Genome scale patterns of recombination between co-infecting vaccinia viruses 2 3 Running Title: Vaccinia recombination 4 5 Authors: Li Qin1, and David H. Evans1# 6 7 8 9 Affiliation: 1Dept. of Medical Microbiology & Immunology and 10 Li Ka Shing Institute of Virology 11 6020H Katz Group Centre 12 University of Alberta 13 Edmonton, AB 14 T6G 2H7 CANADA 15 16 17 Word Counts: 18 Abstract: 250 words 19 Importance: 150 words 20 Text (including above): 6,106 words 21 22 #Corresponding author: Dept. of Medical Microbiology & Immunology, 6020 Katz 23 Group Centre, University of Alberta, Edmonton, AB, T6G 2H7, CANADA. Phone (780) 24 492-2308; FAX (780) 492-7521; E-mail [email protected] 25 ABSTRACT 26 27 Recombination plays a critical role in virus evolution. It helps avoid genetic decline and 28 creates novel phenotypes. This promotes survival, and genome sequencing suggests that 29 recombination 30 Orthopoxviruses like variola virus. Recombination can also be used to map genes, but 31 although recombinant poxviruses are easily produced in culture, classical attempts to map 32 the vaccinia virus (VACV) genome this way, met with little success. We have sequenced 33 recombinants formed when VACV TianTan and Dryvax strains are crossed under 34 different conditions. These were a single round of growth in co-infected cells, five rounds 35 of sequential passage, or using Leporipoxvirus-mediated DNA reactivation. Our studies 36 showed that recombinants contain a patchwork of DNA, with the number of exchanges 37 increasing with passage. Further passage also selected for TianTan DNA and correlated 38 with increased plaque size. The recombinants produced through a single round of 39 co-infection contain a disproportionate number of short conversion tracks (<1 kbp) and 40 exhibited 1 exchange per 12 kbp, close to the ~1 per 8 kbp in the literature. One 41 byproduct of this study was that rare mutations were also detected, VACV replication 42 produces ~1×10-8 mutations per nucleotide copied per cycle of replication and ~1 large 43 (21 kbp) deletion per 70 rounds of passage. Viruses produced using DNA reactivation 44 appeared no different from recombinants produced using ordinary methods. An attractive 45 feature of this approach is that, when combined with selection for a particular phenotype, 46 it provides a way of mapping and dissecting more complex virus traits. has facilitated the evolution of human pathogens including 47 48 Qin et al. Vaccinia virus recombination Page 2 of 31 49 IMPORTANCE 50 51 When two closely related viruses co-infect the same cell, they can swap genetic 52 information through a process called recombination. Recombination produces new 53 viruses bearing different combinations of genes, and it plays an important role in virus 54 evolution. Poxviruses are a family of viruses that includes variola (or smallpox) virus and 55 although poxviruses are known to recombine, no one has previously mapped the patterns 56 of DNAs exchanged between viruses. We co-infected cells with two different vaccinia 57 poxviruses, isolated the progeny, and sequenced them. 58 recombination is a very accurate process that assembles viruses containing DNA copied 59 from both parents. In a single round of infection, DNA is swapped back and forth ~18 60 times per genome to make recombinant viruses that are a mosaic of the two parental 61 DNAs. This mixes many different genes in complex combinations and illustrates how 62 recombination can produce viruses with greatly altered disease potential. We show that poxvirus 63 Qin et al. Vaccinia virus recombination Page 3 of 31 64 INTRODUCTION 65 66 Recombination plays an essential role in DNA repair and, by creating new combinations 67 of genetic traits, it averts the decline in fitness caused by the accumulation of mutations 68 (”Muller’s ratchet”) while creating the genetic diversity that is the substrate for 69 Darwinian selection. Bacteriophage were the first viruses shown to be subject to 70 recombination (1) and the phenomenon was soon also detected in co-cultures of many 71 other viruses including herpes simplex virus (2) and vaccinia virus (3). In the years 72 immediately following, research showed that in vitro recombination could also produce 73 hybrids between related poxviruses such as rabbit fibroma and myxoma viruses (4) and 74 between variola virus and cowpox and rabbitpox viruses (5, 6). The subsequent discovery 75 of another natural hybrid between rabbit fibroma and myxoma viruses, called malignant 76 rabbit virus (7), suggested that poxviruses can also recombine in co-infected animals and 77 the significance for human health is illustrated by the fact that variola minor virus may be 78 a recombinant derived from more virulent West African and Asian variola major strains 79 (8). We have recently published an analysis of some of the strain variants found in an old 80 non-clonal smallpox vaccine, Dryvax, and detected one virus bearing a small region of 81 sequence wherein the single nucleotide polymorphisms (SNPs) were more characteristic 82 of horsepox than of vaccinia virus (VACV) (9). This may represent a sequence relic that 83 has been retained in the absence of counter selection and the population bottlenecks 84 caused by periodic plaque purification. 85 Genetic crosses between viruses encoding different selectable markers were once 86 also used to try and assemble recombination-based maps of VACV (10-12), although the 87 method never proved very useful and was soon supplanted by marker rescue and DNA 88 sequencing technologies. This was due to the limited distances over which linkage is 89 retained relative to the spacing between many markers (<20 kbp over a 200 kbp genome) Qin et al. Vaccinia virus recombination Page 4 of 31 90 and the difficulty of reproducibly measuring recombinant frequencies (13). Further 91 studies showed that homologous recombination can be used to genetically modify VACV 92 (14, 15), that this is an accurate process (16, 17), and that these processes also operate in 93 trans and can be detected using transfected DNAs (18). Poxviruses replicate in 94 sequestered structures called factories (19), each of which derives from a single infecting 95 particle, and it is presumed that recombinants can only form within these factories if 96 different DNAs mix in the presence of the recombination machinery. VACV uses a 97 single-strand annealing mechanism to produce recombinant molecules in a reaction 98 catalyzed by the E9 viral DNA polymerase and I3 single-strand DNA binding protein (20, 99 21) and, since both proteins primarily reside within virus factories, that is presumably 100 where recombination also occurs. We have suggested that random variations in the timing 101 and degree of mixing of virus factories within co-infected cells could explain why 102 recombinant frequencies proved difficult to measure reproducibly (13). If two or more 103 viruses infect any particular cell, but a portion of the factories don’t mix, such a process 104 would decrease the yield of recombinants in a stochastic manner relative to the number of 105 non-recombinant (i.e. fully parental) viruses produced by DNA replication. 106 Although much has been learned concerning the mechanism of poxvirus 107 recombination, questions remain regarding how these processes and physical constraints 108 might affect the patterns of DNA exchange, and thus the overall genetic composition of 109 the resulting pool of parental and recombinant viruses. How genetic linkage distances 110 relate to the actual numbers of exchanges in recombinant viruses also remains to be 111 established. In this study we have used the ~1400 SNPs that differentiate two strains of 112 VACV, a Dryvax clone and a TianTan clone, as sequence tags that can be used to track 113 the origins of the different DNA segments in recombinant progeny. Our study shows that 114 VACV recombination reactions produce genomes exhibiting a “patchwork” of exchanges, 115 some apparently derived from a succession of crossovers over the course of a single Qin et al. Vaccinia virus recombination Page 5 of 31 116 infection cycle. Interestingly, viruses produced using non-genetic reactivation methods 117 (22), appear indistinguishable from recombinants produced in a more regular manner, 118 showing that such viruses are likely subjected to similar replication and developmental 119 pathways. 120 121 METHODS 122 123 Cells and viruses. Vaccinia virus strains DPP17 (GenBank JN654983), TP03 (GenBank 124 KC207810), and TP05 (Genbank KC207811) were cloned from stocks of Dryvax 125 (DPP17) and TianTan (TP03/05) viruses (9, 23). They were cultured on BSC-40 cells in 126 modified Eagle’s medium (MEM, Gibco) supplemented with 5% fetal bovine serum, 1% 127 nonessential amino acids, 1% L-glutamine, and 1% antibiotic at 37°Cin a 5%CO2 128 atmosphere. Two types of recombinant virus stocks were prepared. The DTM viruses 129 (Dryvax-TianTan mixture) were generated by co-infecting cells with DPP17 and TP05 at 130 a multiplicity of infection (MOI) of 0.02 (each 0.01), culturing the cells for two days, 131 harvesting the cell-virus mixture, and releasing the virus by freeze-thaw. A sample (10 132 μL, 0.5% of the lysate, or ~0.02 PFU/cell) was then used to infect another fresh dish of 133 cells and this was repeated for a total of five rounds of passage. Individual DTM viruses 134 were then isolated using three rounds of cloning by limiting dilution as described (9). The 135 DTH viruses (Dryvax-TianTan high MOI) were produced by co-infecting cells with 136 DPP17 and TP05 at MOI=10 (each 5) for 24 hr, followed by three rounds of cloning. 137 Plaque images were processed with ImageJ (24). 138 139 Virus DNA reactivation. A third collection of recombinant VACV were prepared using 140 DNA reactivation reactions as described previously (22). Briefly, BGMK cells were 141 grown to near confluence in 60 mm dishes and infected with Shope fibroma virus (SFV, Qin et al. Vaccinia virus recombination Page 6 of 31 142 strain Kasza) at MOI=1 in PBS. After one hour at 37°C, the medium was replaced with 143 MEM containing 10% fetal bovine serum, incubated for another hour, and the MEM 144 replaced with Opti-MEM (Gibco). DPP17 and TP03 VACV DNAs were extracted from 145 sucrose gradient-purified virions using phenol chloroform, mixed in 1:1 ratio, and the 146 SFV-infected cells transfected with 5 μg of this DNA using Lipofectamine 2000 (Gibco). 147 The cells were incubated for 4 hr, the Opti-MEM media was replaced with MEM 148 containing 10% serum, and the cells cultured for another 3 days. The cells were then 149 subjected to three rounds of freeze-thaw and 0.2 mL used to infect BSC-40 cells (which 150 do not support SFV growth). The reactivated VACV were cloned using three rounds of 151 limited dilution and recombinants were identified using the PCR and the primer pairs 152 DVX-209F and DVX-226R plus DVX-004F and DVX-007R (Table 1). The 209F/226R 153 primers should produce a 1.1 kbp amplicon in reactions containing DPP17 DNA whereas 154 TP03 DNA does not serve as a substrate. The 004F/007R primer pair targets telomeric 155 repeat sequences and should produce 665 bp and 1230 bp products in reactions 156 containing TP03 and DPP17 DNAs, respectively. After cloning, the viruses were purified 157 and sequenced as described. Four DTD clones (Dryvax-TianTan DNA reactivation) were 158 sequenced. 159 160 Virus sequencing and genomic analysis. Stocks of 16 DTM clones, 15 DTH, and 4 161 DTD clones were prepared and purified over sucrose gradients. Viral DNAs were 162 extracted and sequenced as described previously (9) using a Roche 454 GS Junior system. 163 Roche GS De Novo Assembler software was used to deconvolute and assemble the raw 164 sequencing data into contigs and nearly full-length genomes were generated using CLC 165 Genomics Workbench 6. The average read redundancy was 15, which permitted the 166 assembly and mapping of all of the recombinant junctions with confidence. Multiple 167 sequence alignments were prepared using the program LAGAN (http://genome.lbl.gov) Qin et al. Vaccinia virus recombination Page 7 of 31 168 (25) and Base-by-Base software (26) was used to produce a visual summary of the whole 169 genome alignments. The assembled sequence data have been assigned GenBank 170 accession numbers KJ467582 to KJ467616, inclusive (Table S1). 171 PCR and Southern blotting. Southern blotting was used to confirm the rearrangement 172 detected in clone DTM28. Virus DNA was digested with NdeI (Fermentas) and size 173 fractionated by electrophoresis on 0.7% agarose gels. The DNA was fragmented with 174 0.2M HCl, denatured with 0.4M NaOH, transferred to a nylon membrane, and fixed with 175 a UV cross-linker. Two primers (201F and 239R, Table 1) and the PCR were used to 176 prepare a probe in a reaction containing biotin-16-dUTP (Roche, 1093070), which was 177 subsequently hybridized to the prepared membrane and detected using IRDye 178 800CW-coupled streptavidin (Li-Cor; 926-32230) and a Li-Cor imager. The DTM28 and 179 DTM28Δ viruses were also differentiated using the PCR and 208F and 209R (Table 1) 180 primers. This was done in combination with 201F and 239R in a PCR reaction containing 181 all four primers. 182 183 RESULTS and DISCUSSION 184 185 Virus isolation and genome sequencing and assembly. We used three different methods 186 to produce VACV recombinants. The first method was designed to explore the effects of 187 repeated passage, at low MOI, on a seed mixture initially composed of just two different 188 genetically tagged viruses. These viruses were originally cloned from stocks of Dryvax 189 (DPP17) and TianTan (TP05) vaccines and differ in sequence by 1 SNP per ~140 bp. 190 Compared to TP05, DPP17 also encodes a 6 kbp deletion near the right terminal inverted 191 repeat boundary as well as ~150 other smaller insertions and deletions (indels) distributed 192 across the two genomes (Figure 1). The TP05 strain forms plaques that are approximately Qin et al. Vaccinia virus recombination Page 8 of 31 193 twice the diameter of those formed by the DPP17 strain, which provided an opportunity 194 to explore what effect a growth bias might have on the pattern of recombinants. 195 For this first experiment, a 1:1 mixture of the two different VACV were used to 196 infect BSC-40 cells at MOI=0.02, cultured 48 hr, and a portion (10 μL or ~0.02 PFU/cell) 197 of the resulting progeny passaged again under the same conditions. This was repeated to 198 produce a total of 5 rounds of replication. Each time the infection produced overlapping 199 plaques that partly cleared the entire plate. We then plated out the diluted virus in 24-well 200 plates, and identified 36 wells each containing just a single random plaque. These 36 201 viruses were then cloned again, also by limiting dilution, and designated DTM 202 (Dryvax-TianTan mixture) strains. Using this method minimized the risk of picking 203 certain plaque types, since the only criteria we used to choose a clone was that the virus 204 had to have been diluted to the point where it was the only plaque in a well, in the first 205 round of selection. To avoid the problem of resequencing any non-recombinant parental 206 stains, the PCR and three different primer pairs were used to determine the genetic origin 207 of three different sites within each genome: within the terminal inverted repeats (primers 208 004F/007R), in the central part of the genome (primers 107F/108R), and near the junction 209 with the right terminal inverted repeat (213F/209F/226R) (Table 1). Fourteen clones were 210 selected because at least one position was recombinant with respect to either of the other 211 two sites. We also chose two additional viruses, which exhibited a parental arrangement 212 of markers at these three sites, although these were subsequently determined to also be 213 recombinants. These viruses were cloned two more times and 16 were sequenced. After 214 sequencing and assembly, these DTM recombinants exhibited a patchy pattern of SNPs 215 suggesting each virus was the product of approximately 30 exchanges over the course of 216 virus replication. 217 One expects that when viruses are passaged five times under these conditions, it 218 should provide an opportunity for repeated rounds of replication and recombination. We Qin et al. Vaccinia virus recombination Page 9 of 31 219 also examined what the virus progeny would look like if they were permitted just a single 220 round of infection, although it is expected that this would still involve multiple rounds of 221 replication. To do this, we co-infected BSC-40 cells with DPP17 and TP05 viruses at 222 MOI=10 (5 pfu/cell of each virus) and cultured the viruses for just 24 hr. These viruses 223 were cloned and designated DTH strains (Dryvax-TianTan high MOI). After the first 224 round of cloning, 43 viruses were randomly selected and the PCR was used to identify 225 putative recombinants as described above. Thirteen hybrid viruses were cloned twice 226 more, along with two additional viruses (DTH13 and DTH14) that exhibited a parental 227 pattern of markers at the three positions tested by the PCR. DTH14 was subsequently 228 identified as being identical to the TP05 parent virus, while DTH13 proved to be a 229 recombinant. Ultimately, 15 DTH clones were sequenced and assembled as described 230 before. These recombinants exhibited a mean of 18 exchanges per genome. 231 We should note one caveat regarding these methods, in that single plaques isolated in 232 the first round of purification were not always pure, and this provided some limited 233 opportunity for additional rounds of replication and recombination. For example, when a 234 plaque initially identified as recombinant DTM22 was cloned a second time, and the 235 subsidiary plaques reanalyzed by PCR, it was realized that the two daughter plaques 236 (DTM22.1 and DTM22.2) were not identical. However, they are clearly “sibs”, viruses 237 sharing a common genetic origin as judged by a shared pattern of exchanges in the center 238 of the two genomes (Figure 1). We also noted one case where a single apparently 239 recombinant starting plaque resolved into two clearly unrelated recombinant clones upon 240 replating (clones DTH10 and DTH10.2, Figure 1). For simplicity, our analysis has treated 241 these particular clones as being the same as the other recombinants isolated in the study, 242 although they may have experienced some additional limited opportunities to undergo 243 recombination. 244 Qin et al. Vaccinia virus recombination Page 10 of 31 245 Crossovers in DTM and DTH viruses. After assembly, the sequences were aligned with 246 program LAGAN and the alignment corrected manually using Base-by-Base. Inspecting 247 these sequences we could readily identify the origin of each SNP-tagged segment of 248 DNA as belonging to either the DPP17 or TP05 parent (Figure 1). What was remarkable 249 was the very low frequency of observed mutation even though numerous SNPs and 250 smalls indels commonly differentiate clones isolated from a viral stock like Dryvax (9). 251 No mutations were detected in any of the DTH clones, compared with the two parent 252 viruses, and just two mutations in two of the DTM clones. One was a small deletion in 253 DTM29 at alignment position 900, which removed two nucleotides (Figure 2, panel A) 254 just 6 nt upstream of the ORF001 start codon. Although most small deletions are 255 associated with repeats (9, 27), this event was not. It was located immediately adjacent to 256 a SNP that differentiates DPP17 from TP05. We also discovered a point mutation in 257 DTM27 at alignment position 70,493 (Figure 2, panel B). This causes a C-to-T transition 258 mutation and an alanine-to-valine substitution in gene DVX_088 (RNA-helicase). A 259 crude estimate of the VACV replicative error rate can be calculated from the following 260 observations and assumptions. We note that there were only two independent mutations 261 detected in 16 DTM viruses over the course of 5 rounds of infection, and there are 262 ~200,000 nt copied per genome per each round of infection. Each round of infection 263 typically expands the VACV titer ~10,000-fold (i.e. between 214 and 215 doublings of the 264 genome) and thus the error rate is very crudely estimated as 2÷[16×200,000×5×14.5] or 265 ~1×10-8 mutations per nucleotide copied per cycle of replication. Alternatively this is 266 2÷[16×5×14.5] or ~1 mutation per 600 genomes per cycle of replication. By a similar 267 method, the absence of any mutations detected amongst the 15 DTH clones over the 268 course of a single round of infection suggests an error rate of <5×10-8. The VACV E9L 269 gene encodes a typical B-family proofreading DNA polymerase of a type encoded by a 270 variety of viruses and bacteriophage, and this error frequency resembles that reported for Qin et al. Vaccinia virus recombination Page 11 of 31 271 phage (28). Although some drug-resistant E9L alleles cause altered spontaneous mutation 272 rates in vivo (29-31), for comparison purposes these cannot be converted into absolute 273 mutation rates given the uncertainties in the size or number of genetic target(s). We could 274 find no other reported absolute error rates for poxviruses in the literature. 275 Beyond these two rare mutations, the remainder of the sequences in the recombinant 276 genomes could be ascribed to having been inherited from one or the other of the two 277 parent viruses. In total, 1399 SNPs (single nucleotide polymorphisms) can be used to 278 differentiate DPP17 from TP05 and we used these SNPs to track the origins, and thus the 279 sites of crossing over, in the hybrids. The relative abundance of these variant sites (1399 280 scattered across ~200 kbp) allowed us to map the site(s) of crossing over with an average 281 resolution of ~140 nt. In general, each hybrid virus encoded variable-length blocks of 282 DNA derived from each of the two parent strains, and no uniquely conserved block (a 283 hallmark of a highly selected patch of DNA) was detected in all of the viruses. The 284 lengths of these blocks of recombined sequences varied, ranging in length from one to 285 several hundred SNPs. We detected none of the large gene duplications that have been 286 described by other authors (32, 33), but would not expect to do so given that these 287 structures are stable only in the presence of strong selection pressure. 288 To examine the pattern of crossing over in greater detail, we used “Base-by-Base” 289 software to produce a table ascribing each of the 1399 SNPs detected in each hybrid as 290 being of either DPP17 or TP05 origin (data not shown). This provided a tool for 291 calculating the number of exchanges on the assumption that each time the pattern of 292 SNPs changed from DPP17 to TP05 (or vice versa), that an exchange had occurred and 293 was counted as one crossover. It is important to note that this is still an underestimate of 294 the true physical recombination frequency, as any recombination between two parental 295 genomes (e.g. DPP17×DPP17 or TP05×TP05), or recombination occurring over distances 296 less than the distances between SNPs cannot be detected by this method. Figure 3 shows Qin et al. Vaccinia virus recombination Page 12 of 31 297 the results of this analysis. We had expected that viruses given more opportunities for 298 recombination would exhibit a greater number of exchanges, and this was supported by 299 these measurements. The number of crossovers in the DTM viruses ranged from 14 to 44 300 (mean = 30±11 [SD]). In contrast, the numbers of crossovers in the DTH viruses ranged 301 from 0 to 38 (mean = 18±11 [SD]), with one virus, DTH14, identical to the TP05 parents. 302 In a previous publication (13) we conducted a meta-analysis of all of the published 303 VACV genetic recombination data and attempted to correlate these data with the known 304 physical map of the virus. From these studies we derived an estimate that half-maximal 305 recombination was detected in a single round of infection (akin to the method used to 306 produce the DTH viruses), when the distance between VACV markers was ~8 kbp. 307 Although this number is difficult to estimate with precision due to a number of 308 experimental factors (13), from our measurements of the conversion track lengths (see 309 below) we calculated that the DTH viruses exhibited a mean of about 1 physical 310 crossover per 12 kbp, a number compatible with the ~8 kbp deduced from the older 311 genetic literature. Historically, classical genetic crosses never proved a useful tool for 312 mapping VACV genomes, due to a combination of experimental noise and short linkage 313 distances relative to the distances between most VACV markers. When one considers that 314 our estimate of 1 crossover per 12 kbp is associated with a standard deviation of 19 kbp 315 (i.e. 12±19 kbp), the source of this problem is clearly apparent. 316 317 Average length of the conversion tracts. Besides measuring the numbers of exchanges 318 suffered by each of the recombinant viruses, we also examined the lengths of the DNA 319 segments exchanged between viruses (i.e. the conversion track length) in the DTH group. 320 To do this, the calculation assumed that the start and end of each exchange lay midway 321 between the SNPs flanking the two sites of exchange. The resolution of the method varies 322 depending upon the local SNP density, but with an average of 1 SNP per 140 bp we could Qin et al. Vaccinia virus recombination Page 13 of 31 323 detect exchanges ranging in size from 55 to 92,000 bp. An interesting feature of VACV 324 recombination is illustrated by this analysis, which showed that there were relatively 325 more short conversion tracks than long ones (Figure 4). Thus while the mean length of a 326 conversion track was 12 kbp, the median was only 2.6 kbp. The abundance of short 327 conversion tracks would help favor intragenic recombination events, which can be 328 detected between markers spaced only 54 bp apart (34). We should note that this estimate 329 of the recombination frequency is lower than has been previously reported. For example 330 we detected a loss of linkage at distances exceeding 350 bp in one study (35). However, 331 this earlier experiment measured the yield of recombinants when DNA was transfected 332 into Shope fibroma virus-infected cells, and it is possible that the non-specific DNA 333 replication that is seen under these circumstances (36) also exposes transfected DNAs to 334 higher levels of recombination than is normally experienced by viruses. 335 Crossing over is not the only process that could produce this abundance of short 336 exchanges. Poxvirus replication and recombination reactions also produce hybrid (or 337 heteroduplex) DNA (37). Such molecules would contain mismatched bases wherever the 338 sequences differ and if a subset of mismatches were subjected to mismatch-specific and 339 directionally biased short patch DNA repair prior to further replication, it could create the 340 appearance of closely linked crossovers. However, our data provide no evidence that 341 mismatch repair is producing artifactual exchanges. If any repair bias existed, it would 342 most probably occur at sites where the hybrid DNA contained G·T mismatches, since G·T 343 mismatches are generally repaired to G·C basepairs in cells by a pathway employing a 344 thymine DNA glycolylase (38). A G·T mismatch would be formed (along with a 345 reciprocal A·C mismatch) at sites where substitution mutations differentiate the two 346 viruses. Such substitutions (i.e. GÆA, AÆG, CÆT, or TÆC) comprise 72% of the SNP 347 markers in these crosses. If one makes the simplifying assumption that A·C mismatches 348 are just replicated and not repaired, and that all G·T mismatches are converted to G·C Qin et al. Vaccinia virus recombination Page 14 of 31 349 prior to replication, then these single marker exchanges should be biased 2:1 in favour of 350 forming (or retaining) a G or C. We detected 51 single exchanges at sites containing base 351 substitutions (82% of all single exchanges), in the DTM and DTH viruses. Of these, 29 352 retained a G or C, and 22 retained an A or T, which is not significantly different from a 353 1:1 split (Ȥ2=0.96, P=0.33). Although we cannot disprove the hypothesis that biased 354 mismatched repair created some of the short conversion tracts, the simplest explanation 355 for these data is that poxvirus recombination reactions produce an abundance of short 356 conversion tracks through a process formally akin to crossing over. 357 358 Biased genetic origins in progeny viruses. An interesting difference between the 359 TianTan and Dryvax clones used in this study is that TP05 forms plaques twice the size 360 of DPP17 plaques on BSC40 cells. We wondered how this phenotype might segregate 361 amongst the recombinants deriving from either the DTH or DTM crosses. We used the 362 SNPs to determine what fraction of each genome derived from TP05 or DPP17, and 363 plated all of the cloned viruses on BSC-40 cells, at the same time, to determine the 364 average plaque size. The DTH viruses, passaged just once, showed no particular 365 compositional bias, comprising about equal portions (50±27%) of each of the parental 366 viruses (Figure 5A). In contrast the DTM hybrids bear a diminished (19±11%) fraction of 367 the genome derived from DPP17 SNPs (Figure 5A). Oddly, there seems to be a simple 368 linear relationship between plaque size and the proportion of the genome derived from 369 each parent strain, with larger plaque sizes associated with a greater proportion of 370 TP05-derived DNA (Figure 5B). These data suggest that the TP05-derived DNA may 371 confer a selective growth advantage in multiple rounds of culture (i.e. DTM viruses), but 372 one round of growth (i.e. DTH viruses) provides insufficient time or selective pressure to 373 bias the composition of the recombinants. Qin et al. Vaccinia virus recombination Page 15 of 31 374 What would produce this effect is not clear. Plaque size is likely determined by many 375 different genetic factors, and there are many differences in the gene composition of the 376 two parent strains. For example DPP17 contains a large deletion in the right TIR 377 compared to TP05 and this deletion bears a number of different genes (Table 2). However, 378 this deletion is not completely responsible for plaque variation since DPP25, containing 379 all the genes in this region, forms plaques only slightly larger than DPP17 (9). We 380 subsequently annotated all of the hybrid genomes using GATU (39) and evaluated the 381 differences (Table 3). There are many mutant genes segregating in complex ways 382 between the different viruses including mutant forms of I4L (40), F3L (41), E5R (42), 383 M1L, A51R, and C23L, but no obvious distribution patterns could be discerned by 384 inspection beyond the fact that the more presumably functional genes the virus encoded 385 (Table 3, grey cells), the better it grew. The non-transcribed telomeric repeats in VAC 386 telomeres cannot be assembled into contiguous sequences, due to the redundancies in the 387 repeats, but some of the fragments of junction sequences differ enough in TianTan and 388 Dryvax to deduce the origins of the telomeres. This analysis detected a trend suggesting 389 that viruses bearing TP05-like telomeres also form larger plaques. However, all that 390 could really be concluded from this analysis is that TianTan-derived sequences generally 391 contribute greater advantage in culture than does Dryvax DNA. 392 393 Large deletions formed through illegitimate recombination. Poxviruses are also 394 known to suffer deletion mutations during passage. The most extreme example is 395 probably modified vaccinia virus Ankara (MVA), which accumulated six large deletions, 396 and many smaller ones, when it was passaged >570 times in chicken embryo fibroblasts 397 (43). Over the course of these experiments we did detect one such large deletion mutation 398 when we sequenced clone DTM28. The deletion spans 21 kbp and encompasses genes 399 DVX_201 to 239 (Figure 6). In the initial assembly, we found 11 sequence reads that Qin et al. Vaccinia virus recombination Page 16 of 31 400 started in gene DVX_201 and terminated in gene DVX_239 (Figure 6a), along with 401 sequence reads derived from all of the intervening genes. The deletion spans the right 402 TIR boundary, but amongst the reads were some from the unique genes DVX_202-209 403 suggesting we had sequenced a stock of virus containing the DTM28 parent contaminated 404 by a virus bearing the deletion (DTM28Δ). To confirm this interpretation of the data we 405 prepared primers 201F and 239R (which are located 21 kbp apart in genes DVX_201 and 406 DVX_239, respectively; Figure 6b) and used the PCR to detect the novel 1.2 kbp 407 amplicon that was predicted to be formed in this process (Figure 6c). We also tested 408 DNAs extracted from the virus stocks that had been archived during the process of 409 passaging these viruses 5 times, before cloning, as well as DTM27, another independent 410 clone that was purified in parallel. Only the purified DTM28 stock contained a virus 411 bearing the deletion (Figure 6c) suggesting that DTM28Δ arose during the expansion of 412 the stock. Finally we used the 1.2 kbp amplicon to probe a Southern blot of NdeI-cut 413 virus DNA, and showed that the DTM28 stock contains viruses contributing a 6.7kbp 414 band characteristic of the deletion-containing fragment as well as a 5.4 kbp band, which 415 derives from the two 5.4 kbp NdeI fragments that encode the boundaries of the deletion 416 (Figure 6d). We subsequently sub-cloned this stock and separately isolated the two 417 viruses, confirming the viability of DTM28Δ and the fact that none of the deleted genes 418 are essential (Figure 6e) in cell culture. 419 The DNA surrounding the vaccinia virus right TIR boundary is a well-established 420 hotspot for large deletion mutations (23). The mechanism is probably the same as that 421 which drives the formation of small deletion mutations, stating with the misalignment of 422 regions containing imperfect repeats (9, 27). If one aligns the reads spanning the junction 423 boundary between DVX_201 and DVX_239, one sees several small blocks of homology 424 (Figure 6a, boxed) that could have stabilized the first step in an illegitimate 425 recombination reaction. It is difficult to establish an exact rate by which such mutations Qin et al. Vaccinia virus recombination Page 17 of 31 426 arise, but this stock was plaque purified three times, following bulk up and only one virus 427 in 16 DTM viruses passaged in parallel suffered a deletion of this type. This creates a rate 428 of ~0.06/4 passages or 1 deletion per 70 passages. The six large deletions introduced into 429 MVA over 570 passages are thus quite consistent with this estimate although, of course, 430 the selection pressures are very different in the two experiments. 431 432 Recombination in SFV-reactivated vaccinia viruses. A third small collection of 433 recombinant viruses was also produced using Shope fibroma virus mediated DNA 434 reactivation assays and DNAs extracted from DPP17 and TianTan strain TP03 (22). [We 435 used TP03, instead of the TP05 used for the preceding experiments, to test whether 436 viruses could also be produced encoding all three of the large TP03 and DP17 telomeric 437 deletions.] This method relies upon a replicating helper virus (SFV) to rescue or 438 “reactivate” fragments of transfected virus DNA (VACV). The SFV is subsequently 439 eliminated by passage on a cell line that supports only VACV growth. Figure 7 shows the 440 maps of the viruses that were recovered by this method. There were just four viruses 441 obtained and two (DTD03 and DTD11) are so similar that they are probably “sibs” 442 sharing a mostly common history. These viruses were too few in number, and the passage 443 history too complicated, to derive much in the way of statistics about recombination 444 patterns, but the pattern of exchanges generally resembled the lesser numbers and longer 445 conversion tracks seen in the DTH viruses. The method did also produce clones bearing 446 the three large telomeric deletions (DTD03 and DTD18, Figure 7), which left the virus 447 with TIRs just 7.3 kbp long. An important caveat is that the DTD viruses were recovered 448 from cells that had been transfected for a few hours and then incubated for three days, so 449 whether the recombinants were produced during the reactivation stage or during 450 subsequent rounds of re-infection and replication is difficult to deduce. Qin et al. Vaccinia virus recombination Page 18 of 31 451 Overall, there were no strikingly unique features of these reactivated viruses that 452 would differentiate them from any other type of recombinant poxvirus. Perhaps the most 453 important conclusion that could be drawn from this brief study is that this process is very 454 accurate (no mutant viruses were recovered) and no Shope fibroma virus DNA sequences 455 were detected in any of the reactivated VACV. The two most similar genes in SFV and 456 VACV are S068R and J6R, respectively (44), which share only 73% nucleotide sequence 457 identity with no blocks of perfect alignment >17 nt. There is even less similarity between 458 VACV and fowlpox virus, another virus that has also been used to reactivate 459 Orthopoxviruses (45). This is probably insufficient sequence similarity to support 460 frequent recombination between the helper and reactivated viruses. Additionally VACV 461 hybrids may well be rare and difficult to isolate in the absence of selection, if not simply 462 inviable. Such data support the long-standing suspicion that using a heterologous helper 463 virus, like SFV or fowlpox virus, to reactivate Orthopoxviruses can be done without 464 mutation and does not produce hybrid strains. 465 466 Conclusions. Next generation DNA sequencing technologies are greatly improving our 467 understanding of the genome structures and genes encoded by large DNA viruses. Here 468 we show that these methods can also be used to characterize the structures of 469 recombinant poxviruses. These studies show that recombinant VACV are not surprisingly 470 composed of a patchwork of DNA fragments derived from the parent viruses. The 471 numbers of exchanges varies depending upon the passage history, but if one uses 472 methods like those classically used to produce VACV recombinants (a high multiplicity 473 of infection [10] and one day of co-culture), one detects about 1 physical crossover per 12 474 kbp in the DTH viruses, a number only slightly higher than the ~8 kbp we have estimated 475 from a review of the older genetic literature. However, there is a lot of noise observed in Qin et al. Vaccinia virus recombination Page 19 of 31 476 this number (12±19 kbp), perhaps explaining why accurate classical recombination maps 477 were never produced for VACV. 478 Interestingly the lengths of the recombinant patches (i.e. the conversion tracts) are 479 heavily biased towards shorter sizes, something that would favour intragenic 480 recombination. What mechanism would produce such an effect is difficult to identify, 481 although we have previously used genetic methods to show that VACV replication and 482 recombination are intimately linked processes (18, 46), probably because the VACV E9 483 DNA polymerase exhibits properties characteristic of a recombinase both in vitro (21) 484 and in vivo (20). Thus recombination may just be an indirect by-product of virus 485 replication, conceivably associated with the DNA polymerase-catalyzed repair of broken 486 replication structures. Regardless of the mechanism, this process could have interesting 487 genetic consequences for virus evolution, as it would create a lot of diversity within 488 recombinant genes, not just diverse combinations of different genes. This becomes of 489 critical importance when one considers the challenge posed to viruses by rapidly evolving 490 responses to biological features like immunodominant epitopes. Short conversion tracks 491 offer a selective advantage for a virus, as they provide a mechanism for rearranging and 492 eliminating peptide epitopes while still retaining gene function. 493 These studies also show how sequencing could be used to characterize more complex 494 virus traits than those regulated by single genes. Continued passage of the DTM viruses 495 selected for viruses bearing greater proportions of the TianTan genome and this was 496 correlated in some, still unclear, manner to plaque size. By producing recombinants, 497 applying a selection strategy (perhaps in an iterative manner), and then sequencing clones 498 bearing the desired traits, it should be possible to map genes that collectively regulate the 499 phenotype of interest. This is not a novel approach of course; related methods have been 500 used for decades to map complex genetic traits in many different organisms. However, 501 the widespread availability of next generation sequencing technologies creates a tool that Qin et al. Vaccinia virus recombination Page 20 of 31 502 could easily be used by many more laboratories studying gene families and gene 503 interactions in large DNA viruses. 504 Acknowledgements. We thank Dr. Wendy Magee and Mr. Rob Maranchuk for their 505 technical supports with the Roche 454 Junior sequencer. This work was supported by 506 operating grants from the Canadian Institutes for Health Research and the Alberta Cancer 507 Foundation and by an infrastructure award from the Canada Foundation for Innovation. Qin et al. Vaccinia virus recombination Page 21 of 31 508 FIGURE LEGENDS 509 510 Figure 1. Patterns of DNA exchange in recombinant vaccinia viruses. The genome 511 sequences of DTM (panel A) and DTH (panel B) recombinant clones were aligned 512 against the parent genomes DPP17 and TP05 using the program “LAGAN”, and edited 513 using the program “Base-by-Base”. TP05 was used as the reference strain and any 514 differences between a given virus and TP05 are colour coded to indicate insertion, 515 substitution, and deletion mutations derived from strain DPP17 (inset at bottom). Thus 516 the blank regions represented fragments derived from TP05. 517 518 Figure 2. Rare mutations associated with replication and recombination. Panel A 519 shows a deletion mutation in DTM29, immediately adjacent to a G-to-T SNP found at 520 alignment position 70493. Panel B shows a C-to-T substitution detected only in clone 521 DTM27 at position 900. 522 523 Figure 3. Numbers of exchanges in DTM and DTH clones. Each of the hybrid viruses 524 was first aligned against strains TP05 and DPP17. Then, the program “Base-by-Base” 525 was used to determine where each cross-over was located relative to the 1399 SNPs that 526 differentiate the two strains, along with the number of such exchanges. The viruses 527 passaged five times (DTM) exhibited more exchanges per genome than the viruses 528 passed just once (DTH). That is 30±11 versus 18±11 exchanges/genome, respectively. 529 530 Figure 4. Length of the DNA segments exchanged in DTH clones. The lengths of all 531 the conversion tracks were measured in all 14 genomes using midpoints defined by the 532 four SNPs flanking the two bounding sites of exchange. The numbers of events, of a 533 given exchange length, were then determined by assignment to 200 bp bins. A Qin et al. Vaccinia virus recombination Page 22 of 31 534 semi-logarithm of the bin size (i.e. exchange length) is presented because the values 535 differ so greatly in scale across the different genomes. VACV recombination appears to 536 be associated with a disproportionate number of very short exchanges. Because there is 537 approximately one SNP per 140 bp, greater resolution than ~200 bp is not achievable. 538 539 Figure 5. Biased selection for sequences associated with the TianTan parent. The 540 percent of DNA derived from each of the parental viruses was determined from the 541 fraction of SNPs derived from each parent. Panel A shows how the composition varied in 542 viruses passaged just once (DTH hybrids) or five times (DTM hybrids) prior to cloning. 543 Passage appeared to select for SNPs linked to the TP05 TianTan parent, as the percentage 544 of Dryvax DNA decreased from 50±27% to 19±11% with continued passage. Panel B 545 illustrates how the plaque size is related to the genetic origins of the hybrid. The viruses 546 forming smaller plaques, more closely resemble the DPP17 parent. To measure the 547 plaque size, each of the cloned hybrids was plated on BSC-40 cells (in parallel), cultured 548 for two days, stained with crystal violet, scanned, and the plaque area determined using 549 ImageJ(24). Twenty randomly selected plaques were measured for each virus. 550 551 Figure 6. Illegitimate recombination detected during the cloning and sequencing of 552 hybrid DTM28. During the sequencing of DTM28, 11 reads were detected linking gene 553 DVX_201 to gene DVX_239. Panel A shows an alignment of these reads to sequences 554 within the two genes, which are normally spaced 21 kbp apart. We have also identified 555 sequence identities (circles), short patches of homology (boxed) and a simple repeat 556 (underlined) common to sequences flanking the fusion site. The sequence in these reads 557 transitions cleanly from one gene to the next, with no evidence of any unrelated 558 additional sequences having been added in the process. Panel B showed a way to form 559 this deletion. Illegitimate recombination between identical parents (DTM28) excised Qin et al. Vaccinia virus recombination Page 23 of 31 560 21kbp and created the virus we subsequently called DTM28Δ. Panel C shows the results 561 of a PCR analysis using primers targeting sites flanking the fusion site. These are located 562 too far apart in the parent viruses (e.g. DTM27) to amplify 21 kpb of intervening 563 sequence. The DTM28Δ virus was probably formed during the expansion of the clone 564 prior to sequencing, as it is not detected in intermediary viruses during the course of 565 passages. Panel D shows a Southern blot of NdeI-digested virus DNA showing that the 566 sequenced virus stock contained two viruses. These are the DTM28 hybrid (indicated by 567 a 5.4 kbp fragment common to both parent strains), and the DTM28Δ 568 (indicated by a 6.7 kbp fragment containing the fusion junction). Panel E shows the 569 DTM28Δ is independently viable. Six randomly selected viruses were separately plaque 570 purified from the sequenced stock and the PCR was used to detect sequences found only 571 in the deleted region in DTM28 (primers 208F+209R) or only capable of being amplified 572 if the intervening sequences are deleted (primers 201F+239R). 573 574 Figure 7. Patterns of DNA exchange in recombinant vaccinia viruses produced using 575 Leporipoxvirus-mediated reactivation reactions. The genome sequences of the DTD 576 recombinant clones were aligned against the parent genomes DPP17 and TP03 using the 577 program “LAGAN”, and edited using the program “Base-by-Base”. Because this 578 experiment used TP03 DNA, and TP05 was always used as the reference strain in all of 579 our analyses (Figure 1), the telomeric deletion mutations that differentiate TP05 from 580 TP03 show up as additional red blocks in the TP03 alignment. 581 Qin et al. Vaccinia virus recombination Page 24 of 31 582 TABLES 583 584 Table 1. PCR primers used in this study 585 Amplicon size (bp) DPP17 TP05 1120 - - 653 1230 665 225 260 712 712 Primer ID Primer (5’-to-3’) DVX-209F CGAAGAAGATGATGGGGAC DVX-226R ATAAGAGGAAAGAGGACAC DVX-213F CGTTGGATGGATTCGATA DVX-226R ATAAGAGGAAAGAGGACAC DVX-004F GCAGTAGGCTAGTATCTT DVX-007R TACCGGCATCATAAACAC DVX-107F AACTGGAGTAGAGATAGC DVX-108R CCGAGAATATAGCTGTCC 201F AATATGATGGTGATGAGCGA 239R TATTGCGAGATGTGAAGG 208F TTTCTTCTCTTCTCCCTTTC 209R ATTCTATCCCGTACCTCT 586 Qin et al. Vaccinia virus recombination Page 25 of 31 587 Table 2. Gene differences in the right TIR deletion: TP05 versus DPP17. 588 Gene/virus Gene (or feature) Nucleotide length (bp) Copenhagen Dryvax DPP17 TP05 IL-1-β-receptor Cop-B16R DVX_209 1002 981 Unknown Cop-B17L DVX_210 - 1023 Ankyrin motifs Cop-B18R DVX_211 - 1725 IFN-α/β-receptor Cop-B19R DVX_212 - 1056 Ankyrin motifs Cop-B20R DVX_213 - 1794 589 Qin et al. Vaccinia virus recombination Page 26 of 31 590 Table 3. Gene complement in parent and hybrid viruses Virus DPP17 DTH13 DTH22 DTH36 DTH21 DTH31 DTH08 DTH34 DTM29 DTH06 DTH27 DTH10.2 DTH41 DTM03 DTM10 DTH30 DTH28 DTM32 DTM28 DTM27 DTH10 DTM30 DTM11 DTM22.2 DTM09 DTM33 DTM22.1 DTM06 DTM04 DTM19 DTH14 DTM08 TP05 Qin et al. Plaque area 100% 101 103 108 111 112 115 118 124 126 131 137 137 140 141 144 146 150 156 158 160 162 168 175 176 178 179 181 186 188 199 204 206 Telo mere D1 D D D T2 T D D T D T D T D D D T D D T T T T D D T T T T T T T T right TIR -3 + + + + + + + + + + + + + + + + + + + F4L C23L M1L F3L E5R A51R + + + + + + + + + + + + + + + + + + + + + +4 + + + + + + + + + + + - + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + Vaccinia virus recombination Page 27 of 31 591 1. D=DPP17-like telomere repeats; 2. T=TP05-like telomere repeats; 3. Gene or genes 592 are truncated or deleted; 4. Gene appears intact (gray shading). 593 REFERENCES CITED 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. Hershey AD, Rotman R. 1948. Linkage Among Genes Controlling Inhibition of Lysis in a Bacterial Virus. Proc Natl Acad Sci U S A 34:89-96. Wildy P. 1955. Recombination with herpes simplex virus. J Gen Microbiol 13:346-360. Fenner F, Comben BM. 1958. [Genetic studies with mammalian poxviruses. I. Demonstration of recombination between two strains of vaccina virus]. Virology 5:530-548. Woodroofe GM, Fenner F. 1960. Genetic studies with mammalian poxviruses. IV. Hybridization between several different poxviruses. Virology 12:272-282. Bedson HS, Dumbell KR. 1964. Hybrids Derived from the Viruses of Variola Major and Cowpox. The Journal of hygiene 62:147-158. Bedson HS, Dumbell KR. 1964. Hybrids Derived from the Viruses of Alastrim and Rabbit Pox. The Journal of hygiene 62:141-146. Strayer DS, Skaletsky E, Cabirac GF, Sharp PA, Corbeil LB, Sell S, Leibowitz JL. 1983. Malignant rabbit fibroma virus causes secondary immunosuppression in rabbits. J Immunol 130:399-404. Esposito JJ, Sammons SA, Frace AM, Osborne JD, Olsen-Rasmussen M, Zhang M, Govil D, Damon IK, Kline R, Laker M, Li Y, Smith GL, Meyer H, Leduc JW, Wohlhueter RM. 2006. Genome sequence diversity and clues to the evolution of variola (smallpox) virus. Science 313:807-812. Qin L, Upton C, Hazes B, Evans DH. 2011. Genomic analysis of the vaccinia virus strain variants found in Dryvax vaccine. J Virol 85:13049-13060. Ensinger MJ, Rovinsky M. 1983. Marker rescue of temperature-sensitive mutations of vaccinia virus WR: correlation of genetic and physical maps. J Virol 48:419-428. Ensinger MJ. 1982. Isolation and genetic characterization of temperature-sensitive mutants of vaccinia virus WR. J Virol 43:778-790. Condit RC, Motyczka A, Spizz G. 1983. Isolation, characterization, and physical mapping of temperature-sensitive mutants of vaccinia virus. Virology 128:429-443. Lin YC, Evans DH. 2010. Vaccinia virus particles mix inefficiently, and in a way that would restrict viral recombination, in coinfected cells. J Virol 84:2432-2443. Qin et al. Vaccinia virus recombination Page 28 of 31 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. Panicali D, Paoletti E. 1982. Construction of poxviruses as cloning vectors: insertion of the thymidine kinase gene from herpes simplex virus into the DNA of infectious vaccinia virus. Proc Natl Acad Sci U S A 79:4927-4931. Mackett M, Smith GL, Moss B. 1982. Vaccinia virus: a selectable eukaryotic cloning and expression vector. Proc Natl Acad Sci U S A 79:7415-7419. Ball LA. 1987. High-frequency homologous recombination in vaccinia virus DNA. J Virol 61:1788-1795. Ball LA. 1995. Fidelity of homologous recombination in vaccinia virus DNA. Virology 209:688-691. Evans DH, Stuart D, McFadden G. 1988. High levels of genetic recombination among cotransfected plasmid DNAs in poxvirus-infected mammalian cells. J Virol 62:367-375. Condit RC. 2007. Vaccinia, Inc.--probing the functional substructure of poxviral replication factories. Cell Host Microbe 2:205-207. Gammon DB, Evans DH. 2009. The 3'-to-5' exonuclease activity of vaccinia virus DNA polymerase is essential and plays a role in promoting virus genetic recombination. J Virol 83:4236-4250. Willer DO, Yao XD, Mann MJ, Evans DH. 2000. In vitro concatemer formation catalyzed by vaccinia virus DNA polymerase. Virology 278:562-569. Yao XD, Evans DH. 2003. High-frequency genetic recombination and reactivation of orthopoxviruses from DNA fragments transfected into leporipoxvirus-infected cells. J Virol 77:7281-7290. Qin L, Liang M, Evans DH. 2013. Genomic analysis of vaccinia virus strain TianTan provides new insights into the evolution and evolutionary relationships between Orthopoxviruses. Virology 442:59-66. Abramoff MD, Magalhaes, P.J., Ram, S.J. 2004. Image Processing with ImageJ. Biophotonics International 11:36-42. Brudno M, Do CB, Cooper GM, Kim MF, Davydov E, Green ED, Sidow A, Batzoglou S. 2003. LAGAN and Multi-LAGAN: efficient tools for large-scale multiple alignment of genomic DNA. Genome Res 13:721-731. Brodie R, Smith AJ, Roper RL, Tcherepanov V, Upton C. 2004. Base-By-Base: single nucleotide-level analysis of whole viral genome alignments. BMC Bioinformatics 5:96. Coulson D, Upton C. 2011. Characterization of indels in poxvirus genomes. Virus Genes 42:171-177. Goodman MF, Fygenson KD. 1998. DNA polymerase fidelity: from genetics toward a biochemical understanding. Genetics 148:1475-1482. Qin et al. Vaccinia virus recombination Page 29 of 31 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. Taddie JA, Traktman P. 1991. Genetic characterization of the vaccinia virus DNA polymerase: identification of point mutations conferring altered drug sensitivities and reduced fidelity. J Virol 65:869-879. Taddie JA, Traktman P. 1993. Genetic characterization of the vaccinia virus DNA polymerase: cytosine arabinoside resistance requires a variable lesion conferring phosphonoacetate resistance in conjunction with an invariant mutation localized to the 3'-5' exonuclease domain. J Virol 67:4323-4336. Andrei G, Gammon DB, Fiten P, De Clercq E, Opdenakker G, Snoeck R, Evans DH. 2006. Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice. J Virol 80:9391-9401. Slabaugh MB, Roseman NA, Mathews CK. 1989. Amplification of the ribonucleotide reductase small subunit gene: analysis of novel joints and the mechanism of gene duplication in vaccinia virus. Nucleic Acids Res 17:7073-7088. Elde NC, Child SJ, Eickbush MT, Kitzman JO, Rogers KS, Shendure J, Geballe AP, Malik HS. 2012. Poxviruses deploy genomic accordions to adapt rapidly against host antiviral defenses. Cell 150:831-841. Fathi Z, Dyster LM, Seto J, Condit RC, Niles EG. 1991. Intragenic and intergenic recombination between temperature-sensitive mutants of vaccinia virus. J Gen Virol 72 ( Pt 11):2733-2737. Parks RJ, Evans DH. 1991. Effect of marker distance and orientation on recombinant formation in poxvirus-infected cells. J Virol 65:1263-1272. DeLange AM, McFadden G. 1986. Sequence-nonspecific replication of transfected plasmid DNA in poxvirus- infected cells. Proc Natl Acad Sci U S A 83:614-618. Fisher C, Parks RJ, Lauzon ML, Evans DH. 1991. Heteroduplex DNA formation is associated with replication and recombination in poxvirus-infected cells. Genetics 129:7-18. Maiti A, Drohat AC. 2011. Dependence of substrate binding and catalysis on pH, ionic strength, and temperature for thymine DNA glycosylase: Insights into recognition and processing of G.T mispairs. DNA Repair (Amst) 10:545-553. Tcherepanov V, Ehlers A, Upton C. 2006. Genome Annotation Transfer Utility (GATU): rapid annotation of viral genomes using a closely related reference genome. BMC Genomics 7:150. Gammon DB, Gowrishankar B, Duraffour S, Andrei G, Upton C, Evans DH. 2010. Vaccinia virus-encoded ribonucleotide reductase subunits are differentially required for replication and pathogenesis. PLoS Pathog 6:e1000984. Qin et al. Vaccinia virus recombination Page 30 of 31 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 41. 42. 43. 44. 45. 46. Froggatt GC, Smith GL, Beard PM. 2007. Vaccinia virus gene F3L encodes an intracellular protein that affects the innate immune response. J Gen Virol 88:1917-1921. Murcia-Nicolas A, Bolbach G, Blais JC, Beaud G. 1999. Identification by mass spectroscopy of three major early proteins associated with virosomes in vaccinia virus-infected cells. Virus Res 59:1-12. Antoine G, Scheiflinger F, Dorner F, Falkner FG. 1998. The complete genomic sequence of the modified vaccinia Ankara strain: comparison with other orthopoxviruses. Virology 244:365-396. Willer DO, McFadden G, Evans DH. 1999. The complete genome sequence of shope (rabbit) fibroma virus. Virology 264:319-343. Scheiflinger F, Dorner F, Falkner FG. 1992. Construction of chimeric vaccinia viruses by molecular cloning and packaging. Proc Natl Acad Sci U S A 89:9977-9981. Willer DO, Mann MJ, Zhang W, Evans DH. 1999. Vaccinia virus DNA polymerase promotes DNA pairing and strand-transfer reactions. Virology 257:511-523. Qin et al. Vaccinia virus recombination Page 31 of 31
© Copyright 2026 ExpyDoc