ORIGINAL
RESEARCH
Synthetic FXR agonist GW4064 is a modulator of
multiple G-protein coupled receptors
Nidhi Singh1#, Manisha Yadav1#, Abhishek Kumar Singh1, Harish Kumar1,
Shailendra Kumar Dhar Dwivedi2, Jay Sharan Mishra1, Anagha Gurjar1,
Amit Manhas3, Sharat Chandra4 Prem Narayan Yadav3, Kumaravelu Jagavelu3,
Mohammad Imran Siddiqi4, Arun Kumar Trivedi1, Naibedya Chattopadhyay2,
Sabyasachi Sanyal1*
1
Division of Biochemistry, CSIR-Central Drug Research Institute, 10, Janakipuram Extn, Sitapur Rd,
Lucknow 226031, UP, India. 2Division of Endocrinology, CSIR-Central Drug Research Institute, 10,
Janakipuram Extn, Sitapur Rd, Lucknow 226031, UP, India. 3Division of Pharmacology, CSIR-Central
Drug Research Institute, 10, Janakipuram Extn, Sitapur Rd, Lucknow 226031, UP, India.4Division of
Molecular and Structural Biology, CSIR-Central Drug Research Institute, 10, Janakipuram Extn, Sitapur
Rd, Lucknow 226031, UP, India
The synthetic nuclear bile acid receptor (FXR) agonist GW4064 is extensively used as a specific
pharmacological tool to illustrate FXR functions. We noticed that GW4064 activated empty luciferase reporters in FXR-deficient HEK-293T (HEK) cells. We postulated that this activity of
GW4064 might be routed through as yet unknown cellular targets and undertook an unbiased
exploratory approach to identify these targets. Investigations revealed that GW4064 activated
cAMP and nuclear factor for activated T cell -response elements (CRE and NFAT-RE) present on
these empty reporters. While GW4064-induced NFAT-RE activation involved rapid intracellular
Ca2⫹ accumulation and NFAT nuclear translocation, CRE activation involved soluble adenylyl
cyclase-dependent cAMP accumulation and Ca2⫹-calcineurin-dependent nuclear translocation of
transducers of regulated CREB proteins 2. Use of dominant negative heterotrimeric G-protein
minigenes revealed that GW4064 caused activation of G␣i/o and Gq11 G-proteins. Sequential
pharmacological inhibitor-based screening and radioligand binding studies revealed that
GW4064 interacted with multiple G-protein coupled receptors. Functional studies demonstrated
that GW4064 robustly activated H1 and H4, and inhibited H2 histamine receptor signaling events.
We also found that MCF-7 breast cancer cells, reported to undergo GW4064-induced apoptosis in
an FXR-dependent manner, did not express FXR, and the GW4064-mediated apoptosis, also apparent in HEK cells, could be blocked by selective histamine receptor-regulators. Together, we
demonstrate identification of histamine receptors as alternate targets for GW4064, which not
only necessitates cautious interpretation of the biological functions attributed to FXR using
GW4064 as a pharmacological tool, but also provides a basis for the rational designing of new
pharmacophores for histamine receptor modulation.
XR (also known as BAR and NR1H4) is a member of
the nuclear receptor superfamily that is expressed
mainly in the liver, intestine, kidney and adrenal glands
(1, 2). Low expression levels of FXR have been reported
in the heart, adipose and vasculature (3, 4), although the
functional significance of this receptor is less clear in these
F
tissues. More than a decade of studies has established key
roles of FXR in cholesterol, bile acid and carbohydrate
metabolism (reviewed in (5)). Recent findings further extend its function in cholesterol gall stone disease (6), liver
regeneration and hypertrophy (7–9), inflammation (10 –
14), cholestatic liver disease (15), liver cirrhosis (16, 17)
ISSN Print 0888-8809 ISSN Online 1944-9917
Printed in U.S.A.
Copyright © 2014 by the Endocrine Society
Received November 1, 2013. Accepted February 28, 2014.
Abbreviations:
doi: 10.1210/me.2013-1353
Molecular Endocrinology is published monthly by The Endocrine
Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.
Mol Endocrinol
mend.endojournals.org
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
1
2
GW4064 modulates multiple GPCRs
and various cancers (8, 9, 12, 14, 18 –31). However the
roles attributed to FXR in cell growth regulation, apoptosis and cancer are conflicting, where FXR has been shown
to have both proapoptotic as well as prosurvival
functions.
Bile acids, especially chenodeoxycholic acid (CDCA)
are potent endogenous FXR agonists (32); however,
CDCA also regulates alternate FXR-independent signaling, primarily through the G-protein coupled receptor
(GPCR) Tgr5 (33). GW4064, a synthetic isoxazole was
developed as an extremely potent specific FXR agonist
(34) and has been extensively used in deciphering the
cellular and physiological functions of FXR over a decade. Earlier, we identified GW as an agonist for estrogen
receptor-related receptors (ERR) and demonstrated its
ERR-mediated regulation of PPAR gamma coactivator 1
alpha (PGC-1␣) promoter (35). However, during this
study, we observed that GW also significantly activated a
number of control luciferase reporters (luc) that did not
contain any FXR response element (FXRE). A similar
observation was made by Dr. Ron Evans’s group, who
reported that GW4064 but not fexaramine (another FXR
agonist) activated a minimal TK promoter-containing luciferase reporter in FXR-deficient CV-1 cells (36). We,
thus, postulated that GW4064 may regulate empty luciferase reporters via as yet unknown cellular targets. This
study was therefore designed to objectively explore the
mechanism of FXR-independent signaling by GW4064
and discover the cellular targets responsible for its FXRindependent actions.
Materials and Methods
Reagents
Cell culture media and supplements were purchased from
Invitrogen (Carlsbad, CA). All fine chemicals were from Sigma
Aldrich (St. Louis, MO) unless otherwise indicated. GW4064
was purchased from Sigma. All inhibitors/antagonist used in
this study were from Tocris Biosciences (Ellisville, MO) unless
otherwise indicated. HTRF cAMP femto kit was from Cisbio
bioassays (Parc Marcel Boiteux, France). Calcineurin cellular
activity assay kit was from Enzo Life Science (Farmingdale, NY)
and Vectashield was from Vector Laboratories (Burlingame,
CA).
Plasmids
Reporter plasmids, pCRE-Luc, pNFAT-RE-Luc, pAP-1 Luc,
pNF-kB Luc and pCIS-CK luc and were purchased from Agilent
technologies (La Jolla, CA), pGL3-Basic, and pGL3 promoter
vector were from Promega (Madison, WI). pGL3–3X-FXRE,
hPGC-1␣ promoter and hSHP promoter lucs are described elsewhere (35). Dominant negative G-protein minigene constructs
were kind gifts from Dr. Heidi. E. Hamm (Vanderbilt University
Medical Center) (37). pGloSensor™-22F cAMP construct was
Mol Endocrinol
from Promega. Histamine receptor expression plasmids in
pcDNA3.1 were from Missouri S&T cDNA Resource Center.
Antibodies
Rabbit FXR (sc-13063) and mouse -Actin (sc-47778) antibodies were from Santa Cruz Biotechnology Inc. (Santa Cruz,
CA). NFATc1 (NFAT2), TORC2, phospho-CREB (S133) and
ERK antibodies were from Cell Signaling Technology (Boston,
MA). Antibodies against histamine receptors were purchased
from Genetex (Irvine, CA). All the histamine receptor antibodies
were validated at antibodypedia (http://www.antibodypedia.com/) secondary antibodies were from Sigma Aldrich.
Cell culture
Human embryonic kidney cell line HEK, human breast cancer cell line MCF-7, and human hepatoma cell line HepG2 were
obtained from ATCC, USA. Cells were cultured as recommended by ATCC
Cell viability assay
Cell proliferation was assessed using the 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay.
HEK or MCF-7 cells were seeded in 96 well plates and synchronized by serum starvation for 24 hours. All the treatments were
done in serum-free medium or in indicated percentage of serum.
Transient transfection-based luciferase assay
Transfections were carried out with lipofectamine LTX (Invitrogen) according to the manufacturer’s protocol. Total DNA
in each transfection was adjusted to 700ng by adding pcDNA3
empty vector. Luciferase activity was measured in a GloMax-96
Microplate luminometer (Promega) using the Steady-Glo reagent from Promega, GFP fluorescence was quantified using a
Fluostar Omega fluorimeter (BMG Labtech, Offenburg,
Germany).
GloSensor™ cAMP Assay
HEK cells transfected with H2, H3 and H4 histamine receptor expression plasmids were incubated with GloSensor™
cAMP Reagent (Hanks’ balanced salt solution (HBSS) ⫹ HEPES
20 mM ⫹ Luciferin substrate 10 mg/ml) for 2 hours followed by
treatment with Forskolin (10 M) for 15 minutes. The cells
were then treated with different doses of GW4064 ranging from
(10 pM-50 M) and histamine receptor agonists for another 15
minutes and then luminescence was estimated.
Intracellular calcium determination
HEK cells were trypsinized and washed with phosphate buffer saline (pH 7.4). The cells were then labeled with Fluo 4 AM
(Invitrogen) for 45 minutes. Following which cells were washed
and suspended in calcium free HBSS at a concentration of 108
cells per ml. Samples were acquired in a BD FACSCalibur instrument and analyzed using Cell Quest Pro software.
Reverse transcription-PCR analysis
Total RNA was extracted according to the manufacture’s
protocol using TRI Reagent (Life Technologies (Carlsbad, CA).
Reverse transcription (RT) was carried out with the High-Capacity cDNA Reverse Transcription Kit from Applied Biosys-
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
doi: 10.1210/me.2013-1353
tems (Foster City, CA). cDNAs obtained were amplified using
the following primers. The primer sequences (5⬘-3⬘) are:FXR-FCGAGCCTGAAGAGTGGTACTGTC. FXR-R-CATTCAGCCAACATTCC
CATCTC.GAPDH-F-CACCATCTTCCAGGAGCGAGA. GAPDH-R-GCTAAGCAGTT GGTGGTGCA.
H1-F-CTTGGTCACAGTAGGGCTCA.
H1-RGCTCGGGTCTTGGTA CGATA H2-F -TATTGCAGACCCACCAACAA, H2-R-CCAGCTGCCTCCTGAATAAG H3F-CACTCAAGAGGGGCTCCAAG.
H3-RTACCAGTAGTCAGGGACGCA.
H4-F-CCAT
CTCTGACTTCTTTGTGGTTT.
H4-R-ACCGACTGTGTTGTGATGGT.
HDC-F-TTTGA
AGGGCGGAGCTAAGG.
HDC-R- CAATGTACCACCCCAGGCAT
The PCR conditions were as follows. Initial denaturation at
94°C for 2 minutes, followed by 35 cycles for hFXR (94°C
1min, 65°C 1min, 72°C 1min), 25 cycles for H1, H2,H3 and H4
and GAPDH (94°C for 1min, 55°C for 1min and 72°C for
1min), followed by 10 minutes at 72°C. PCR products were
resolved by 1.5% agarose gel electrophoresis and the bands
were visualized with ethidium bromide.
mend.endojournals.org
3
(Farmingdale, NY) according to manufacturer’s directions. Absorbance was measured in an ELISA plate reader at 620nm. The
conventional method of reporting calcineurin activity: calcineurin ⫽ total phosphatase activity – activity in the presence of
EGTA buffer, was used; background phosphate was subtracted
from each sample.
Radioligand binding assay
GW4064 binding with Angiotensin receptors were performed at Euroscreen Fast (Gosselies, Belgium) and rest of the
binding assays were executed at Eurofins panlabs (Taipei,
Taiwan).
Data analysis and statistics
Data represent mean ⫾ SEM of 3 independent experiments
unless otherwise indicated. Statistical analyses were performed
using two-tailed unpaired student’s t test or one way analysis of
variance (ANOVA) followed by Dunnet’s post test as
appropriate.
Immunoblotting
Immunoblot analysis was performed as described previously
(35). Signals were detected using a chemiluminiscence-based
detection system in a LAS 4010 Chemi-doc Imager (GE Healthcare). Antibody dilutions used were as follows: Histamine receptor antibodies (1:5000), b-actin (1:3000) and all other antibodies were used at a dilution of 1:1000.
Microscopy
HEK cells were grown on poly-l lysin coated coverslips in
6-well plates till they reached 40% confluence. Cells were then
treated with DMSO (vehicle), GW4064 (1 M) or ionomycin (2
M) and were fixed in 4% paraformaldehyde in PBS for 20 –30
minutes. Cells were then washed with 0.1% PBST (PBS containing 0.1% Tween 20) followed by incubation with blocking buffer (10% FBS in 0.1% PBST and 1% BSA) for 2 hours at RT.
Cells were then probed with anti-NFATc1 antibody (1:100)
overnight. Nuclei were stained with Hoechst 33342. Image acquisition was performed with a fluorescent microscope (Carl
Zeiss). Scale bars; 50 m.
Quantitation of cAMP
Cellular cAMP was estimated using a homogenous time-resolved fluorescence (HTRF) -based assay kit from Cisbio International using manufacturer’s protocol. Briefly, HEK cells
seeded onto 96 well plates were serum starved for 4h followed
by treatment with 500 M 3-isobutyl-1-methylxanthine
(IBMX) (Sigma Aldrich) for 30 minutes and the cells were then
treated with the indicated compounds for additional 30 minutes. For inhibitor studies cells were pretreated with 10 M
BAPTA-AM or KH7 (Cayman Chemical, Ann Arbor, Michigan). After completion of incubation with compounds, cells
were lysed and the lysates were used for estimation of cAMP
using a fluorimeter (Fluostar Omega, BMG Labtech; Ortenberg,
Germany).
Calcineurin activity assay
Calcineurin activity was determined using the colorimetric
cellular calcineurin activity assay kit from Enzo life sciences
Results
GW4064 activates empty luciferase reporters via
FXR, ERR and Tgr5 -independent mechanism
We first studied FXR-independent GW4064 activity
on empty luciferase reporters. To rule out interferences by
endogenous FXR, we systematically assessed FXR expression across commonly used cell lines. Consistent with
prior reports (7, 38, 39), HEK cells did not express FXR
(Figure 1A). To our surprise, we failed to detect FXR
mRNA or protein in MCF-7 cells that have been reported
to undergo GW4064-induced apoptosis via endogenous
FXR (26, 31). We used identical pair of primers used in
the prior report (26) and failed to detect FXR expression
across three different stocks of MCF-7 from ATCC procured 2 to3 years apart. HepG2 liver cells, as expected,
expressed FXR while, C2C12 myotubes did not (Figure
1A).
GW4064 activated yeast Gal4 upstream activation sequence and minimal promoter containing Gal4-TK and
PGL4.31 lucs in HEK (Figure 1B and C). It also activated
empty PGL2 and 3 -basic as well as CIS-CK luc reporters
(lacking minimal promoters), and minimal promotercontaining PGL2 and PGL3 –promoter lucs (Figure 1B
and C). In agreement with our prior report (35), GW4064
caused robust activation of ERR-responsive human small
heterodimer partner (hSHP) and hPGC-1␣ -promoterdriven reporters. While ectopic FXR could not augment
the GW4064 activation of hPGC-1␣-luc, it enhanced
hSHP-luc activity, consistent with its FXR-responsiveness
(40) (Figure 1B). Ectopic FXR also robustly enhanced
GW4064 response on 3X-FXRE-luc (in PGL3-prom), but
not empty reporters (Figure 1B and C). The activation of
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
4
GW4064 modulates multiple GPCRs
empty reporters by GW4064 ranged from 1.5–50 folds
(Figure 1B is one representative experiment displaying
GW4064 response on the higher side and Figure 1C is
mean ⫾ SEM of 4 independent temporally separated experiments). Based on activation, average amplitude of the
GW4064 response on different reporters could be arranged
in
the
following
descending
order:
Mol Endocrinol
Gal4TKⱖPGL4.31⬎PGL2 promⱖPGL3 prom⬎PGL2
basicⱖPGL3 basicⱖCIS-CKluc.
We next assessed if the GW4064 activation of empty
reporters could be attributed to ERR as HEK cells express
endogenous ERRs (35). However, pretreatment with
ERR␣ inverse agonist XCT-790 (41) did not affect
GW4064 activation of PGL3-basic, while as expected, it
FIGURE 1. FXR-independent activation of luciferase reporters by GW4064. A. FXR mRNA and protein expression in commonly used
cell-lines. mRNA and total protein were isolated from indicated cell-lines and were analyzed by reverse-transcriptase PCR (RT-PCR, upper panel) or
immunoblot analysis (lower panel).P.C; plasmid control, N.C; no RT control. GAPDH and -actin were used as loading controls for RT-PCR and
immunoblots respectively. “Transfected FXR” is lysate from Flag-FXR-transfected HEK cells. B. HEK cells in 24-well plates were transfected with
indicated reporters (0.2 g), expression plasmids or empty vector (0.1 g) and internal control pEGFPC1 (0.1 g). 12h after transfection cells were
treated with GW4064 for 24h, harvested and GFP fluorescence and luminiscence were measured and the GFP normalized luciferase activity was
plotted as fold luciferase activity over vehicle (0.1% DMSO)-treated empty expression vector transfected respective reporter controls. PC is positive
control ligands. One representative of 9 independent experiments performed in duplicate and showing similar pattern but different fold activities is
shown. C. Normalized luciferase activity from HEK cells transfected and treated as above were plotted as fold activity over respective vehicletreated reporter controls. Data is mean ⫾ SEM from 4 independent experiments performed in duplicates. D-I. HEK (D-G, I) or MCF-7 and HepG2
cells (H) were transfected as above with indicated plasmids and data are mean ⫾ SEM of 3 independent experiments performed in duplicates.
GW4064 concentration used was 1 M (B-E,G-I) or as indicated (F). Where indicated, 30 minutes prior to GW4064 treatment cells were
pretreated with 5 M XCT-790 (D, G). CDCA concentration used was 50 M (I).
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
doi: 10.1210/me.2013-1353
compromised GW4064 activation of hPGC-1␣-promoter
luc (Figure 1D). Sequence analyses revealed the presence
of a number of response elements for cyclic AMP (CRE),
nuclear factor for activated T cells (NFAT-RE), activating
protein 1 (AP-1RE) and nuclear factor kB (NFkB-RE) on
all the empty reporters (data not shown). We therefore
assessed if GW4064 could activate luciferase reporters
driven by these elements. GW4064 strongly activated
CRE and NFAT-RE –lucs but failed to activate AP-1 and
NFB-RE-lucs in HEK cells (Figure 1E). On CRE and
NFAT-RE -lucs, GW4064 response was concentrationdependent (respective effective concentration 50 (EC50)
after 24h treatment, 0.012 M and 0.015 M; Figure
1F). ERR␣ did not appear to be responsible for this activity, as XCT-790 could not suppress GW4064 activation of CRE (Figure 1H). We also studied GW4064 response on these reporters in HepG2 cells that has been
extensively studied with respect to FXR biology (42, 43)
and MCF-7. As shown in Figure 1G, in FXR-rich HepG2,
GW4064 modestly activated the reporters, while in
MCF-7, the activation was robust, which confirmed that
GW4064 activation of these reporters were indeed
FXR-independent.
mend.endojournals.org
5
Bile acids activate CRE through TGR5 (44), and we
thus checked if the observed GW4064 response was mediated through this receptor. However, GW4064 activation of CRE was dampened upon TGR5 overexpression,
while, CDCA activation of CRE was clearly elevated (Figure 1H).
Together, results from Figure 1 indicate that GW4064mediated activation of empty reporters is independent of
FXR, ERR or TGR5.
GW4064 induces phospholipase C– dependent
calcineurin activation and NFAT nuclear
translocation
Since GW4064 activated NFAT-RE, we assessed if it
could influence intra-cellular Ca2⫹ level. GW4064 indeed
induced intra-cellular Ca2⫹ accumulation in HEK cells, as
visualized by flow cytometry (Figure 2A). Consequent to
Ca2⫹ accumulation, endogenous calcineurin activity was
enhanced, evident from release of free phosphate from a
calcineurin-specific RII phosphopeptide substrate, which
was also dephosphorylated by positive controls ionomycin and purified human calcineurin, while, calcineurin
inhibitor FK506 inhibited its basal dephosphorylation
FIGURE 2. GW4064 induces NFAT translocation and calcineurin activation by a PI-PLC-dependent mechanism.A. GW4064induction of intracellular Ca2⫹ accumulation was assessed by flow cytometry using fluo-4 as previously described (30) in a BD FACS Calibur flow
cytometer. Data are representative of three independent experiments showing identical pattern.B. HEK 293 cells in 10cm dishes were treated with
1 M GW4064, ionomycin (1 M) or FK506 (10 M) for 30 minutes and then was assayed for calcineurin activity using a colorimetric calcineurin
assay kit. Recombinant human calcineurin (40 U) was used as a positive control. Data represents nmol of PO4 released (values are normalized to
control). Data is mean ⫾ SEM from three representative experiments performed in triplicates. C. HEK cells in chamber slides were treated with 1
M GW4064 or ionomycin (1 M) for 30 minutes and endogenous NFATc1 was detected by immunocytochemistry. The nuclei were stained with
DAPI. Magnification 40X, bar; 50 m. Data are representative of three independent experiments. I; ionomycin. D. HEK cells in 24 well plates were
transfected with 200ng NFAT-RE-luc, and 100ng eGFPC1. Cells were then treated with indicated compoundsfor 30 minutes followed by treatment
with 1 M GW4064 for 24h. Normalized luciferase values were then plotted as % inhibition of GW4064 response. Data are mean ⫾ SEM of three
independent experiments performed in duplicate. *P ⬍ .05, **P ⬍ .01.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
6
GW4064 modulates multiple GPCRs
(Figure 2B). Consequent to calcineurin activation, nuclear translocation of endogenous NFATc1 was enhanced
by GW4064 in a microscopy-based assay (Figure 2C).
We next used a battery of inhibitors to revalidate and
gain further insights into the above observations. As demonstrated in Figure 2D, the specific NFAT inhibitor 11RVIVIT (45); INCA-6, a blocker of calcineurin-NFAT interaction (46); and inhibitors of calcineurin enzyme
activity FK506 and Cyclosporin A strongly repressed
GW4064 response on NFAT-RE-luc, indicating that Calcineurin-NFAT activation is indeed required for activation of NFAT-RE by GW4064. While GW4064-activation of NFAT-RE was blocked by Na3VO4 (general
phosphatase inhibitor), okadaic acid (protein phosphatase (PP) 1 and 2A inhibitor), sangunarine chloride (PP2C
inhibitor) (47) or NSC87877 (SHP1 and SHP2 protein
tyrosine phosphatase inhibitor) (48) failed to block this
activity (Figure 2D). These results suggest that GW4064
activation of NFAT-RE is achieved by specific activation
of calcineurin but not other phosphatases. GW4064 response on NFAT-RE was also blocked by phosphoinositol-dependent phospholipase C (PI-PLC) inhibitors in-
Mol Endocrinol
cluding, U73122 (49) and edelfosine (50) but not by
phosphatidylcholine-dependent phospholipase C inhibitor, D609 (51) (Figure 2D). Inositol triphosphate (IP3)
receptor antagonist 2-APB (52) and intracellular Ca2⫹
chelator BAPTA-AM (53) strongly inhibited GW4064response on NFAT-RE, however these effects were only
modestly blocked by cAMP-dependent protein kinase
(PKA) inhibitors including KT5720 (54) and H-89 (Figure 2D), while protein kinase C inhibitor, GF109203X
(55) had no effect. Together, these results demonstrate
that GW4064-mediated NFAT activation may primarily
be a result of PI-PLC pathway-mediated IP3 receptor activation and upregulation of cellular Ca2⫹ level which in
turn activates calcineurin-mediated NFAT nuclear
translocation.
GW4064 induces Ca2ⴙ -dependent cAMP signaling.
Next, effect of GW4064 on cAMP signaling was assessed. Intriguingly, although GW4064 dose-dependently
enhanced basal cAMP level (EC50: 0.241 M; Figure 3A)
and consequently enhanced CREB phosphorylation at
S133 (Figure 3B), it strongly suppressed forskolin-in-
FIGURE 3. GW4064 activation of CRE requires involvement of both cAMP and Ca2ⴙ signaling.A. HEK cells in 6-well plates were
treated with indicated doses of GW4064 or forskolin (FSK) for 30 minutes as indicated. Cells were then lysed, cAMP level was measured using an
HTRF-based kit and normalized with protein content. cAMP conc (nM)/g of protein was plotted. Data are mean ⫾ SEM of three independent
experiments performed in triplicates. B. HEK cells in 10 cm dishes were treated with 1 M GW4064 for the indicated time periods and were
immunoblotted for phospho-CREB S133. Total ERK1/2 was used as a loading control. Data are representative of three independent experiments.
C. HEK cells were pretreated with 10 M FSK for 30 minutes followed by treatment with indicated concentrations of GW4064 for another 30
minutes. D. HEK cells were pretreated with KH7 or BAPTA-AM for 30 minutes followed by 5 minutes treatment with 1 M GW4064. cAMP was
measured and plotted as in 3A. C and D; data are mean ⫾ SEM of three independent experiments performed in triplicates. E. HEK cells in 24well plates were transfected with 200ng NFAT-RE-luc and 100ng eGFPC1. Cells were then treated with indicated compounds for 30 minutes
followed by treatment with 1 M GW4064 for 24h. Normalized luciferase values were then plotted as % inhibition of GW4064 response. Data
are mean ⫾ SEM of three independent experiments performed in duplicates. F. HEK cells in 10 cm dishes were treated as indicated and nuclear
accumulation of endogenous Torc2 was determined by western blotting of cytosolic or nuclear extracts. ␣/ tubulin and histone H3 were used as
markers for cytosolic and nuclear fractions respectively. G and H. HEK cells in 24-well plates were transfected with CRE- luc and indicated
expression plasmids as above and were treated as indicated. Normalized luciferase values were plotted as fold activity over reporter plasmid
transfected vehicle (0.1% DMSO) treated cells. Data are mean ⫾ SEM of three independent experiments performed in duplicate. *P ⬍ .05, **P ⬍
.01, ***P ⬍ .001.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
doi: 10.1210/me.2013-1353
duced cAMP accumulation (inhibitory concentration 50
(IC50): 0.07 M; Figure 3C). We postulated that
GW4064-induction of basal cAMP level probably did not
occur through the membrane-bound forskolin-stimulated
adenylyl cyclase and assessed if it was achieved through
the Ca2⫹ and HCO3- -dependent soluble adenylyl cyclase
(56). Both intracellular Ca2⫹ chelator BAPTA-AM (53)
and soluble adenylyl cyclase inhibitor KH7 (56) blocked
the GW4064-induction of cAMP accumulation (Figure
3D), indicating that GW4064-mediated accumulation of
cAMP was indeed Ca2⫹-dependent.
The above observations were revalidated by assessing
GW4064 activation of CRE-luc in presence of various
pharmacological inhibitors. GW4064 activation of CREluc was partially blocked by KT5720. Na3VO4, FK506 as
well as BAPTA-AM also blocked it to the same extent as
KT5720, while okadaic acid had no effect (Figure 3E).
These results suggest that while CRE activation by
GW4064 may occur due to cellular accumulation of
cAMP, the full extent of GW4064 response is achieved by
additional Ca2⫹-calcineurin dependent events.
Transducers of regulated CREB protein (TORC) proteins are coactivators for CRE binding transcription factor (CREB), that are known to activate CRE independent
of cAMP-PKA dependent CREB phosphorylation at S133
(57). Since TORC proteins are activated by calcineurin
mediated dephosphorylation (58, 59), we assessed if
GW4064 could induce TORC translocation to nucleus.
GW4064 indeed caused a robust nuclear accumulation of
endogenous TORC2 in HEK cells, with a comparable
activity to staurosporin (Figure 3F), a salt-inducible kinase inhibitor that prevents phosphorylation of TORC
and thereby increases its nuclear translocation (60). In
support of GW4064-mediated CRE activation by both
cAMP and TORC pathways, overexpression of the PKA
catalytic subunit (PKA-Cat) resulted in synergistic activation of CRE in presence of GW4064 (Figure 3G) and
GW4064 cotreatment with staurosporine also resulted in
synergistic activation of this reporter (Figure 3H).
Taken together, data from Figure 2 and 3 suggest that
GW4064 primarily activates PI-PLC and IP3 dependent
Ca2⫹ signaling which leads to calcineurin-dependent activation of NFAT and TORC2 and these two factors stimulate NFAT-RE and CRE respectively. In addition, CRE
luc activation by GW4064 is also supplemented by cAMP
generated by Ca2⫹-dependent activation of soluble adenylyl cyclase.
GW4064 elicits signaling through G␣i/0, Gq/11
G-proteins
Since GW4064 activated PI-PLC signaling, we investigated if GW4064 achieved this through a GPCR. To that
mend.endojournals.org
7
end, GW4064 activation of NFAT-RE was assessed in
presence of GPCR minigenes that served as dominant
negatives for their respective G-proteins (37). Transfection of G␣0,i1/2,3 or Gq11 minigenes strongly inhibited
GW4064 response on NFAT-RE in HEK cells, while
minigenes for G␣S, G12, G13 or a scrambled control Gprotein minigene (GiR) were ineffective (Figure 4), indicating that GW4064 may regulate signaling through
G␣i/0 and/or Gq11 coupled GPCRs.
GW4064 binds to multiple GPCRs and elicits
histamine receptor-mediated signaling events
To identify the specific GPCRs through which
GW4064 signal is mediated, we first compiled a list of
G␣i/0 or Gq11 – coupled GPCRs that are expressed in
HEK cells from available literature (61– 63). Because
GW4064 activated PI-PLC dependent Ca2⫹ signaling and
caused intracellular cAMP accumulation, we speculated
that rather than acting as a neutral antagonist, GW4064
may act as a pure, partial or inverse agonist for one or
more GPCRs. A decade of studies have demonstrated that
a ligand can alter a receptor conformation into an activation/inhibition state that is dependent upon an intrinsic
property of the ligand usually based on its chemical composition (64). Theoretically therefore, each different ligand is capable of imparting its own unique activation/
inhibition state to a receptor. We thus conducted a
pharmacological screening where GW4064 activity on
NFAT-RE was assessed in presence of antagonists/inhibitors of compiled GPCRs. Interestingly, GW4064 activation of NFAT-RE was blocked by a number of GPCR
antagonists including that of angiotensin II, adrenergic,
cholecystokinin (CCK), dopamine, endothelin, histamine, leukotriene B4, neurotensin, M3 muscarinic, protease activated, and somatostatin receptors (Supplemen-
FIGURE 4. GW4064 activation of NFAT-RE is blocked by Gq/
11, G␣i and Go G-protein minigenes. HEK cells in 24-well
plates were transfected with 200ng NFAT-RE-luc, 100ng eGFPC1 and
200ng of indicated G-protein minigenes. Cells were then treated with
1 M GW4064 for 24h. Normalized luciferase values were then
plotted as % inhibition of GW4064 response. Data are mean ⫾ SEM
of three independent experiments performed in duplicates.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
8
GW4064 modulates multiple GPCRs
tary Table 1). These results indicate that GW4064mediated activation of NFAT-RE may stem from
activation/inhibition of more than one GPCR.
The secondary screening was performed by assessing
direct binding of GW4064 to these receptors by radioligand competition experiments and as shown in Supplementary Table 2, GW4064 competed with cognate radioligands for binding to angiotensin II receptor AT1R but
not AT2R, muscarinic acetylcholinergic receptors (M1,
M2, M3, M5 but not M4), and H1 and H2 histamine
receptors (H1R and H2R). GW4064 failed to affect binding of radioligands to other receptors tested, including
alpha adrenergic 1B, cholecystokinin,dopamine D4, endothelin A, neurotensin receptor 1 and somastostatin receptors 2 and 5 (Supplementary Table 2). Detailed competition binding studies performed on selected receptors
revealed that GW4064 showed concentration dependent
replacement of cognate radioligand binding to M1 (IC50;
7.33 M, Ki; 1.8 M), M2 (IC50; 4.11 M, Ki; 1.73
M), M3 (IC50; 11.6 M, Ki; 5.62 M) and M5 (IC50;
7.9 M,Ki; 4.89 M), and AT1R (IC50; 1.03 M, Ki;
0.94 M) (Supplementary Figure 1). GW4064 also competed with cognate radioligands for binding to H1R
(IC50; 8.58 M, Ki; 4.10 M) and H2R (IC50; 7.74 M,
Ki; 6.33 M) (Figure 5A and B) but not H3 and H4
(Figure 5C-D) histamine receptors (H3R and H4R).
We next assessed if GW4064 could functionally modulate activity of these receptors. While in cell-free assays
the EC50s of GW4064 for FXR in recruiting receptor
interacting domain of steroid receptor coactivator 1
(SRC1) (corresponding to amino acids 676 –700 of
SRC1) and transcription intermediary factor 2 (TIF-2)
were reported to be 0.015 and 0.070 M (34, 65) respectively and in cell-based mammalian one hybrid assay it
was reported to be 0.15 M (35), majority of studies in
the context of FXR have used GW4064 at a concentration
range of 0.1–10 M. Since we also observed the GWinduced rapid signaling events within this range, the ability of GW4064 to control the functions of these GPCRs
were assessed to a maximum concentration of 10 M. As
shown in Supplementary Figure 2, GW4064 failed to activate or repress AT-1R or muscarinic receptors M2 and
M3-mediated Ca2⫹ signaling in this concentration
range, indicating that GW4064 might signal through
these receptors only at high micromolar concentrations
(which correlated well with the binding data). GW4064,
however, robustly activated Gq11 coupled H1R and G␣i
coupled H4R, inhibited G␣s coupled H2R within this
concentration range and it was noneffective against G␣i
coupled H3R. GW4064-mediated H1R activation was
measured by a NFAT-RE-luc-based assay in which HEK
cells transfected with pcDNA3 or pcDNA3-H1R were
Mol Endocrinol
incubated with different concentrations of GW4064 or
histamine or in combination. Since a luciferase reporterbased assay system was used, in order to minimize secondary long term effects on the reporter, as well as to
avoid luciferase saturation-related exaggeration in EC50
values of the ligands, all treatments were given for 3h
(unlike 24h in Figure 1F). As demonstrated in Figure 5E
and F, both histamine and GW4064 activated the reporter in absence of transfected H1R (GW4064 EC50:
9.76 M, histamine EC50: 0.17 M), indicating that in
agreement with prior reports (63) HEK cells did express
functional endogenous H1R. In presence of transfected
H1R, not only the amplitude of activation was enhanced
but also the EC50 for both ligands were shifted to the left
(GW4064 EC50: 0.32 M, histamine EC50: 0.008 M).
EC50 of GW4064 for H1R was comparable to a previously reported EC50 of GW4064 (0.15 M) for FXR as
determined from a cell-based mammalian one hybrid assay (35). Interestingly, cotreatment of GW4064 with various doses of histamine or vice versa resulted in further
increase in amplitude of reporter activation, without any
significant change in EC50 of either ligands (Figure 5G
and H). These data indicate that, although GW4064
showed some binding to the histamine binding site of
H1R, it activated H1R through a distinct binding site on
this receptor. A similar finding was observed for H4R, for
which although GW4064 could not compete with [3H]
Histamine in the radio-ligand binding assay (Figure 5D),
in the functional (cAMPGloSensor) assay it activated
H4R-mediated downregulation of forskolin-stimulated
cAMP (GW4064 EC50: 7.42 ⫻ 10-4 M) with similar
efficacy to selective H4R agonist, clobenpropit (66)
(EC50: 1.46 ⫻ 10-3M) (Figure 5K), however, consistent
with lack of binding to H3R it did not modulate H3R
activity (Figure 5J). GW4064 also suppressed H2R mediated cAMP accumulation in presence or absence of the
selective H2R agonist, amthamine (67) (IC50: 3.8 M
and 0.78 M respectively) as determined by the cAMP
GloSensor assay (Figure 5I). Calculated EC50s, IC50s
and Ki values from functional and radioligand competition assays as well as published EC50s of GW4064 for
FXR have been summarized in Table 1.
H1R has been cocrystalized with its specific ligand
E-doxepin (68). Although evidences from functional assays indicated that H1R activation by GW4064 was primarily achieved through a site topographically distinct
from its orthosteric site (Figure 5E and F), given that
GW4064 also competed with [3H] histamine in a radioligand binding assay (Figure 5A), thereby suggesting that
it interacted with the orthosteric site too, we investigated
the interaction of GW4064 with histamine binding site of
human H1R by a molecular docking study. To determine
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
doi: 10.1210/me.2013-1353
the ability of our docking program to reproduce the orientation and position of the ligand present in the crystal
structure, first E-Doxepin was extracted and docked back
to the corresponding binding pocket of H1R. The conformation obtained after docking was found to be similar to
that of the crystal structure, which validated our docking
method. GW4064 binding mode closely resembled the
cocrystallized E-doxepin in H1R, and its carboxyl group
was found to extend out of pocket toward the extracellular space where it formed hydrogen bonds with ASP178
mend.endojournals.org
9
and HIS450 (Supplementary Figure 3). The top scoring
binding conformation of GW4064 was found to be involved in aromatic interactions with the aromatic rings of
TYR108, TYR158 and TYR431, whereas hydrophobic
interactions were found to be primarily provided by
SER111, LYS179, TRP428, PHE432 and ILE454 (Supplementary Figure 3).
We also evaluated the structural similarities between
GW4064 and other histamine receptor ligands but no
significant similarity between their chemical structures
FIGURE 5. GW4064 binds to and modulates the activities of histamine receptors. A-D. Membrane fractions from CHO-K1 cells
overexpressing indicated receptors were incubated with cognate radioligands [1.20 nM3H-Pyrilamine for H1 (kd 1.10 nM), 0.10 nM125IAminopotentidine for H2 (kd 0.45 nM), 0.40 nM3H- N-␣-Methylhistamine for H3 (kd 0.38 nM) and 8.20 nM [3H] Histamine for H4 (kd 5.70 nM)]
for 1.5–3 hours in presence of indicated concentrations of unlabeled GW4064 or ligands and data was plotted as % binding of radioligands with
values in absence of cold competitors set as 100. Non specific binding in each case was determined by coincubation with 1.0 M Pyrilamine for
H1, 3.0 M Tiotidine for H2, 1.0 M R(-)-␣-Methylhistamine (RAMH) for H3 and 1.0 M Histamine for H4. A-D. Data represent mean ⫾ SEM
from one experiment performed in duplicates. E-F. NFAT-RE-luciferase activity was determined in HEK cells transfected with pcDNA3 or H1 and
treated with indicated concentrations of histamine or GW4064 for 3h. G-H. NFAT-RE-luciferase activity was determined in H1-trasnsfected HEK
cells after indicated cotreatments. I-K. HEK cells overexpressing H2, H3 or H4 and cAMPGloSensor plasmids were treated with GW4064 or
histamine receptor ligands for 15 minutes. For H2 assay (I), cells were treated with GW4064 alone for 15 minutes or were pretreated with 1 M
amthamine for 15 minutes. For H3 and H4 assays (J and K) cells were pretreated with 10 M forskolin for 15 minutes, and were then treated
with imetit, clobenpropit or GW4064 for 15 minutes further. For Imetit ⫹ GW4064 or clobenpropit ⫹ GW4064 treated groups, imetit or
clobenpropit were added 15 minutes prior to GW4064 treatment. cAMP level was determined using a luminometer, and plotted as relative light
units. E-K, data are mean ⫾ SEM of 3 independent experiments performed in duplicates.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
10
GW4064 modulates multiple GPCRs
Table 1.
Receptor
hFXR
Mol Endocrinol
Relative EC50, IC50 and Ki values of GW4064 for FXR and histamine receptors
IC50
(antagonist)
(M)
IC50 (inverse
agonist)
(M)
EC
50 (M)
0.015a
Ki
(M)
0.09b
hFXR
0.07
hFXR
0.15
H1R
0.32a
H2R
4.1b
0.78 a
3.8 a
NI a
NI a
6.33
b
H3R
NA a
H4R
7.42 ⫻
10-4 a
Assays
Cell free FRET assay
with SRC1 676 –700 (34)
b
Cell-based FXRE-luc
reporter assay (34)
Cell free HTRF assay
with hTIF-2 (65)
Mammalian one hybrid
assay with pM-FXR
(35)
a
Cell based NFAT-REluciferase
b
Competitive RLB
a
Cell based cAMP
b
Competitive RLB
a
Cell based cAMP
b
Competitive RLB
a
Cell based cAMP
b
Competitive RLB
a
NC b
NC b
Table 1. Relative EC50, IC50 and ki values of GW4064 pertaining to FXR and histamine receptors is indicated. NA; no activation, NI; no inhibition,
NC; no competition, FRET; Fluorescence resonance energy transfer, HTRF; Homogenous time resolved fluorescence, RLB; Radioligand binding
assay.
were found (data not shown), suggesting that GW4064
provides a new chemical scaffold for modulation of histamine receptors.
Together these results indicate that GW4064 is a functional modulator of H1, H2 and H4 histamine receptors
and that these receptors may contribute to the pharmacological action of GW4064 in addition to FXR and
ERRs.
Induction of cell death in MCF-7 and HEK cells by
GW4064 is FXR-independent
GW4064 has been reported to promote apoptosis of
colon cancer and breast cancer (MCF-7) cells (12, 14, 26,
31), while in HepG2 hepatoma cells it protects against
serum-deprivation-induced apoptosis (12, 28). Since
GW4064 modulated the activity of histamine receptors,
that has been reported to regulate cell growth and apoptosis (69), and as we observed no FXR expression in
MCF-7 cells, GW4064-induced MCF-7 cell death was
re-evaluated.
The GW4064-induced MCF-7 cell death was dependent on serum concentration (Figure 7A), which is in
agreement with the experimental conditions followed by
Swales et al, where MCF-7 cells were serum starved for
24h followed by treatment with GW4064 in medium containing no serum for the cell-death assays (26). Interestingly, in identical conditions, similar amount of cell-death
was also observed in HEK cells (Figure 7A). Ectopic expression of FXR in HEK cells rather improved cell-sur-
vival both in presence or absence of GW4064 when compared to vector-transfected control cells (Figure 7B),
indicating that FXR overexpression not only protected
against GW4064-induced cell death but also protected
these cells against transfection-related stress-induced cell
death.
Swales et al, have demonstrated GW4064-induction of
FXRE in MCF-7 cells (26) and we found that although
GW4064 indeed activated FXRE-luc in these cells, the
amplitude of FXRE activation in absence of ectopic FXR
was equivalent to GW4064-mediated activation of empty
PGL3-prom luc (Figure 7C). Only with ectopic expression of FXR in these cells, did we obtain a higher response
on FXRE-luc when compared to PGL3 prom-luc (Figure
7D). In contrast, in HepG2 cells, GW4064 robustly activated FXRE in comparison to PGL3-prom, even without
exogenous FXR (Figure 7D). These results demonstrate
that GW4064-induction of apoptosis in MCF-7 and HEK
cells was FXR-independent and occurred probably via the
GPCR signaling pathways.
Histamine receptors are expressed in HEK, MCF-7
and HepG2 cells and histamine receptor regulators
protect against GW4064-induced cell death
To investigate if GW4064-mediated signaling events
and cell death in HEK and MCF-7 were indeed dependent
on the histamine receptors, first histamine receptor expression in these cells were studied. As shown in Figure
7A, all the histamine receptor mRNAs were detected in
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
doi: 10.1210/me.2013-1353
HEK, MCF-7 and HepG2 cells. In addition, histidine decarboxylase (HDC), the enzyme that catalyzes conversion
of histidine to histamine was also expressed in these cells
(Figure 7A), indicating that a functional autocrine histamine signaling system was present in these cells. We next
determined the efficacy of histamine receptor modulators
in blocking GW4064-induced cell death in HEK and
MCF-7 cells. GW4064-induced cell death in both HEK
and MCF-7 were significantly blocked by selective H2
agonist amthamine and H4 inhibitor JNJ 10191584 (70)
(Figure 7B and C). While, H1 antagonist fexofenadine
mend.endojournals.org
11
was modestly effective in blocking GW4064-induced cell
death in MCF-7 (Figure 7C), it was ineffective in HEK
(Figure 7B). H3 agonist (R)-(-)-␣-Methylhistamine
(RAMH) was ineffective in both HEK and MCF-7 (Figure
7B and C).
Discussion
While objectively exploring the mechanism of GW4064induced activation of empty luciferase reporters, here we
have identified GW4064 as a ligand
for multiple GPCRs and have established that at least the cell growth
regulatory functions of this compound could be attributed to its
modulation of histamine receptors.
Our findings that GW4064 modulates histamine receptor activity
and that HepG2 cells express all histamine receptor subtypes, explain at
least in part the gross differences in
hepatic gene expression profiles induced by three different FXR agonists; fexaramine, GW4064 and
CDCA (36).
Although FXR expression is predominant in enterohepatic tissues,
recently a number of reports implicated this receptor in a number of
roles in extraenterohepatic organs,
including in different cancer types
and vasculature (4, 13, 14, 21, 25,
26, 71). GW4064 has been used in a
number of these studies as a pharmacological tool as CDCA, the endogenous FXR agonist also activates TGR5 (44). Interestingly,
while FXR or its ligands have been
reported to increase survival of normal and malignant breast, hepatic
and pancreatic cells through its antiinflammatory functions (8, 12, 16,
FIGURE 6. GW4064 induces FXR-independent cell-death in MCF-7 and HEK cells.
19, 22, 23, 28) they have also been
A. MCF-7 or HEK cells were plated in 96 well plates (10000 cells / well) and then were
shown to cause reactive oxygen spemaintained in medium supplemented with indicated serum concentrations for 24h. The cells
cies (ROS) -induced apoptosis of
were then treated with indicated concentrations of GW4064 in medium with identical serum
concentrations, and were further cultured for 24h or 48h following which cell viability was
cardiac, vascular and cancer cells (4,
assessed by MTT assay and plotted as % cell death compared to vehicle-treated controls (for
18, 21, 29, 31, 72). Although it is
which cell death was set as 0). B. Effect of 5 M GW4064 on cell viability of untransfected (UT),
possible that these differential reempty vector or FXR transfected cells were assessed by MTT. C. Comparison of PGL3-prom or
3X-FXRE luc activities in HepG2, HEK or MCF-7 cells transfected with empty (vector) or FXR
sponses could result from spatioexpression plasmids. Normalized luciferase activities were plotted as fold activity over values from
temporal differences in FXR funcvehicle-treated control groups. Data are are mean ⫾ SEM of 3 independent experiments
tions, our inability to detect FXR
performed in duplicates. *P ⬍ .05.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
12
GW4064 modulates multiple GPCRs
transcript or protein in MCF-7 cells, coupled with induction of apoptosis by GW4064 in these cells clearly indicate that FXR-independent mechanisms are responsible
for the cytotoxic effects of GW4064. Identification of
GW4064 as an H4R agonist also raises the possibility that
GW4064-mediated cell death in hepatocellular carcinoma could actually occur via H4R, as clobenpropit an
H4R agonist has been shown to inhibit progression and
metastasis of human hepatic cholangiocarcinoma (66).
The notion that histamine receptors may contribute to the
cytotoxic functions attributed to FXR activation by
GW4064 gains support from the observations where
GW4064 has been shown to aggravate diet-induced obesity, diabetes and hepatic steatosis (73, 74), while INT747, another FXR agonist protected against these conditions (74). Given that GW4064 inhibited H2R, it is
interesting to note that H2R knock-out mice have been
shown to display severe hyperglycemia and hepatic steatosis (75). However, to fully dissect the FXR-dependent
and independent functions of GW4064 it is necessary to
assess the function of this compound in FXR knock-out
mice.
Incidentally, a number of nuclear receptor ligands have
been found to display off-target effects. For example,
CDCA and estrogen were found to modulate G-protein
coupled receptors TGR5 and GPR-30, respectively (44,
76), guggulsterone initially identified as an FXR antagonist was found to bind to and modulate the activities of
several steroid receptors including androgen, mineralo-
Mol Endocrinol
corticoid, glucocorticoid and progesterone receptors with
higher affinity and efficacy than FXR (77), and T019377,
a liver X receptor agonist was found to activate pregnane
X receptor (78). Together with our results these evidences
indicate that in the context of ligand-receptor interactions, promiscuity might be a rule rather than an exception, and therefore careful combination of genetic and
pharmacological approaches are necessary for interpretation of biological data pertaining to a particular receptor.
The histamine receptors comprise a group of 4 GPCRs
that couple to Gq/11 (H1R), G␣s (H2R), G␣i/0 (H3R and
H4R). These receptors display distinct tissue distribution,
where H1R is predominantly localized in endothelial cells
and smooth muscle, H2R in gastric parietal cells, H3R in
the central nervous system (CNS) and H4R in mast cells,
eosinophils, T cells and dendritic cells (69, 79). Histamine
receptors have been of intense pharmacological interest
relating to allergy, inflammation, immunomodulation,
smooth muscle contraction, gastric acid secretion and
functioning of the CNS including cognition, wakefulness
and food-intake (69, 79). A number of drugs pertaining to
allergy (H1R), gastric ulcer and gastrooesophageal reflux
(H2R) are used widely. Other than betahistine, a dual
H1R agonist and H3R antagonist which is used as an
antivertigo agent, H3R antagonists are also being researched as potential drugs for neurodegenerative diseases. Histamine has been shown to play important roles
in cell growth, carcinogenesis, angiogenesis, metastasis
and apoptosis since 1932 (50, 66, 69), however, due to
FIGURE 7. All four histamine receptors and histidine decarboxylase are expressed in HEK and MCF-7 cells and selective
histamine receptor modulators block GW4064-induced cell death in these cells. A. mRNA expression as determined by RT-PCR.
PC; plasmid control, NC; no RT control. Data is representative of 3 independent experiments. B and C. MTT assay in HEK (B) and MCF-7 (C) cells
treated with indicated concentrations of selective histamine receptor modulators with or without 5 M GW4064 for 48h. Data is plotted as % cell
death where cell death obtained with 5uM GW4064 alone was set as 100%. C and D; Data are are mean ⫾ SEM of 3 independent experiments
performed in duplicates. *P ⬍ .05, **P ⬍ .01, ***P ⬍ .001.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
doi: 10.1210/me.2013-1353
the differential functions of the four different histamine
receptors, interpretation of existing data has been difficult. Further, both agonists and inhibitors of histamine
receptors have been shown to induce cell type-specific
proliferation or cell death in different studies (69). A comprehensive analysis of these studies along with the clinical
findings that plasma histamine is raised in patients with
breast cancer indicate that histamine may have a biphasic
role in malignancies and its level might be tightly regulated by these cells in order to maintain an environment
conducive to proliferation and malignancy. In our hands
both agonists and antagonists of the four histamine receptors induced variable levels of cell growth at picomolar to nanomolar concentrations, while at high micromolar concentrations most of them inhibited cellular
proliferation and induced cell death (Yadav and Sanyal
unpublished data) and the same was true for GW4064.
That GW4064-induction of cell death in both MCF-7 and
HEK were efficiently blocked by H2R agonist amthamine
and H4R antagonist JNJ 10191584, indicates that
GW4064 induced cell death was indeed dependent on
modulation of these two receptors by this compound.
It’s interesting to note that despite exhibiting some
level of binding to the orthosteric site of H1R, GW4064
activated this receptor cooperatively with histamine. Further, despite lack of competitive binding to H3R and
H4R, GW4064 strongly activated H4R only, without affecting H3R activity in an identical assay system. The
above evidences indicate that GW4064 may act through
topographically distinct allosteric binding sites on H1R
and H4R. Given that till date no allosteric modulators of
histamine receptors are available and the intense pharmacological interest pertaining to this group of receptors,
GW4064 may provide a unique strategy for histamine
receptor modulation and also owing to the fact that it
resembles none of the existing histamine receptor modulators, this compound may provide novel chemical scaffolds for designing specific drugs pertaining to histamine
signaling. Also the ability of this compound to bind to
other GPCRs including AT1 and muscarinic receptors
may provide a scaffold for novel pharmacological modulators of these receptors.
In conclusion, our unbiased attempt to objectively decipher the mechanism behind induction of empty luciferase reporters by the synthetic FXR agonist GW4064
led to the identification of this compound as a regulator of
multiple GPCRs and this discovery will not only help to
dissect the functional difference between different FXR
agonists, but also will provide important medicinal chemistry insights for design of novel drugs related to histamine and angiotensin receptors.
mend.endojournals.org
13
Acknowledgments
The authors are thankful to Dr. Heidi E Hamm (Vanderbilt
University Medical Center) for kind gift of plasmids. The authors acknowledge SAIF division of CSIR-CDRI for help with
flow cytometry.
Received November 1, 2013. Accepted February 28, 2014.
*Address all correspondence and requests for reprints to:
Sabyasachi Sanyal, Division of Biochemistry, CSIR-Central
Drug Research Institute, 10 Janakipuram Extn, Sitapur Road,
UP, India., E-Mail: [email protected]., Phone No.091- (522)2771940, Fax No. 091- (522)-27719401.
#These authors contributed equally
Disclosure Summary: The authors have nothing to disclose
This work was supported by research grants from CSIR network projects UNDO (to SS and AKT) and ASTHI (to NC). NS,
HK and JSM were supported by fellowships from UGC. MY
was supported by fellowship from ICMR. AKS, AG, SKDD
were supported by fellowships from CSIR.
References
1. Forman BM, Goode E, Chen J, Oro AE, Bradley DJ, Perlmann T,
Noonan DJ, Burka LT, McMorris T, Lamph WW, Evans RM,
Weinberger C. Identification of a nuclear receptor that is activated
by farnesol metabolites. Cell. 1995;81(5):687– 693.
2. Seol W, Choi HS, Moore DD. Isolation of proteins that interact
specifically with the retinoid X receptor: two novel orphan receptors. Mol Endocrinol. 1995;9(1):72– 85.
3. Abdelkarim M, Caron S, Duhem C, Prawitt J, Dumont J, Lucas A,
Bouchaert E, Briand O, Brozek J, Kuipers F, Fievet C, Cariou B,
Staels B. The farnesoid X receptor regulates adipocyte differentiation and function by promoting peroxisome proliferator-activated
receptor-gamma and interfering with the Wnt/beta-catenin pathways. J Biol Chem. 2010;285(47):36759 –36767.
4. Bishop-Bailey D, Walsh DT, Warner TD. Expression and activation of the farnesoid X receptor in the vasculature. Proc Natl Acad
Sci U S A. 2004;101(10):3668 –3673.
5. Calkin AC, Tontonoz P. Transcriptional integration of metabolism
by the nuclear sterol-activated receptors LXR and FXR. Nat Rev
Mol Cell Biol. 2012;13(4):213–224.
6. Moschetta A, Bookout AL, Mangelsdorf DJ. Prevention of cholesterol gallstone disease by FXR agonists in a mouse model. Nat Med.
2004;10(12):1352–1358.
7. Xing X, Burgermeister E, Geisler F, Einwachter H, Fan L, Hiber M,
Rauser S, Walch A, Rocken C, Ebeling M, Wright MB, Schmid RM,
Ebert MP. Hematopoietically expressed homeobox is a target gene
of farnesoid X receptor in chenodeoxycholic acid-induced liver hypertrophy. Hepatology. 2009;49(3):979 –988.
8. Zhang L, Wang YD, Chen WD, Wang X, Lou G, Liu N, Lin M,
Forman BM, Huang W. Promotion of liver regeneration/repair by
farnesoid X receptor in both liver and intestine in mice. Hepatology.
56(6):2336 –2343.
9. Zhang L, Wang YD, Chen WD, Wang X, Lou G, Liu N, Lin M,
Forman BM, Huang W. Promotion of liver regeneration/repair by
farnesoid X receptor in both liver and intestine in mice. Hepatology.
2012;56(6):2336 –2343.
10. Gadaleta RM, van Mil SW, Oldenburg B, Siersema PD, Klomp LW,
van Erpecum KJ. Bile acids and their nuclear receptor FXR: Relevance for hepatobiliary and gastrointestinal disease. Biochim Biophys Acta. 2010;1801(7):683– 692.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
14
GW4064 modulates multiple GPCRs
11. Modica S, Gadaleta RM, Moschetta A. Deciphering the nuclear bile
acid receptor FXR paradigm. Nucl Recept Signal. 8:e005.
12. Wang YD, Chen WD, Wang M, Yu D, Forman BM, Huang W.
Farnesoid X receptor antagonizes nuclear factor kappaB in hepatic
inflammatory response. Hepatology. 2008;48(5):1632–1643.
13. Modica S, Gadaleta RM, Moschetta A. Deciphering the nuclear bile
acid receptor FXR paradigm. Nucl Recept Signal. 2010;8:e005.
14. Modica S, Murzilli S, Salvatore L, Schmidt DR, Moschetta A. Nuclear bile acid receptor FXR protects against intestinal tumorigenesis. Cancer Res. 2008;68(23):9589 –9594.
15. Trauner M, Fickert P, Halilbasic E, Moustafa T. Lessons from the
toxic bile concept for the pathogenesis and treatment of cholestatic
liver diseases. Wien Med Wochenschr. 2008;158(19 –20):542–548.
16. Lindor KD. Farnesoid X receptor agonists for primary biliary cirrhosis. Curr Opin Gastroenterol. 27(3):285–288.
17. Lindor KD. Farnesoid X receptor agonists for primary biliary cirrhosis. Curr Opin Gastroenterol. 2011;27(3):285–288.
18. Catalano S, Malivindi R, Giordano C, Gu G, Panza S, Bonofiglio D,
Lanzino M, Sisci D, Panno ML, Ando S. Farnesoid X receptor,
through the binding with steroidogenic factor 1-responsive element, inhibits aromatase expression in tumor Leydig cells. J Biol
Chem. 2010;285(8):5581–5593.
19. Journe F, Laurent G, Chaboteaux C, Nonclercq D, Durbecq V,
Larsimont D, Body JJ. Farnesol, a mevalonate pathway intermediate, stimulates MCF-7 breast cancer cell growth through farnesoidX-receptor-mediated estrogen receptor activation. Breast Cancer
Res Treat. 2008;107(1):49 – 61.
20. Kaeding J, Bouchaert E, Belanger J, Caron P, Chouinard S, Verreault M, Larouche O, Pelletier G, Staels B, Belanger A, Barbier O.
Activators of the farnesoid X receptor negatively regulate androgen
glucuronidation in human prostate cancer LNCAP cells. Biochem J.
2008;410(2):245–253.
21. Koutsounas I, Giaginis C, Theocharis S. Farnesoid X Receptor
(FXR) from normal to malignant state. Histol Histopathol. 2012;
27(7):835– 853.
22. Lee JY, Lee KT, Lee JK, Lee KH, Jang KT, Heo JS, Choi SH, Kim Y,
Rhee JC. Farnesoid X receptor, overexpressed in pancreatic cancer
with lymph node metastasis promotes cell migration and invasion.
Br J Cancer. 2011;104(6):1027–1037.
23. Lian F, Xing X, Yuan G, Schafer C, Rauser S, Walch A, Rocken C,
Ebeling M, Wright MB, Schmid RM, Ebert MP, Burgermeister E.
Farnesoid X receptor protects human and murine gastric epithelial
cells against inflammation-induced damage. Biochem J. 2011;
438(2):315–323.
24. Maran RR, Thomas A, Roth M, Sheng Z, Esterly N, Pinson D, Gao
X, Zhang Y, Ganapathy V, Gonzalez FJ, Guo GL. Farnesoid X
receptor deficiency in mice leads to increased intestinal epithelial
cell proliferation and tumor development. J Pharmacol Exp Ther.
2009;328(2):469 – 477.
25. Smith DL, Keshavan P, Avissar U, Ahmed K, Zucker SD. Sodium
taurocholate inhibits intestinal adenoma formation in APCMin/⫹
mice, potentially through activation of the farnesoid X receptor.
Carcinogenesis. 2010;31(6):1100 –1109.
26. Swales KE, Korbonits M, Carpenter R, Walsh DT, Warner TD,
Bishop-Bailey D. The farnesoid X receptor is expressed in breast
cancer and regulates apoptosis and aromatase expression. Cancer
Res. 2006;66(20):10120 –10126.
27. Zhong XY, Yu JH, Zhang WG, Wang ZD, Dong Q, Tai S, Cui YF,
Li H. MicroRNA-421 functions as an oncogenic miRNA in biliary
tract cancer through down-regulating farnesoid X receptor expression. Gene. 2012;493(1):44 –51.
28. Wang YD, Yang F, Chen WD, Huang X, Lai L, Forman BM, Huang
W. Farnesoid X receptor protects liver cells from apoptosis induced
by serum deprivation in vitro and fasting in vivo. Mol Endocrinol.
2008;22(7):1622–1632.
29. Catalano S, Panza S, Malivindi R, Giordano C, Barone I, Bossi G,
Lanzino M, Sirianni R, Mauro L, Sisci D, Bonofiglio D, Ando S.
Mol Endocrinol
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
Inhibition of Leydig tumor growth by farnesoid X receptor activation: the in vitro and in vivo basis for a novel therapeutic strategy.
Int J Cancer. 2013;132(10):2237–2247.
Vines A, McBean GJ, Blanco-Fernandez A. A flow-cytometric
method for continuous measurement of intracellular Ca(2⫹) concentration. Cytometry A. 2010;77(11):1091–1097.
Giordano C, Catalano S, Panza S, Vizza D, Barone I, Bonofiglio D,
Gelsomino L, Rizza P, Fuqua SA, Ando S. Farnesoid X receptor
inhibits tamoxifen-resistant MCF-7 breast cancer cell growth
through downregulation of HER2 expression. Oncogene. 2011;
30(39):4129 – 4140.
Makishima M, Okamoto AY, Repa JJ, Tu H, Learned RM, Luk A,
Hull MV, Lustig KD, Mangelsdorf DJ, Shan B. Identification of a
nuclear receptor for bile acids. Science. 1999;284(5418):1362–
1365.
Kawamata Y, Fujii R, Hosoya M, Harada M, Yoshida H, Miwa M,
Fukusumi S, Habata Y, Itoh T, Shintani Y, Hinuma S, Fujisawa Y,
Fujino M. A G protein-coupled receptor responsive to bile acids.
J Biol Chem. 2003;278(11):9435–9440.
Maloney PR, Parks DJ, Haffner CD, Fivush AM, Chandra G, Plunket KD, Creech KL, Moore LB, Wilson JG, Lewis MC, Jones SA,
Willson TM. Identification of a chemical tool for the orphan nuclear receptor FXR. J Med Chem. 2000;43(16):2971–2974.
Dwivedi SK, Singh N, Kumari R, Mishra JS, Tripathi S, Banerjee P,
Shah P, Kukshal V, Tyagi AM, Gaikwad AN, Chaturvedi RK,
Mishra DP, Trivedi AK, Sanyal S, Chattopadhyay N, Ramachandran R, Siddiqi MI, Bandyopadhyay A, Arora A, Lundasen T,
Anakk SP, Moore DD, Sanyal S. Bile acid receptor agonist GW4064
regulates PPARgamma coactivator-1alpha expression through estrogen receptor-related receptor alpha. Mol Endocrinol. 2011;
25(6):922–932.
Downes M, Verdecia MA, Roecker AJ, Hughes R, Hogenesch JB,
Kast-Woelbern HR, Bowman ME, Ferrer JL, Anisfeld AM, Edwards PA, Rosenfeld JM, Alvarez JG, Noel JP, Nicolaou KC, Evans
RM. A chemical, genetic, and structural analysis of the nuclear bile
acid receptor FXR. Mol Cell. 2003;11(4):1079 –1092.
Gilchrist A, Vanhauwe JF, Li A, Thomas TO, Voyno-Yasenetskaya
T, Hamm HE. G alpha minigenes expressing C-terminal peptides
serve as specific inhibitors of thrombin-mediated endothelial activation. J Biol Chem. 2001;276(28):25672–25679.
Nakahara M, Furuya N, Takagaki K, Sugaya T, Hirota K, Fukamizu A, Kanda T, Fujii H, Sato R. Ileal bile acid-binding protein,
functionally associated with the farnesoid X receptor or the ileal
bile acid transporter, regulates bile acid activity in the small intestine. J Biol Chem. 2005;280(51):42283– 42289.
Wang S, Lai K, Moy FJ, Bhat A, Hartman HB, Evans MJ. The
nuclear hormone receptor farnesoid X receptor (FXR) is activated
by androsterone. Endocrinology. 2006;147(9):4025– 4033.
Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J,
Mangelsdorf DJ. Molecular basis for feedback regulation of bile
acid synthesis by nuclear receptors. Mol Cell. 2000;6(3):507–515.
Busch BB, Stevens WC, Jr., Martin R, Ordentlich P, Zhou S, Sapp
DW, Horlick RA, Mohan R. Identification of a selective inverse
agonist for the orphan nuclear receptor estrogen-related receptor
alpha. J Med Chem. 2004;47(23):5593–5596.
Fang S, Tsang S, Jones R, Ponugoti B, Yoon H, Wu SY, Chiang CM,
Willson TM, Kemper JK. The p300 acetylase is critical for ligandactivated farnesoid X receptor (FXR) induction of SHP. J Biol
Chem. 2008;283(50):35086 –35095.
Gineste R, Sirvent A, Paumelle R, Helleboid S, Aquilina A, Darteil
R, Hum DW, Fruchart JC, Staels B. Phosphorylation of farnesoid X
receptor by protein kinase C promotes its transcriptional activity.
Mol Endocrinol. 2008;22(11):2433–2447.
Maruyama T, Miyamoto Y, Nakamura T, Tamai Y, Okada H,
Sugiyama E, Nakamura T, Itadani H, Tanaka K. Identification of
membrane-type receptor for bile acids (M-BAR). Biochem Biophys
Res Commun. 2002;298(5):714 –719.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
doi: 10.1210/me.2013-1353
45. Aramburu J, Yaffe MB, Lopez-Rodriguez C, Cantley LC, Hogan
PG, Rao A. Affinity-driven peptide selection of an NFAT inhibitor
more selective than cyclosporin A. Science. 1999;285(5436):2129 –
2133.
46. Roehrl MH, Kang S, Aramburu J, Wagner G, Rao A, Hogan PG.
Selective inhibition of calcineurin-NFAT signaling by blocking protein-protein interaction with small organic molecules. Proc Natl
Acad Sci U S A. 2004;101(20):7554 –7559.
47. Aburai N, Yoshida M, Ohnishi M, Kimura K. Sanguinarine as a
potent and specific inhibitor of protein phosphatase 2C in vitro and
induces apoptosis via phosphorylation of p38 in HL60 cells. Biosci
Biotechnol Biochem. 2010;74(3):548 –552.
48. Chen L, Sung SS, Yip ML, Lawrence HR, Ren Y, Guida WC, Sebti
SM, Lawrence NJ, Wu J. Discovery of a novel shp2 protein tyrosine
phosphatase inhibitor. Mol Pharmacol. 2006;70(2):562–570.
49. Bleasdale JE, Thakur NR, Gremban RS, Bundy GL, Fitzpatrick FA,
Smith RJ, Bunting S. Selective inhibition of receptor-coupled phospholipase C-dependent processes in human platelets and polymorphonuclear neutrophils. J Pharmacol Exp Ther. 1990;255(2):756 –
768.
50. Powis G, Seewald MJ, Gratas C, Melder D, Riebow J, Modest EJ.
Selective inhibition of phosphatidylinositol phospholipase C by cytotoxic ether lipid analogues. Cancer Res. 1992;52(10):2835–
2840.
51. Amtmann E. The antiviral, antitumoural xanthate D609 is a competitive inhibitor of phosphatidylcholine-specific phospholipase C.
Drugs Exp Clin Res. 1996;22(6):287–294.
52. Maruyama T, Kanaji T, Nakade S, Kanno T, Mikoshiba K. 2APB,
2-aminoethoxydiphenyl borate, a membrane-penetrable modulator
of Ins(1,4,5)P3-induced Ca2⫹ release. J Biochem. 1997;122(3):
498 –505.
53. Raspe E, Ramboer I, Galand N, Boeynaems JM. Enhanced release
of prostacyclin from quin 2-loaded endothelial cells. Eur J Pharmacol. 1989;163(2–3):345–351.
54. Kase H, Iwahashi K, Nakanishi S, Matsuda Y, Yamada K, Takahashi M, Murakata C, Sato A, Kaneko M. K-252 compounds, novel
and potent inhibitors of protein kinase C and cyclic nucleotidedependent protein kinases. Biochem Biophys Res Commun. 1987;
142(2):436 – 440.
55. Toullec D, Pianetti P, Coste H, Bellevergue P, Grand-Perret T,
Ajakane M, Baudet V, Boissin P, Boursier E, Loriolle F, et al. The
bisindolylmaleimide GF 109203X is a potent and selective inhibitor
of protein kinase C. J Biol Chem. 1991;266(24):15771–15781.
56. Hess KC, Jones BH, Marquez B, Chen Y, Ord TS, Kamenetsky M,
Miyamoto C, Zippin JH, Kopf GS, Suarez SS, Levin LR, Williams
CJ, Buck J, Moss SB. The “soluble” adenylyl cyclase in sperm
mediates multiple signaling events required for fertilization. Dev
Cell. 2005;9(2):249 –259.
57. Conkright MD, Canettieri G, Screaton R, Guzman E, Miraglia L,
Hogenesch JB, Montminy M. TORCs: transducers of regulated
CREB activity. Mol Cell. 2003;12(2):413– 423.
58. Bittinger MA, McWhinnie E, Meltzer J, Iourgenko V, Latario B,
Liu X, Chen CH, Song C, Garza D, Labow M. Activation of cAMP
response element-mediated gene expression by regulated nuclear
transport of TORC proteins. Curr Biol. 2004;14(23):2156 –2161.
59. Kovacs KA, Steullet P, Steinmann M, Do KQ, Magistretti PJ, Halfon O, Cardinaux JR. TORC1 is a calcium- and cAMP-sensitive
coincidence detector involved in hippocampal long-term synaptic
plasticity. Proc Natl Acad Sci U S A. 2007;104(11):4700 – 4705.
60. Jefcoate CR, Lee J, Cherradi N, Takemori H, Duan H. cAMP
stimulation of StAR expression and cholesterol metabolism is modulated by co-expression of labile suppressors of transcription and
mRNA turnover. Mol Cell Endocrinol. 2011;336(1–2):53– 62.
61. Atwood BK, Lopez J, Wager-Miller J, Mackie K, Straiker A. Expression of G protein-coupled receptors and related proteins in
HEK293, AtT20, BV2, and N18 cell lines as revealed by microarray
analysis. BMC Genomics. 2011;12:14.
mend.endojournals.org
15
62. Mundell SJ, Benovic JL. Selective regulation of endogenous G protein-coupled receptors by arrestins in HEK293 cells. J Biol Chem.
2000;275(17):12900 –12908.
63. Iwata K, Luo J, Penn RB, Benovic JL. Bimodal regulation of the
human H1 histamine receptor by G protein-coupled receptor kinase
2. J Biol Chem. 2005;280(3):2197–2204.
64. Perez DM, Karnik SS. Multiple signaling states of G-protein-coupled receptors. Pharmacol Rev. 2005;57(2):147–161.
65. Otte K, Kranz H, Kober I, Thompson P, Hoefer M, Haubold B,
Remmel B, Voss H, Kaiser C, Albers M, Cheruvallath Z, Jackson D,
Casari G, Koegl M, Paabo S, Mous J, Kremoser C, Deuschle U.
Identification of farnesoid X receptor beta as a novel mammalian
nuclear receptor sensing lanosterol. Molecular and cellular biology.
2003;23(3):864 – 872.
66. Meng F, Han Y, Staloch D, Francis T, Stokes A, Francis H. The H4
histamine receptor agonist, clobenpropit, suppresses human cholangiocarcinoma progression by disruption of epithelial mesenchymal transition and tumor metastasis. Hepatology. 2011;54(5):
1718 –1728.
67. Eriks JC, van der Goot H, Sterk GJ, Timmerman H. Histamine
H2-receptor agonists. Synthesis, in vitro pharmacology, and qualitative structure-activity relationships of substituted 4- and 5-(2aminoethyl)thiazoles. J Med Chem. 1992;35(17):3239 –3246.
68. Shimamura T, Shiroishi M, Weyand S, Tsujimoto H, Winter G,
Katritch V, Abagyan R, Cherezov V, Liu W, Han GW, Kobayashi
T, Stevens RC, Iwata S. Structure of the human histamine H1 receptor complex with doxepin. Nature. 2011;475(7354):65–70.
69. Medina VA, Rivera ES. Histamine receptors and cancer pharmacology. Br J Pharmacol. 2010;161(4):755–767.
70. Venable JD, Cai H, Chai W, Dvorak CA, Grice CA, Jablonowski
JA, Shah CR, Kwok AK, Ly KS, Pio B, Wei J, Desai PJ, Jiang W,
Nguyen S, Ling P, Wilson SJ, Dunford PJ, Thurmond RL, Lovenberg TW, Karlsson L, Carruthers NI, Edwards JP. Preparation and
biological evaluation of indole, benzimidazole, and thienopyrrole
piperazine carboxamides: potent human histamine h(4) antagonists. J Med Chem. 2005;48(26):8289 – 8298.
71. Hageman J, Herrema H, Groen AK, Kuipers F. A role of the bile salt
receptor FXR in atherosclerosis. Arteriosclerosis, thrombosis, and
vascular biology. 2010;30(8):1519 –1528.
72. Pu J, Yuan A, Shan P, Gao E, Wang X, Wang Y, Lau WB, Koch W,
Ma XL, He B. Cardiomyocyte-expressed farnesoid-X-receptor is a
novel apoptosis mediator and contributes to myocardial ischaemia/
reperfusion injury. European heart journal. 2013;34(24):1834 –
1845.
73. Watanabe M, Horai Y, Houten SM, Morimoto K, Sugizaki T, Arita
E, Mataki C, Sato H, Tanigawara Y, Schoonjans K, Itoh H, Auwerx
J. Lowering bile acid pool size with a synthetic farnesoid X receptor
(FXR) agonist induces obesity and diabetes through reduced energy
expenditure. J Biol Chem. 2011;286(30):26913–26920.
74. Cipriani S, Mencarelli A, Palladino G, Fiorucci S. FXR activation
reverses insulin resistance and lipid abnormalities and protects
against liver steatosis in Zucker (fa/fa) obese rats. Journal of lipid
research. 2010;51(4):771–784.
75. Wang KY, Tanimoto A, Yamada S, Guo X, Ding Y, Watanabe T,
Watanabe T, Kohno K, Hirano K, Tsukada H, Sasaguri Y. Histamine regulation in glucose and lipid metabolism via histamine receptors: model for nonalcoholic steatohepatitis in mice. The American journal of pathology. 2010;177(2):713–723.
76. Revankar CM, Cimino DF, Sklar LA, Arterburn JB, Prossnitz ER.
A transmembrane intracellular estrogen receptor mediates rapid
cell signaling. Science. 2005;307(5715):1625–1630.
77. Burris TP, Montrose C, Houck KA, Osborne HE, Bocchinfuso WP,
Yaden BC, Cheng CC, Zink RW, Barr RJ, Hepler CD, Krishnan V,
Bullock HA, Burris LL, Galvin RJ, Bramlett K, Stayrook KR. The
hypolipidemic natural product guggulsterone is a promiscuous steroid receptor ligand. Mol Pharmacol. 2005;67(3):948 –954.
78. Mitro N, Vargas L, Romeo R, Koder A, Saez E. T0901317 is a
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
16
GW4064 modulates multiple GPCRs
potent PXR ligand: implications for the biology ascribed to LXR.
FEBS letters. 2007;581(9):1721–1726.
79. Blaya B, Nicolau-Galmes F, Jangi SM, Ortega-Martinez I, AlonsoTejerina E, Burgos-Bretones J, Perez-Yarza G, Asumendi A,
Mol Endocrinol
Boyano MD. Histamine and histamine receptor antagonists in cancer biology. Inflammation, allergy drug targets. 2010;9(3):146 –
157.
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 10 March 2014. at 23:56 For personal use only. No other uses without permission. . All rights reserved.
© Copyright 2026 ExpyDoc