Figure S1. Negative controls in BiFC experiment The negative controls that were conducted by cotransfecting unfused EYFP fragments with a single complementary ABI1 and ABI2 or ACS2 and ACSS6 proteins. Control analyses resulted in no detectable signals. Figure S2. Ethylene production and the immune complex ACS6 activity in WT Col-0 and the abi1td mutant in response to CuSO4 A-B. Seedlings were treated with CuSO4 in GC vials. The accumulated ethylene in the headspace was measured at 24 – 28 hours later. The presented results show average values of the triplicate experiment in three replicates each (n=9). Error bars show standard error. Stars * indicate statistically significant difference at P < 0.05. Figure S3. Chlorophyll content of leaves of the WT and abi1td The chlorophyll content (A, C-D) and chlorophyll a:b ratio (B) in WT Col-0 and abi1td plants in response to 350 ppb ozone treatment. The data show means from two independent experiments with at least five biological replicates each. The asterisk (*) indicates statistically significant changes at P < 0.001. Figure S4. Effect of ozone on glutathione contents in the abi1td mutant The levels (A-C) and the redox state (D) of glutathione in WT Col-0 and in the abi1td mutant. GSH – reduced glutathione; GSSH – oxidized glutathione; FW - fresh weight. The asterisk (*) indicates statistically significant changes at P < 0.009. The experiment was performed twice with similar results. The data represent means of two experiments. The bars represent means ±SD (n = 4). Figure S5. Construction of the StrepTag expression cassette for expression of Strep tagged proteins based on the pGEM-T Easy vector The A. thaliana UBQ10 promoter (from -1482 bp to +1 bp) was PCR amplified from genomic DNA using the UBQ10F and the UBQ10R primers. NOS terminator was amplified using primers NOS1F and NOS1R with pBI121 vector as a template. Intron was cloned from modified intervening sequence 2 (IV2) of the potato LS1 gene (Zhao et al., 2001) delivered by Rosemarie W. Hammond in pUC19 vector using primers STREP1F and STREP1R. 5’ end of One-STrEP-Tag encoding sequence was added to forward primer. 3’ end of One-STrEP-Tag encoding sequence was achieved by hybridization of oligonucleotides STREP2F and STREP2R and subsequent extension of double stranded DNA using Pfu DNA polymerase. 3’ end of IV2 intron was added to STREP2F primer. SfiI restriction sites compatible with pUNI51 vector was added to One-STrEP-Tag via PCR using STREP3F and STREP4R primers. Both DNA fragments of One-STrEP-Tag and intron fusions had overlapping sequences containing ApoI restriction site that was used to join these fragments to each other. XhoI was used to recombine UBQ10 promoter with One-STrEP-Tag:intron:SfiI DNA fragment and EcoRI was used to join NOS terminator to 5’ end of resulting sequence. Amplified sequence of whole expression cassette (primers UBQ10F and NOS1R) was recombined with pGEM-T Easy. Primers used for generation the expression cassette: UBQ10F 5’-GTTGGTGCTT TCCTTACATT CTGA-3’; UBQ10R 5’-AACTCGAGCT GTTAATCAGA AAAACTCAGA TTAA-3’; NOS1F 5’-TGAATTCGAA TTTCCCCGAT CGTTCAAAC-3’; NOS1R 5’-AACTAGTCCG ATCTAGTAAC ATAGATGACA-3’; STREP1F 5’-GGACTCGAGA TGGCTAGCTG GAGCCACCCG CAGTTCGGTA AGTTTCTGCT TCTACCTTT-3’; STREP1R 5’-ATCAACAAAT TTTGGTCATA TATTAGAA-3’; STREP2F 5’-TGACCAAAAT TTGTTGATGT GCAGAGAAAG GTGGAGGTTC CGGAGGTGGA TCGGGAGGTG GATCGT-3’; STREP2R 5’CCAAACCATA TGGGCGCCTT TTTCGAACTG CGGGTGGCTC CACGATCCAC CTCCCGATCC ACCTCCG-3’; STREP3F 5’-TGACCAAAAT TTGTTGATGT GCA-3’; STREP4R 5’-AGAATTCCGG CCCATGAGGC CCTCTAGTGT GGCCTTGACG GCCGGGCGCC TTTTTCGAAC TG-3’ EXPERIMENTAL PROCEDURES Plant material and treatment Surface-sterilized Arabidopsis thaliana seeds were germinated on half-strength Murashige & Skoog medium including 1% sucrose. Following a two-day stratification (4˚C), the seeds were transferred to a growth chamber and grown under conditions described in Ludwików et. al. (2009). For gas chromatography experiments, 2-week-old seedlings of WT A. thaliana (L.) ecotype Columbia (Col) and the abi1td mutant were treated with 100 M ACC (concentration used in Yoo et al., 2008), 20 mM CuSO4 (as used in Vogel et al., 1998) or 100 M MG132 (as used in Nishizawa-Yokoi et al., 2010) for 24 h. For each treatment an equivalent mock control was used. A. thaliana T87 suspension cells (Axelos et. al. 1992) were maintained in 200 ml of 0.32% Gamborg’s B5 liquid medium (Yamada et al., 2004) with 1.5% sucrose and 0.1 μg/l 2,4-dichlorophenoxyacetic acid. The cells were grown under continuous light conditions (50 μmol m-2 s-1) at 22˚C with rotary shaking at 120 rpm. For the treatments, 7- or 12-day-old T87 cultured cells were supplemented with 100 µM (+) ABA (dissolved in methanol), 3% H2O2, 100 µM ACC or 100 µM MG132 (dissolved in 5% DMSO). Cell culture samples were collected after 3 h of incubation. After the treatments, the samples were frozen in liquid nitrogen and stored at −80˚C until use. The cell culture media and chemicals (±ABA, ACC and MG132) were purchased from Sigma-Aldrich. Plant growth, ozone treatment (350 ppb), and ion leakage analysis were performed as described in Ludwików et al. (2009). Ozone experiments were performed using three-week-old A. thaliana plants. Plasmid construction For protein interaction analysis in yeasts, pAS2-1, pACT2, pGBKT7 and pGADT7 cloning vectors were used (Clonetech). ABI1 BD and ACS2 AD or ACS6 AD constructs were as described in Ludwików et al. (2009). The ΔN-ABI1 fragment was excised from the pAS2-1ABI-BD construct and ligated into the pGBKT7-BD cloning vector between the EcoRI and PstI restriction sites. ΔACS2 and ΔACS6 constructs were PCR-amplified using specific primer pairs, and cloned into the pGEM-T Easy vector (Promega), excised as EcoRI-SacI or EcoRI-XhoI restriction fragments, respectively, and ligated into the pGADT7-AD vector. For the BiFC assay cDNAs were cloned into pSAT4-cEYFP-C1-B or pSAT4-nEYFPC1 vectors (Tzfira et al., 2005). The full-length cDNAs for ABI1 and ABI2 were amplified using Pfu polymerase and cloned into pSAT4-cEYFP-C1-B between the SalI and BamHI or EcoRI and SalI sites, respectively. Similarly, ACS2 and ACS6 cDNAs were PCR-amplified using specific primers and cloned into pSAT4-nEYFP-C1 as PstI-SacI and SalI-BamHI restriction sites, respectively. To generate the recombinant GST-tagged vectors, pUNI clones for ABI1, ABI2, PP2C6, ACS2, ACS6, MPK6 were recombined with the pHB2-GST vector using purified Cre recombinase (Liu et al., 1998). To generate Strep-tagged ABI1, ABI2, and PP2C6 constructs, corresponding uniclones were digested with SfiI and the resulting fragments were cloned into the pGEM-T Easy vector carrying a StrepTag expression cassette under control of the AtUBQ10 promoter (for details see Supplemental Figure 4). ORFs containing StrepTag cassettes were excised as NotI restriction fragments and ligated into the pART27 binary vector. pUNI clones and all plasmids generated were verified by sequencing. Primers, and the Uniclones used in vector construct generation, are listed in Supplemental Tables 1-2. Yeast two hybrid analysis The yeast two hybrid assays were carried out using Matchmaker GAL4-based two-hybrid systems (Clontech). To test for protein interaction, plasmid constructs encoding BD- and ADfusion proteins were co-transformed into Saccharomyces cerevisiae strain Y187 and spread on an SD/-Leu/-Trp selective medium. For the protein interaction studies, the transformed yeasts were grown overnight in liquid SD/-Leu/-Trp medium and the concentrated culture was spread on SD/-Leu/-Trp/-His (TDO) and SD/-Leu/-Trp/-His/-Ade (QDO) plates. To confirm the expression of the LacZ reporter, a β-galactosidase lift assay was performed. The experiments were repeated three times with the same results. Bimolecular Fluorescence Complementation (BIFC) in Arabidopsis protoplasts For the BiFC analysis, leaf mesophyll protoplasts were isolated from A. thaliana Col 0 as described in Wu et al. (2009). Various combinations of plasmids encoding cEYFP and nEYFP fusion proteins were mixed at a 1:1 (w/w) ratio, and 10 μg of the mixture of plasmid DNA was used for PEG-mediated transformation of 0.1 ml of protoplast solution, as described by Wu et al. (2009). The transformed protoplasts were incubated overnight at 25˚C prior to imaging. Plant protoplasts were viewed directly under a Nikon A1R confocal laser-scanning microscope, equipped with a 405 nm diode laser, a 514 Argon nm laser, a set of filters capable of distinguishing between EYFP and plastid/cell wall autofluorescence, and a Nomarski differential interference contrast (DIC) lens for capturing transmitted light images. The protoplast suspension was treated with 50 μM MG132 for 6 h prior to observation. At least twenty transfected protoplasts were analyzed in each experiment. Mesophyll Protoplast Transient Expression Assays Arabidopsis protoplasts were isolated from Arabidopsis WT Col-0 and abi1td mutant plants as described above and transformed with 5 µg plasmid DNA coding for StrepTagged ACS6. Transfected protoplasts were incubated overnight in the dark at 25°C and then were treated with 50 µM MG132 or mock treated (0.1% DMSO) for 6 h prior to harvesting. After brief centrifugation, cells were disrupted using isolation buffer (20 mM Hepes, pH 7.5, 10 mM MgCl2, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, protease inhibitors - EDTA free, Roche). Protein concentration was determined using a NanoDrop spectrophotometer. Using an Amicon Ultra-15 Centrifugal Filter Unit (Millipore), 50 µg of the total extract was concentrated, separated by SDS-PAGE and analyzed by western blotting. GST-tagged protein overexpression and purification E. coli BL21(DE3) competent cells were transformed with recombinant expression constructs, generated using the pHB2-GST vector. For protein induction, cell cultures with OD600 0.6 were treated with 0.5 mM isopropyl-β-D-1-thiogalactopyranoside (IPTG) for 3.5 h. The pellet was resuspended in 1 ml of ice-cold PBS buffer with EDTA-free protease inhibitor cocktail (Roche), sonicated and then centrifuged for 5 min at 12,000 rpm. The supernatant was incubated with Glutathione Sepharose 4B (GE Healthcare) according to manufacturer protocols. Recombinant protein production was checked by SDS–PAGE and Coomassie Brilliant Blue staining. Pull-down assay GST-tagged proteins pre-coupled to glutathione sepharose were incubated at 4˚C overnight with Strep-tagged proteins in 1 ml PBS with protease inhibitors (Roche). After incubation, the resin was washed three times with 400 l PBS. Proteins were eluted with 30 l of elution buffer (10 mM reduced glutathione in 50 mM Tris- HCl pH 8.0) and analyzed by 12% SDSPAGE and immunoblotting. Transformation of Arabidopsis T87 cells For the T87 cell transformation, 3 ml of an overnight culture of A. tumefaciens strain GV3101 carrying the appropriate construct was added to 14 ml of freshly passaged T87 culture (7 ml of Gamborg’s medium inoculated with 7 ml of a seven-day-old T87 culture). After 24 h of growth, the culture medium was exchanged for a fresh portion of Gamborg’s GB5 supplemented with 200 μg/ml biotaxime (Polpharma), 150 μg/ml timentin (GlaxoSmithKline) and 50 μg/ml kanamycin (Bioshop). To establish transgenic lines, the cells were subcultured (most of the cells were transferred to a new portion of medium containing antibiotics) at 3-4 day intervals for two weeks, and then at 7-day intervals for two months (1:10 ratio of inoculum to medium). Strep-Tag protein expression and purification Seven-day-old T87 cultures, grown in 200 ml medium, were treated with 100 M (±)ABA, 50 mM H2O2 or an equivalent mock control. After 3 h treatment, cells were harvested and ground in liquid nitrogen. Total proteins were isolated according to Park et al. (2009) in 5 ml of protein extraction buffer (50 mM Na-phosphate pH 7.4, 150 mM NaCl, 0,1% NP-40, 1 mM DTT and EDTA-free protease inhibitor cocktail (Roche)). StrepTag fusion proteins were purified using Strep-Tactin Superflow high capacity resin (IBA BioTAGnology) and immobilized on Bio-Spin Disposable Chromatography Columns (BioRad) according to manufacturer’s instructions, but with the following modifications. To equilibrate Strep-Tactin resin, two column volumes of Buffer W (100 mM Tris-HCl pH 8.0, 150 mM NaCl) were applied. To elute Strep-tagged proteins, six one-half-column volumes of Buffer E (100 mM Tris-HCl pH 8.0, 150 mM NaCl, 2.5 mM desthiobiotin) were used. Fractions 2 to 5 were pooled and concentrated using Amicon Ultra-15 Centrifugal Filter Units (Millipore). Protein concentration was measured by a standard Bradford procedure. LC-MS/MS analysis and data processing Protein identification in the StrepTag purified ABI1 complexes was performed according to the standard protocols at the Mass Spectrometry Laboratory, Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw (www.ibb.waw.pl/en/services/massspectrometry-lab). Protein identification in a publicly available database was achieved by fragment ion analysis and peptide mass fingerprinting employing MASCOT. Data sets were searched against the TAIR10 database using the following settings: tryptic peptides with one missed cleavage site and 20 ppm for peptide and 0.6 Da for fragment ion mass tolerance. The cysteine carbamidomethylation was searched as a fixed modification and methionine oxidation as variable modifications. Proteins were reported as identified if their probability score was below 0.05 (P<0.05). Kinase and phosphatase assays MPK6 activation was performed based on Yoo et al. (2008) and Wang et al. (2010). Wild type two-week-old A. thaliana plants grown on ½ MS medium were sprayed with 3% H2O2 or 100 M ACC and plant samples were collected after 30 min. Total protein extracts were isolated with 1 volume of isolation buffer (20 mM Hepes, pH 7.5, 10 mM MgCl2, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 0.1 mM NaVO3, protease inhibitors (EDTA free, Roche)). The MPK6 immunocomplex assay was performed based on methods described in Ligterink et al. (1997). Tissue extracts containing 300 μg of total protein were immunoprecipitated for 1 h at 4˚C with 5 μg of anti-AtMPK6 antibody (A7104, Sigma) precoupled to Dynabeads protein-A (Invitrogen), washed three times with wash buffer I (20 mM Tris-HCl, 5 mM EDTA, 100 mM NaCl, 1% Triton X-100), once with the same buffer but containing 1 M NaCl, and once with kinase buffer (20 mM Hepes, pH 7.5, 10 mM MgCl 2, 1 mM DTT). For the kinase inactivation assay, a half aliquot of activated MPK6 was used to phosphorylate 3-5 µg of substrate (myelin basic protein - MBP or recombinant GST-ACS2/6) in the presence of PP2C in kinase buffer containing 25 µM ATP and with [γ-32P]ATP (0.2 µCi per reaction or 20 µCi per reaction, when short-lived proteins were used) at 30˚C. Another half aliquot of activated MPK6 was assayed under the same conditions without radioactive ATP. Reactions were stopped by the addition of SDS-loading buffer after 30 min. SDS-PAGE reaction products were analyzed using autoradiography or Western blotting. The in vitro phosphatase assay was performed based on Umezawa et al. (2009) with modifications. Recombinant GST-ACS6 was purified as described above. GST-ACS6 precoupled to glutathione sepharose was mixed with active (immunoprecipitated) MPK6 in kinase buffer with 50 µCi [γ-32P]ATP for 30 min. The reaction mixture was then incubated at 75˚C for 10 min for MPK6 inactivation. After washing, the buffer was exchanged for phosphatase reaction buffer (20 mM HEPES, pH 7.5, and 150 mM NaCl) and 35 µl aliquots were mixed with StrepTag-ABI1 and 5 μg of MBP. MBP was used to control inactivation of MPK6. The reaction was stopped after 30 min at 37˚C by addition of SDS-loading buffer. SDS-PAGE reaction products were analyzed using autoradiography or Western blotting. Quantitative phosphatase assays were performed using the non-radioactive Serine/Threonine Phosphatase Assay System (Promega), according to the manufacturer’s protocol and with recommendations included in Yin et al. (2009). Phosphatase assay reactions containing 3 µg of GST-ABI1, GST-PP2C6, and Strep-tagged ABI1 with 20 mM HEPES, pH 7.5, and 150 mM NaCl were performed in 50 µl. Ethylene production, ACC content and ACS activity Ethylene evolution was measured using gas chromatography: 500 ml of headspace from sample vials was injected manually with a valve-equipped gas-tight syringe into an Agilent 7890A instrument fitted with a J&W Al/KCl (50 m x 320 mm x 8 mm) column (19091PM15, Agilent Technologies, Palo Alto, CA, USA). The S/SL inlet was operated in splitless mode at 65˚C. Chromatography was performed at a constant pressure of 22 psi using an oven temperature program of 40˚C for 3min, then 80˚C/min for 1 min up to 120˚C, remaining at 120˚C for 1 min. Helium was used as a carrier gas and detection was performed with FID at 250˚C. Peak area was used for quantitation. ACC content, ACC synthase activity and ACS immune complex activities were performed essentially as described in Liu and Zhang (2004), with the following modification in ACS extraction buffer, where MG132 was used instead of MG115. For the ACS immune complex, goat anti-AtACS2 (Santa Cruz Biotechnology) and goat anti-AtACS6 antibodies (Liu and Zhang, 2004) were used. Ozone-induced ethylene emission was analyzed from three rosettes incubated for 2 h at 20˚C. Immunoblot analysis For the immunoblot analysis, denatured proteins were separated on a 12% SDS-PAGE gel (BioRad) and transferred onto Immobilon - P (Millipore). The membranes were blocked for 1 h in PBS-T buffer pH7.4 containing 3-5% blocking solution (skim milk). Membranes were washed 3 times for 5 min with PBS-T buffer and incubated for 1 h with StrepMAB-Classic (1:3000; IBA BioTAGnology), anti-GST-Tag (1:5000; Sigma), rabbit anti-GFP (1:200; sc8334, Santa Cruz Biotechnology), goat anti-AtACS2 (1:5000; sc-12775, Santa Cruz Biotechnology) or goat anti-AtACS6 (1:5000; sc-12771, Santa Cruz Biotechnology) antibody. After washing, as previously, the membranes were incubated for 1 h with the appropriate secondary antibody. Detection was performed with ECL (Thermo Scientific) according to manufacturer’s instructions. Chlorophyll content, ROS detection and enzymatic assays The chlorophyll content analysis was performed as described in Richardson et al. (2002). The AsA determination was performed as described in Paradiso et al. (2008). GSH, GSSH, H2O2 and superoxide ion determinations as well as antioxidant activities (SOD, CAT and APOX) were performed as described in Malecka et al. (2009). Table S1. Primers used for vector construction Name Strepseq3 StrepseqF Fny Fcy ABI1G180DF ABI1G180DR ACS2ΔCEco ACS2ΔCSac ACS6ΔCEco ACS6ΔCXho Primer sequence (5'-> 3') AACTAGTCCGATCTAGTAACATAGATGACA TGACCAAAATTTGTTGATGTGCA CAGCCACAACGTCTATATCAT TCCTGCTGGAGTTCGTGACC TACGACGGCCATGACGGTTCTCAGGTA TACCTGAGAACCGTCATGGCCGTCGTA ATGAATTCACGCAGACCAATCTTCGACTA ATGAGCTCTCATGCTCGGAGAAGAGGT ATGAATTCACGAGGCGGTTCGATGA CACTCGAGTTAAGTCTGTGCACGGA Table S2. pUNI clones used for vector construction pUNI clone C104649 U24491 U15193 U67169 U14825 C00052 (E) Gene name ABI1 ABI2 MPK6 PP2C6 ACS6 ACS2 TAIR At4g26080 At5g57050 At2g43790 At3g55050 At4g11280 At1g01480 Description StrepTag sequencing primers StrepTag sequencing primers pSAT sequencing primers pSAT sequencing primers ABI1 mutagenesis ABI1 mutagenesis Protein deletion constructs for Y2H analysis Protein deletion constructs for Y2H analysis Protein deletion constructs for Y2H analysis Protein deletion constructs for Y2H analysis
© Copyright 2026 ExpyDoc