Sample & Assay Technologies Welcome! Next generation sequencing for cancer research Ravi Vijaya Satya, Ph.D. Contact Technical Support North America: • [email protected] or [email protected] Phone: 1-800-362-7737 International customers: [email protected] Webinar related questions: [email protected] Sample & Assay Technologies Four part webinar series on NGS Webinar 1: Next-generation sequencing, an introduction to technology and applications Speaker: Quan Peng, Scientist, Genomics Assay Development – QIAGEN Webinar 2: Next-generation sequencing for cancer research Speaker: Raed Samara, Global Product Manager for NGS – QIAGEN Webinar 3: Next-generation sequencing data analysis for genetic profiling Speaker: Ravi Vijaya Satya, Senior Scientist, Bioinformatics – QIAGEN Webinar 4: Advancing Biological Analysis and Interpretation in Cancer Studies Speaker: Nathan Pearson, Principal Genome Scientist – Ingenuity, a QIAGEN company 2 Sample & Assay Technologies Welcome to the four-part webinar series Next Generation Sequencing and its role in cancer biology Webinar 1: Next-generation sequencing, an introduction to technology and applications Date: February 4, 2014 Speaker: Quan Peng, Scientist, Genomics Assay Development – QIAGEN Webinar 2: Next-generation sequencing for cancer research Date: February 11, 2014 Speaker: Raed Samara, Global Product Manager for NGS – QIAGEN Webinar 3: Next-generation sequencing data analysis for genetic profiling Date: February 18, 2014 Speaker: Ravi Vijaya Satya, Senior Scientist, Bioinformatics – QIAGEN Webinar 4: Advancing Biological Analysis and Interpretation in Cancer Studies Date: February 25, 2014 Speaker: Nathan Pearson, Principal Genome Scientist – Ingenuity, a QIAGEN company Title, Location, Date 3 Sample & Assay Technologies Legal Disclaimer QIAGEN products shown here are intended for molecular biology applications. These products are not intended for the diagnosis, prevention, or treatment of a disease. For up-to-date licensing information and product-specific disclaimers, see the respective QIAGEN kit handbook or user manual. QIAGEN kit handbooks and user manuals are available at www.QIAGEN.com or can be requested from QIAGEN Technical Services or your local distributor. Title, Location, Date 4 Sample & Assay Technologies Agenda NGS Data Analysis Read Mapping Variant Calling Variant Annotation Targeted Enrichment GeneRead Gene Panels GeneRead Data Analysis Portal Workflow Interface Data Interpretation 5 Sample & Assay Technologies Read Mapping Reads mapped to a reference genome Millions of reads from a single run Alignment Mapping Quality Programs for read-mapping Hash-based: MAQ, ELAND, SOAP, Novoalign Suffix array/Burrows Wheeler Transform based: BWA, BowTie, BowTie2, SOAP2 Title, Location, Date 6 Sample & Assay Technologies Variant Calling Determine if there is enough statistical support to call a variant Reference sequence ACAGTTAAGCCTGAACTAGACTAGGATCGTCCTAGATAGTCTCGATAGCTCGATATC Aligned reads AACTAGACTAGGATCGTCCTAGATAGTCTCG AACTAGACTAGGATCGTCCTACATAGTCTCG AACTAGACTAGGATCGTCCTACATAGTCTCG GATCGTCCTAGATAGTCTCGATAGCTCGAT GATCGTCCTAGATAGTCTCGATAGCTCGAT GATCGTCCTAGATAGTCTCGATAGCTCGAT Multiple factors are considered in calling variants No. of reads with the variant Mapping qualities of the reads Base qualities at the variant position Strand bias (variant is seen in only one of the strands) Variant Calling Software GATK Unified Genotyper, Torrent Variant Caller, SamTools, Mutect, … Title, Location, Date 7 Sample & Assay Technologies Variant Representation VCF – Variant Call Format http://www.1000genomes.org/wiki/Analysis/Variant%20Call%20Format/vcf-variant-call-format-version-41 Header lines ##fileformat=VCFv4.1 ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype"> ##INFO=<ID=DP,Number=1,Type=Integer,Description="Approximate read depth; some reads may have been filtered"> ##INFO=<ID=FS,Number=1,Type=Float,Description="Phred-scaled p-value using Fisher's exact test to detect strand bias"> ##INFO=<ID=MQ,Number=1,Type=Float,Description="RMS Mapping Quality"> ##INFO=<ID=OND,Number=1,Type=Float,Description="Overall non-diploid ratio (alleles/(alleles+nonalleles))"> ##INFO=<ID=QD,Number=1,Type=Float,Description="Variant Confidence/Quality by Depth"> ##contig=<ID=chrM,length=16571,assembly=hg19> ##contig=<ID=chr1,length=249250621,assembly=hg19> ##contig=<ID=chr2,length=243199373,assembly=hg19> Column labels ##contig=<ID=chr3,length=198022430,assembly=hg19> ##contig=<ID=chr4,length=191154276,assembly=hg19> #CHROM POS ID REF ALT QUAL FILTER INFO FORMAT Sample chr1 11181327 rs11121691 C T 100.0 PASS DP=1000;MQ=87.67 GT:AD:DP 0/1:146,45:191 chr1 11190646 rs2275527 G A 100.0 PASS DP=1000;MQ=67.38 GT:AD:DP 0/1:462,121:583 chr1 11205058 rs1057079 C T 100.0 PASS DP=1000;MQ=79.57 GT:AD:DP 0/1:49,143:192 Variant calls Title, Location, Date 8 Variant Annotation Sample & Assay Technologies dbSNP/COSMIC ID Chro m chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr1 chr2 R ef 11181327 rs11121691 C 11190646 rs2275527 G 11205058 rs1057079 C 11288758 rs1064261 G 11300344 rs191073707 C 11301714 rs1135172 A 11322628 rs2295080 G 186641626 rs2853805 G 186642429 rs2206593 A 186643058 rs5275 A 186645927 rs2066826 C 29415792 rs1728828 G Pos ID Alt T A T A T G T A G G T A Actual change and position within the codon or amino acid sequence Gene Mutation Name type MTOR SNP MTOR SNP MTOR SNP MTOR SNP MTOR SNP MTOR SNP MTOR SNP PTGS2 SNP PTGS2 SNP PTGS2 SNP PTGS2 SNP ALK SNP chr2 29416366 rs1881421 G C ALK SNP chr2 29416481 rs1881420 T C ALK SNP chr2 29416572 rs1670283 T C ALK SNP chr2 29419591 chr2 29445458 chr2 29446184 rs1670284 G T rs3795850 G T rs2276550 C G ALK ALK ALK SNP SNP SNP Effect of the variant on protein coding Codon AA Filtered Variant Allele Frequency snpEff Effect Change Change Coverage Frequency c.6909C>T p.L2303 C=0.761 T=0.239 SYNONYMOUS_CODING 1,924 0.239 c.5553G>A p.S1851 G=0.791 A=0.208 SYNONYMOUS_CODING 5,842 0.208 c.4731C>T p.A1577 C=0.254 T=0.746 SYNONYMOUS_CODING 1,928 0.746 c.2997G>A p.N999 G=0.212 A=0.788 SYNONYMOUS_CODING 5,186 0.788 C=0.924 T=0.076 INTRON 210 0.076 c.1437A>G p.D479 A=0.248 G=0.752 SYNONYMOUS_CODING 3,965 0.752 G=0.239 T=0.755 UPSTREAM 339 0.755 G=0.0 A=1.0 UTR_3_PRIME 97 1 A=0.167 G=0.833 UTR_3_PRIME 3,552 0.833 A=0.759 G=0.241 UTR_3_PRIME 237 0.241 C=0.88 T=0.12 INTRON 209 0.12 G=0.0 A=1.0 UTR_3_PRIME 2,520 1 NON_SYNONYMOUS_CODI c.4587G>C p.D1529E G=0.907 C=0.093 NG 4,361 0.093 NON_SYNONYMOUS_CODI c.4472T>C p.K1491R T=0.954 C=0.045 NG 3,061 0.045 NON_SYNONYMOUS_CODI c.4381T>C p.I1461V T=0.0 C=0.999 NG 5,834 0.999 G=0.093 T=0.907 INTRON 739 0.907 c.3375G>T p.G1125 G=0.917 T=0.082 SYNONYMOUS_CODING 1,776 0.082 C=0.895 G=0.105 INTRON 475 0.105 SIFT score Predicts the deleterious effect of an amino acid change based on how conserved the sequence is among related species Polyphen score Predicts the impact of the variant on protein structure Title, Location, Date 9 Sample & Assay Technologies GeneRead DNAseq Gene Panel: Targeted Sequencing What is targeted sequencing? Sequencing a sub set of regions in the whole-genome Why do we need targeted sequencing? Not all regions in the genome are of interest or relevant to a specific study Exome Sequencing: sequencing most of the exonic regions of the genome (exome). Protein-coding regions constitute less than 2% of the entire genome Focused panel/hot spot sequencing: focused on the genes or regions of interest What are the advantages of focused panel sequencing? More coverage per sample, more sensitive mutation detection More samples per run, lower cost per sample Title, Location, Date 10 Sample & Assay Technologies Target Enrichment - Methodology Multiplex PCR Small DNA input (< 100ng) Short processing time (several hrs) Relatively small throughput (KB - MB region) Sample preparation (DNA isolation) PCR target enrichment (2 hours) Title, Location, Date Library construction Sequencing Data analysis 11 Sample & Assay Technologies Variants Identifiable through Multiplex PCR SNPs – single nucleotide polymorphisms Indels Indels < 20 bp in length CNV Variants callable with the help of a reference Copy number variants (CNVs) Variants not callable Structural variants – Large indels – Inversions Large insertion Inversion Title, Location, Date 12 Sample & Assay Technologies GeneRead DNAseq Gene Panel Multiplex PCR technology based targeted enrichment for DNA sequencing Cover all human exons (coding region + UTR) Division of gene primers sets into 4 tubes; up to 1200 plex in each tube 13 Sample & Assay Technologies GeneRead DNAseq Gene Panel Focus on your Disease of Interest Comprehensive Cancer Panel (124 genes) Disease Focused Gene Panels (20 genes) Genes Involved in Disease Breast cancer Colon Cancer Gastric cancer Leukemia Liver cancer Lung Cancer Ovarian Cancer Prostate Cancer Genes with High Relevance 14 Sample & Assay Technologies GeneRead DNAseq Custom Panel 15 Sample & Assay Technologies Data Analysis for Targeted Sequencing GeneRead data analysis work flow Read Mapping Primer Trimming Variant Calling Variant Annotation Read mapping Identify the possible position of the read within the reference Align the read sequence to reference sequences Primer trimming Remove primer sequences from the reads Variant calling Identify differences between the reference and reads Variant filtering and annotation Functional information about the variant Title, Location, Date 16 Sample & Assay Technologies Reads from Targeted Sequencing Typical NGS raw read from targeted sequencing Adapter Barcode Primer Insert sequence Primer Adapter -3’ 5’Removal of adapters and de-multiplexing Primer Insert sequence Primer -3’ 5’-3’ 5’Read length can vary: only part of the insert 5’or the 3’ primer may be present 5’- -3’ -3’ Title, Location, Date 17 Sample & Assay Technologies Read Mapping Align reads to the reference genome Reference sequence Amplicon 1 Amplicon 2 Aligned reads Title, Location, Date 18 Primer Trimming Sample & Assay Technologies Primer sequences must be trimmed for accurate variant calling Reference sequence Amplicon 1 Frequency of `C` without primer trimming = 4/13 = 31% C C C C Aligned reads Amplicon 2 Title, Location, Date Frequency of `C` after primer trimming = 4/7 = 57% 19 Sample & Assay Technologies GeneRead Variant Calling Overview Raw reads from the sequencer (de-multiplexed) GeneRead panel ID Annotation Analysis mode snpEff (basic annotation) Read mapping and post-processing dbSNP MiSeq/HiSeq Sequencing platform BowTie2/BWA IonTorrent Cosmic TMAP BAM GATK Indel Realigner ClinVar BAM GATK Base Quality Score Recalibrator BAM dbNSFP VCF BAM Primer Trimming BAM SnpSift (links to dbSNP, Cosmic and computation of Sift scores, etc.) Primer Trimming BAQ Computation Variant calling and filtering BAM GATK Unified VCF Genotyper BAM GATK Variant Annotator Torrent Variant Caller (TVC) VCF VCF VCF GATK Variant Filtration VCF VCF Additional filtering (based on frequency and coverage) VCF Variants in Excel format Separate interface, free preview available Title, Location, Date Variants in Ingenuity® Variant Analysis™ 20 Sample & Assay Technologies Indel Realignment DePristo MA, et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 2011 May; 13(5):191-8. PMID: 21178889 Eliminates some false-positive variant calls around indels Read aligners can not eliminate these alignment errors since they align reads independently Multiple sequence alignment can identify these errors and correct them Title, Location, Date 21 Sample & Assay Technologies Base Quality Recalibration DePristo MA, et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 2011 May; 13(5):191-8. PMID: 21178889 Eliminates sequencer-specific biases Lane-specific/sample-specific biases Instrument-specific under-reporting/over-reporting of quality scores Systematic errors based on read position Di-nucleotide-specific sequencing errors Recalibration leads to improved variant calls Title, Location, Date 22 Sample & Assay Technologies Variant Filtration Variant Frequency Somatic mode – SNPs with frequency < 4% and indels with frequency < 20% Germline mode – SNPs with frequency < 20% and indels with frequency < 25% Strand Bias SNPs with FS ≤ 60 Indels with FS ≤ 200 Mapping Quality SNPs with MQ ≤ 40.0 Haplotype Score SNPs with HaplotypeScore ≤ 13.0 Not applicable for pooled samples Title, Location, Date C C C Strand Bias: variants that are present in reads from only one of the two strands 23 Sample & Assay Technologies Haplotype Score Helps remove false positives due to errors in sequencing or alignment Title, Location, Date 24 Sample & Assay Technologies Specificity Analysis Specificity: the percentage of sequences that map to the intended targets region of interest number of on-target reads / total number of reads Reference sequence ROI 1 ROI 2 NGS reads Off-target reads On-target reads Title, Location, Date On-target reads 25 Sample & Assay Technologies NGS Data Analysis: Coverage Depth and Uniformity Coverage depth (or depth of coverage): how many times each base has been sequenced Coverage uniformity: evenness of the coverage depth along the target region Reference sequence NGS reads coverage depth = 10 coverage depth = 3 coverage depth = 2 Title, Location, Date 26 Sample & Assay Technologies GeneRead Data Analysis Web Portal FREE Complete & Easy to use Data Analysis with Web-based Software • • .bam file (Ion Torrent) .fastq or .fastq.gz (MiSeq/HiSeq) 27 Sample & Assay Technologies GeneRead Data Analysis Web Portal Title, Location, Date 28 Sample & Assay Technologies Job Submission Title, Location, Date 29 Sample & Assay Technologies Retrieving Results Title, Location, Date 30 Sample & Assay Technologies Results Title, Location, Date 31 Sample & Assay Technologies Summary Run Summary Specificity Coverage Uniformity Numbers of SNPs and Indels Summary By Gene Specificity Coverage Uniformity # of SNPs and Indels 32 Sample & Assay Technologies Features of Variant Report SNP detection Indel detection 33 Sample & Assay Technologies Biological Interpretation Using IVA VCF to Ingenuity Variant Analysis Built-in optimized support for uploading called variant files in VCF format Create analysis by answering a few questions about study Study Type Repeat workflows Title, Location, Date 34 Sample & Assay Technologies Features of Ingenuity Variant Analysis Annotate samples with Ingenuity Knowledge Base Compare what’s genetically distinctive Identify and share the most promising variants Interactive filter cascade Share / Publish Ingenuity Annotation Title, Location, Date 35 Sample & Assay Technologies QIAGEN’s GeneRead DNAseq Gene Panel System FOCUS ON YOUR RELEVANT GENES Focused: Biologically relevant content selection enables deep sequencing on relevant genes and identification of rare mutations Flexible: Mix and match any gene of interest NGS platform independent: Functionally validated for PGM, MiSeq/HiSeq Integrated controls: Enabling quality control of prepared library before sequencing Free, complete and easy to use data analysis tool Sample & Assay Technologies Thank you for attending Are you ready to try? Contact Technical Support North America: • • [email protected] [email protected] Phone: 1-800-362-7737 International customers: [email protected] Webinar related questions: [email protected] 37
© Copyright 2026 ExpyDoc