GENOTYPING BY PCR PROTOCOL MUTANT MOUSE REGIONAL RESOURCE CENTER: UC DAVIS [email protected] 530-754-MMRRC NAME OF PCR: Universal tdTomato MMRRC # UCD Protocol: Reagent/ Constituent Water 10x Buffer MgCl2 (stock concentration is 25mM) Betaine (stock concentration is 5M) dNTPs (stock concentration is 10mM) DMSO Primer 1 (stock concentration is 20μM) tdTomato Fwd Primer 2 (stock concentration is 20μM) tdTomato Rev2 Taq Polymerase (5Units/μL) DNA extracted with NaOH Proteinase K Volume (μL) 11.725 2.5 1.7 6.5 0.5 0.325 0.25 0.25 0.25 1.0 Other: TOTAL VOLUME OF REACTION: 25.00 Comments on protocol: o o Use Touch-Down cycling protocol-first 10 cycles anneal at 65 C decreasing in temperature by 1.0 C; next 30 cycles o anneal at 55 C. Betaine/DMSO is standardized due to high GC content in promoter regions and protocol may be tested without. Also, may adjust MgCl2 to increase reaction or decrease non specific amplifications. Strategy: Steps 1. Initiation/Melting 2. Denaturation 3. Annealing 4. Elongation 5. Amplification 6. Finish } o HOT START? steps 2-3-4 will cycle in sequence Temp ( C ) 94 94 65 to 55 (↓1oC/cycle) 72 72 4 Time (m:ss) 5:00 0:15 0:30 0:40 5:00 # of Cycles ∞ n/a Primers: Name Nucleotide Sequence (5' - 3') AGCAAGGGCGAGGAGGTCATC CCTTGGAGCCGTACATGAACTGG 1: tdTomato Fwd 2: tdTomato Rev2 Electrophoresis Protocol: Agarose: 1.5% V: 90 Estimated Running Time: 90 min. Primer Combination Band Genotype 1 and 2 208 bp tdTomato 1 2 3 4 Lanes 1. No Template Control 2. Wild-type 3. tdTomato positive 4. tdTomato positive PCR protocol developed by MMRRC at University of California, Davis 1 } 40x 1
© Copyright 2026 ExpyDoc