Supplementary Data

Figure S1. Negative controls in BiFC experiment
The negative controls that were conducted by cotransfecting unfused EYFP fragments with a
single complementary ABI1 and ABI2 or ACS2 and ACSS6 proteins. Control analyses
resulted in no detectable signals.
Figure S2. Ethylene production and the immune complex ACS6 activity in WT Col-0
and the abi1td mutant in response to CuSO4
A-B. Seedlings were treated with CuSO4 in GC vials. The accumulated ethylene in the
headspace was measured at 24 – 28 hours later. The presented results show average values of
the triplicate experiment in three replicates each (n=9). Error bars show standard error. Stars *
indicate statistically significant difference at P < 0.05.
Figure S3. Chlorophyll content of leaves of the WT and abi1td
The chlorophyll content (A, C-D) and chlorophyll a:b ratio (B) in WT Col-0 and abi1td plants
in response to 350 ppb ozone treatment. The data show means from two independent
experiments with at least five biological replicates each. The asterisk (*) indicates statistically
significant changes at P < 0.001.
Figure S4. Effect of ozone on glutathione contents in the abi1td mutant
The levels (A-C) and the redox state (D) of glutathione in WT Col-0 and in the abi1td mutant.
GSH – reduced glutathione; GSSH – oxidized glutathione; FW - fresh weight. The asterisk (*)
indicates statistically significant changes at P < 0.009. The experiment was performed twice
with similar results. The data represent means of two experiments. The bars represent means
±SD (n = 4).
Figure S5. Construction of the StrepTag expression cassette for expression of Strep
tagged proteins based on the pGEM-T Easy vector
The A. thaliana UBQ10 promoter (from -1482 bp to +1 bp) was PCR amplified from
genomic DNA using the UBQ10F and the UBQ10R primers. NOS terminator was amplified
using primers NOS1F and NOS1R with pBI121 vector as a template. Intron was cloned from
modified intervening sequence 2 (IV2) of the potato LS1 gene (Zhao et al., 2001) delivered by
Rosemarie W. Hammond in pUC19 vector using primers STREP1F and STREP1R. 5’ end of
One-STrEP-Tag encoding sequence was added to forward primer. 3’ end of One-STrEP-Tag
encoding sequence was achieved by hybridization of oligonucleotides STREP2F and
STREP2R and subsequent extension of double stranded DNA using Pfu DNA polymerase. 3’
end of IV2 intron was added to STREP2F primer. SfiI restriction sites compatible with
pUNI51 vector was added to One-STrEP-Tag via PCR using STREP3F and STREP4R
primers. Both DNA fragments of One-STrEP-Tag and intron fusions had overlapping
sequences containing ApoI restriction site that was used to join these fragments to each other.
XhoI was used to recombine UBQ10 promoter with One-STrEP-Tag:intron:SfiI DNA
fragment and EcoRI was used to join NOS terminator to 5’ end of resulting sequence.
Amplified sequence of whole expression cassette (primers UBQ10F and NOS1R) was
recombined with pGEM-T Easy. Primers used for generation the expression cassette:
UBQ10F 5’-GTTGGTGCTT TCCTTACATT CTGA-3’; UBQ10R 5’-AACTCGAGCT
GTTAATCAGA AAAACTCAGA TTAA-3’; NOS1F 5’-TGAATTCGAA TTTCCCCGAT
CGTTCAAAC-3’; NOS1R 5’-AACTAGTCCG ATCTAGTAAC ATAGATGACA-3’;
STREP1F 5’-GGACTCGAGA TGGCTAGCTG GAGCCACCCG CAGTTCGGTA
AGTTTCTGCT TCTACCTTT-3’; STREP1R 5’-ATCAACAAAT TTTGGTCATA
TATTAGAA-3’; STREP2F 5’-TGACCAAAAT TTGTTGATGT GCAGAGAAAG
GTGGAGGTTC CGGAGGTGGA TCGGGAGGTG GATCGT-3’; STREP2R 5’CCAAACCATA TGGGCGCCTT TTTCGAACTG CGGGTGGCTC CACGATCCAC
CTCCCGATCC ACCTCCG-3’; STREP3F 5’-TGACCAAAAT TTGTTGATGT GCA-3’;
STREP4R 5’-AGAATTCCGG CCCATGAGGC CCTCTAGTGT GGCCTTGACG
GCCGGGCGCC TTTTTCGAAC TG-3’
EXPERIMENTAL PROCEDURES
Plant material and treatment
Surface-sterilized Arabidopsis thaliana seeds were germinated on half-strength Murashige &
Skoog medium including 1% sucrose. Following a two-day stratification (4˚C), the seeds
were transferred to a growth chamber and grown under conditions described in Ludwików et.
al. (2009). For gas chromatography experiments, 2-week-old seedlings of WT A. thaliana (L.)
ecotype Columbia (Col) and the abi1td mutant were treated with 100 M ACC (concentration
used in Yoo et al., 2008), 20 mM CuSO4 (as used in Vogel et al., 1998) or 100 M MG132
(as used in Nishizawa-Yokoi et al., 2010) for 24 h. For each treatment an equivalent mock
control was used. A. thaliana T87 suspension cells (Axelos et. al. 1992) were maintained in
200 ml of 0.32% Gamborg’s B5 liquid medium (Yamada et al., 2004) with 1.5% sucrose and
0.1 μg/l 2,4-dichlorophenoxyacetic acid. The cells were grown under continuous light
conditions (50 μmol m-2 s-1) at 22˚C with rotary shaking at 120 rpm. For the treatments, 7- or
12-day-old T87 cultured cells were supplemented with 100 µM (+) ABA (dissolved in
methanol), 3% H2O2, 100 µM ACC or 100 µM MG132 (dissolved in 5% DMSO). Cell
culture samples were collected after 3 h of incubation. After the treatments, the samples were
frozen in liquid nitrogen and stored at −80˚C until use. The cell culture media and chemicals
(±ABA, ACC and MG132) were purchased from Sigma-Aldrich. Plant growth, ozone
treatment (350 ppb), and ion leakage analysis were performed as described in Ludwików et al.
(2009). Ozone experiments were performed using three-week-old A. thaliana plants.
Plasmid construction
For protein interaction analysis in yeasts, pAS2-1, pACT2, pGBKT7 and pGADT7 cloning
vectors were used (Clonetech). ABI1 BD and ACS2 AD or ACS6 AD constructs were as
described in Ludwików et al. (2009). The ΔN-ABI1 fragment was excised from the pAS2-1ABI-BD construct and ligated into the pGBKT7-BD cloning vector between the EcoRI and
PstI restriction sites. ΔACS2 and ΔACS6 constructs were PCR-amplified using specific
primer pairs, and cloned into the pGEM-T Easy vector (Promega), excised as EcoRI-SacI or
EcoRI-XhoI restriction fragments, respectively, and ligated into the pGADT7-AD vector.
For the BiFC assay cDNAs were cloned into pSAT4-cEYFP-C1-B or pSAT4-nEYFPC1 vectors (Tzfira et al., 2005). The full-length cDNAs for ABI1 and ABI2 were amplified
using Pfu polymerase and cloned into pSAT4-cEYFP-C1-B between the SalI and BamHI or
EcoRI and SalI sites, respectively. Similarly, ACS2 and ACS6 cDNAs were PCR-amplified
using specific primers and cloned into pSAT4-nEYFP-C1 as PstI-SacI and SalI-BamHI
restriction sites, respectively.
To generate the recombinant GST-tagged vectors, pUNI clones for ABI1, ABI2,
PP2C6, ACS2, ACS6, MPK6 were recombined with the pHB2-GST vector using purified Cre
recombinase (Liu et al., 1998). To generate Strep-tagged ABI1, ABI2, and PP2C6 constructs,
corresponding uniclones were digested with SfiI and the resulting fragments were cloned into
the pGEM-T Easy vector carrying a StrepTag expression cassette under control of the
AtUBQ10 promoter (for details see Supplemental Figure 4). ORFs containing StrepTag
cassettes were excised as NotI restriction fragments and ligated into the pART27 binary
vector. pUNI clones and all plasmids generated were verified by sequencing. Primers, and the
Uniclones used in vector construct generation, are listed in Supplemental Tables 1-2.
Yeast two hybrid analysis
The yeast two hybrid assays were carried out using Matchmaker GAL4-based two-hybrid
systems (Clontech). To test for protein interaction, plasmid constructs encoding BD- and ADfusion proteins were co-transformed into Saccharomyces cerevisiae strain Y187 and spread
on an SD/-Leu/-Trp selective medium. For the protein interaction studies, the transformed
yeasts were grown overnight in liquid SD/-Leu/-Trp medium and the concentrated culture was
spread on SD/-Leu/-Trp/-His (TDO) and SD/-Leu/-Trp/-His/-Ade (QDO) plates. To confirm
the expression of the LacZ reporter, a β-galactosidase lift assay was performed. The
experiments were repeated three times with the same results.
Bimolecular Fluorescence Complementation (BIFC) in Arabidopsis protoplasts
For the BiFC analysis, leaf mesophyll protoplasts were isolated from A. thaliana Col 0 as
described in Wu et al. (2009). Various combinations of plasmids encoding cEYFP and nEYFP
fusion proteins were mixed at a 1:1 (w/w) ratio, and 10 μg of the mixture of plasmid DNA
was used for PEG-mediated transformation of 0.1 ml of protoplast solution, as described by
Wu et al. (2009). The transformed protoplasts were incubated overnight at 25˚C prior to
imaging. Plant protoplasts were viewed directly under a Nikon A1R confocal laser-scanning
microscope, equipped with a 405 nm diode laser, a 514 Argon nm laser, a set of filters
capable of distinguishing between EYFP and plastid/cell wall autofluorescence, and a
Nomarski differential interference contrast (DIC) lens for capturing transmitted light images.
The protoplast suspension was treated with 50 μM MG132 for 6 h prior to observation. At
least twenty transfected protoplasts were analyzed in each experiment.
Mesophyll Protoplast Transient Expression Assays
Arabidopsis protoplasts were isolated from Arabidopsis WT Col-0 and abi1td mutant plants
as described above and transformed with 5 µg plasmid DNA coding for StrepTagged ACS6.
Transfected protoplasts were incubated overnight in the dark at 25°C and then were treated
with 50 µM MG132 or mock treated (0.1% DMSO) for 6 h prior to harvesting. After brief
centrifugation, cells were disrupted using isolation buffer (20 mM Hepes, pH 7.5, 10 mM
MgCl2, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride, protease inhibitors - EDTA free,
Roche). Protein concentration was determined using a NanoDrop spectrophotometer. Using
an Amicon Ultra-15 Centrifugal Filter Unit (Millipore), 50 µg of the total extract was
concentrated, separated by SDS-PAGE and analyzed by western blotting.
GST-tagged protein overexpression and purification
E. coli BL21(DE3) competent cells were transformed with recombinant expression constructs,
generated using the pHB2-GST vector. For protein induction, cell cultures with OD600 0.6
were treated with 0.5 mM isopropyl-β-D-1-thiogalactopyranoside (IPTG) for 3.5 h. The pellet
was resuspended in 1 ml of ice-cold PBS buffer with EDTA-free protease inhibitor cocktail
(Roche), sonicated and then centrifuged for 5 min at 12,000 rpm. The supernatant was
incubated with Glutathione Sepharose 4B (GE Healthcare) according to manufacturer
protocols. Recombinant protein production was checked by SDS–PAGE and Coomassie
Brilliant Blue staining.
Pull-down assay
GST-tagged proteins pre-coupled to glutathione sepharose were incubated at 4˚C overnight
with Strep-tagged proteins in 1 ml PBS with protease inhibitors (Roche). After incubation, the
resin was washed three times with 400 l PBS. Proteins were eluted with 30 l of elution
buffer (10 mM reduced glutathione in 50 mM Tris- HCl pH 8.0) and analyzed by 12% SDSPAGE and immunoblotting.
Transformation of Arabidopsis T87 cells
For the T87 cell transformation, 3 ml of an overnight culture of A. tumefaciens strain GV3101
carrying the appropriate construct was added to 14 ml of freshly passaged T87 culture (7 ml
of Gamborg’s medium inoculated with 7 ml of a seven-day-old T87 culture). After 24 h of
growth, the culture medium was exchanged for a fresh portion of Gamborg’s GB5
supplemented with 200 μg/ml biotaxime (Polpharma), 150 μg/ml timentin (GlaxoSmithKline)
and 50 μg/ml kanamycin (Bioshop). To establish transgenic lines, the cells were subcultured
(most of the cells were transferred to a new portion of medium containing antibiotics) at 3-4
day intervals for two weeks, and then at 7-day intervals for two months (1:10 ratio of
inoculum to medium).
Strep-Tag protein expression and purification
Seven-day-old T87 cultures, grown in 200 ml medium, were treated with 100 M (±)ABA, 50
mM H2O2 or an equivalent mock control. After 3 h treatment, cells were harvested and ground
in liquid nitrogen. Total proteins were isolated according to Park et al. (2009) in 5 ml of
protein extraction buffer (50 mM Na-phosphate pH 7.4, 150 mM NaCl, 0,1% NP-40, 1 mM
DTT and EDTA-free protease inhibitor cocktail (Roche)). StrepTag fusion proteins were
purified using Strep-Tactin Superflow high capacity resin (IBA BioTAGnology) and
immobilized on Bio-Spin Disposable Chromatography Columns (BioRad) according to
manufacturer’s instructions, but with the following modifications. To equilibrate Strep-Tactin
resin, two column volumes of Buffer W (100 mM Tris-HCl pH 8.0, 150 mM NaCl) were
applied. To elute Strep-tagged proteins, six one-half-column volumes of Buffer E (100 mM
Tris-HCl pH 8.0, 150 mM NaCl, 2.5 mM desthiobiotin) were used. Fractions 2 to 5 were
pooled and concentrated using Amicon Ultra-15 Centrifugal Filter Units (Millipore). Protein
concentration was measured by a standard Bradford procedure.
LC-MS/MS analysis and data processing
Protein identification in the StrepTag purified ABI1 complexes was performed according to
the standard protocols at the Mass Spectrometry Laboratory, Institute of Biochemistry and
Biophysics, Polish Academy of Sciences, Warsaw (www.ibb.waw.pl/en/services/massspectrometry-lab). Protein identification in a publicly available database was achieved by
fragment ion analysis and peptide mass fingerprinting employing MASCOT. Data sets were
searched against the TAIR10 database using the following settings: tryptic peptides with one
missed cleavage site and 20 ppm for peptide and 0.6 Da for fragment ion mass tolerance. The
cysteine carbamidomethylation was searched as a fixed modification and methionine
oxidation as variable modifications. Proteins were reported as identified if their probability
score was below 0.05 (P<0.05).
Kinase and phosphatase assays
MPK6 activation was performed based on Yoo et al. (2008) and Wang et al. (2010). Wild
type two-week-old A. thaliana plants grown on ½ MS medium were sprayed with 3% H2O2 or
100 M ACC and plant samples were collected after 30 min. Total protein extracts were
isolated with 1 volume of isolation buffer (20 mM Hepes, pH 7.5, 10 mM MgCl2, 1 mM DTT,
1 mM phenylmethylsulfonyl fluoride, 0.1 mM NaVO3, protease inhibitors (EDTA free,
Roche)). The MPK6 immunocomplex assay was performed based on methods described in
Ligterink et al. (1997). Tissue extracts containing 300 μg of total protein were
immunoprecipitated for 1 h at 4˚C with 5 μg of anti-AtMPK6 antibody (A7104, Sigma) precoupled to Dynabeads protein-A (Invitrogen), washed three times with wash buffer I (20 mM
Tris-HCl, 5 mM EDTA, 100 mM NaCl, 1% Triton X-100), once with the same buffer but
containing 1 M NaCl, and once with kinase buffer (20 mM Hepes, pH 7.5, 10 mM MgCl 2, 1
mM DTT).
For the kinase inactivation assay, a half aliquot of activated MPK6 was used to
phosphorylate 3-5 µg of substrate (myelin basic protein - MBP or recombinant GST-ACS2/6)
in the presence of PP2C in kinase buffer containing 25 µM ATP and with [γ-32P]ATP (0.2
µCi per reaction or 20 µCi per reaction, when short-lived proteins were used) at 30˚C.
Another half aliquot of activated MPK6 was assayed under the same conditions without
radioactive ATP. Reactions were stopped by the addition of SDS-loading buffer after 30 min.
SDS-PAGE reaction products were analyzed using autoradiography or Western blotting.
The in vitro phosphatase assay was performed based on Umezawa et al. (2009) with
modifications. Recombinant GST-ACS6 was purified as described above. GST-ACS6 precoupled to glutathione sepharose was mixed with active (immunoprecipitated) MPK6 in
kinase buffer with 50 µCi [γ-32P]ATP for 30 min. The reaction mixture was then incubated at
75˚C for 10 min for MPK6 inactivation. After washing, the buffer was exchanged for
phosphatase reaction buffer (20 mM HEPES, pH 7.5, and 150 mM NaCl) and 35 µl aliquots
were mixed with StrepTag-ABI1 and 5 μg of MBP. MBP was used to control inactivation of
MPK6. The reaction was stopped after 30 min at 37˚C by addition of SDS-loading buffer.
SDS-PAGE reaction products were analyzed using autoradiography or Western blotting.
Quantitative
phosphatase
assays
were
performed
using
the
non-radioactive
Serine/Threonine Phosphatase Assay System (Promega), according to the manufacturer’s
protocol and with recommendations included in Yin et al. (2009). Phosphatase assay reactions
containing 3 µg of GST-ABI1, GST-PP2C6, and Strep-tagged ABI1 with 20 mM HEPES, pH
7.5, and 150 mM NaCl were performed in 50 µl.
Ethylene production, ACC content and ACS activity
Ethylene evolution was measured using gas chromatography: 500 ml of headspace from
sample vials was injected manually with a valve-equipped gas-tight syringe into an Agilent
7890A instrument fitted with a J&W Al/KCl (50 m x 320 mm x 8 mm) column (19091PM15, Agilent Technologies, Palo Alto, CA, USA). The S/SL inlet was operated in splitless
mode at 65˚C. Chromatography was performed at a constant pressure of 22 psi using an oven
temperature program of 40˚C for 3min, then 80˚C/min for 1 min up to 120˚C, remaining at
120˚C for 1 min. Helium was used as a carrier gas and detection was performed with FID at
250˚C. Peak area was used for quantitation. ACC content, ACC synthase activity and ACS
immune complex activities were performed essentially as described in Liu and Zhang (2004),
with the following modification in ACS extraction buffer, where MG132 was used instead of
MG115. For the ACS immune complex, goat anti-AtACS2 (Santa Cruz Biotechnology) and
goat anti-AtACS6 antibodies (Liu and Zhang, 2004) were used. Ozone-induced ethylene
emission was analyzed from three rosettes incubated for 2 h at 20˚C.
Immunoblot analysis
For the immunoblot analysis, denatured proteins were separated on a 12% SDS-PAGE gel
(BioRad) and transferred onto Immobilon - P (Millipore). The membranes were blocked for 1
h in PBS-T buffer pH7.4 containing 3-5% blocking solution (skim milk). Membranes were
washed 3 times for 5 min with PBS-T buffer and incubated for 1 h with StrepMAB-Classic
(1:3000; IBA BioTAGnology), anti-GST-Tag (1:5000; Sigma), rabbit anti-GFP (1:200; sc8334, Santa Cruz Biotechnology), goat anti-AtACS2 (1:5000; sc-12775, Santa Cruz
Biotechnology) or goat anti-AtACS6 (1:5000; sc-12771, Santa Cruz Biotechnology) antibody.
After washing, as previously, the membranes were incubated for 1 h with the appropriate
secondary antibody. Detection was performed with ECL (Thermo Scientific) according to
manufacturer’s instructions.
Chlorophyll content, ROS detection and enzymatic assays
The chlorophyll content analysis was performed as described in Richardson et al. (2002). The
AsA determination was performed as described in Paradiso et al. (2008). GSH, GSSH, H2O2
and superoxide ion determinations as well as antioxidant activities (SOD, CAT and APOX)
were performed as described in Malecka et al. (2009).
Table S1. Primers used for vector construction
Name
Strepseq3
StrepseqF
Fny
Fcy
ABI1G180DF
ABI1G180DR
ACS2ΔCEco
ACS2ΔCSac
ACS6ΔCEco
ACS6ΔCXho
Primer sequence (5'-> 3')
AACTAGTCCGATCTAGTAACATAGATGACA
TGACCAAAATTTGTTGATGTGCA
CAGCCACAACGTCTATATCAT
TCCTGCTGGAGTTCGTGACC
TACGACGGCCATGACGGTTCTCAGGTA
TACCTGAGAACCGTCATGGCCGTCGTA
ATGAATTCACGCAGACCAATCTTCGACTA
ATGAGCTCTCATGCTCGGAGAAGAGGT
ATGAATTCACGAGGCGGTTCGATGA
CACTCGAGTTAAGTCTGTGCACGGA
Table S2. pUNI clones used for vector construction
pUNI clone
C104649
U24491
U15193
U67169
U14825
C00052 (E)
Gene name
ABI1
ABI2
MPK6
PP2C6
ACS6
ACS2
TAIR
At4g26080
At5g57050
At2g43790
At3g55050
At4g11280
At1g01480
Description
StrepTag sequencing primers
StrepTag sequencing primers
pSAT sequencing primers
pSAT sequencing primers
ABI1 mutagenesis
ABI1 mutagenesis
Protein deletion constructs for Y2H analysis
Protein deletion constructs for Y2H analysis
Protein deletion constructs for Y2H analysis
Protein deletion constructs for Y2H analysis

Download Report