SAMPLE SUBMISSION GUIDE Amplicon Sequencing Favourites Uni- and bidirectional amplicon sequencing with GS Junior Sending samples according to the requirements below helps us to do our job better and provides you best possible data quality! General Amplicon preparation requirements Amplicon length: 250 – 500 bp (including adaptors) Each PCR in sample pool has to be tagged by unique multiplex identifier (MID) For your convenience please find a list with 48 individual MID sequences for your successful primer design and primer ordering at the end of this document Please choose the following primer setup for each of your PCR samples: 1x forward primer A (= A-key primer) 5’‐CGTATCGCCTCCCTCGCGCCATCAG‐(MID)‐forward-specific-sequence-3’ 1x reverse primer B (= B-key primer) 5’‐CTATGCGCCTTGCCAGCCCGCTCAG‐(MID)‐reverse-specific-sequence-3’ Unidirectional sequencing For unidirectional sequencing a MID is needed only on one side of the PCR product (= the end of PCR that is to be sequenced - e.g. either select PCR A-side or PCR B-side (figure 1) e.g.: Sample 1 should have MID #1 on forward primer A-side or reverse primer B-side, sample 2 should have MID #2 on forward primer A-side or reverse primer B-side, etc. Do not mix the location of MID within one pool of PCR The sequencing direction of projects with unidirectional sequencing can be selected during the online ordering process (step 3) If you have already prepared PCR samples containing MID sequences on both ends, these samples can be also be sequenced unidirectional from primer A-side or primer B-side Adding a MID on both ends maintains flexibility for bidirectional sequencing at a later stage Figure 1 - MID only on one side of the amplicon (sufficient for unidirectional sequencing) Eurofins Genomics I Anzinger Str. 7a I 85560 Ebersberg I Germany I eurofinsgenomics.com I [email protected] I +49 8092 8289-0 Bidirectional sequencing For bidirectional sequencing a MID is needed on both sides of PCR product (figure 2) Depending on your individual sequencing needs, MID on forward-specific-sequence and reverse-specific-sequence primer (e.g. A-key primer or B-key primer) may have identical or different sequences Figure 2 - MID on both sides of the amplicon (mandatory for bidirectional sequencing) PCR pool requirements Please provide pooled PCR samples (1 tube per PCR pool) Pooling is recommended to be done with PCR fragments of about same length. Please note that shorter fragments often perform better in pools Please deliver the DNA solved in TRIS buffer / buffer from commercial DNA extraction kits Please use 1.5 – 2.0 ml safe-lock tubes for shipping Use the concentrations and volumes below for each PCR sample pool to be sequenced: Sample Type without gel purification with gel purification Minimum amount of DNA 500 ng – 1 µg 1 – 2 µg Concentration 10 – 20 ng/µl 20 – 40 ng/µl Volume > 25 µl > 25 µl If possible, please supply us with the 2-3 fold amount of PCR sample material. Please quantify the DNA concentration with fluorometric methods. Concentration determination by spectrometric methods (UV photometer) may deliver imprecise DNA concentration values. Eurofins Genomics I Anzinger Str. 7a I 85560 Ebersberg I Germany I eurofinsgenomics.com I [email protected] I +49 8092 8289-0 Sample Submission Delivery of sample material Correct sample labelling is in the responsibility of the customer Eurofins MWG Operon would recommend delivery on dry ice Please send your samples including a copy of your order confirmation from the online shop Please send your samples to: NGS - Laboratory Eurofins Genomics c/o Dr. Arman Tehrani – Dr. Elmar Schilling Anzinger Str. 7a 85560 Ebersberg Germany For Non-EU countries: Please follow the customs instructions, the customs documents must state - purified DNA, not harmful, not infectious, for research only. Delivery of additional information Complete primer sequences inclusive the specific primer sequences as well as a MID-tag list will have to be sent as FASTA file/Excel-file prior to start of the sequencing process to your sales representative or to the following Email-address: [email protected]. List of 48 individual MID sequences for bar-coded fusion primer: MID-01 MID-02 MID-03 MID-04 MID-05 MID-06 MID-07 MID-08 MID-10 MID-11 MID-13 MID-14 MID-15 MID-16 MID-17 MID-18 ACGAGTGCGT ACGCTCGACA AGACGCACTC AGCACTGTAG ATCAGACACG ATATCGCGAG CGTGTCTCTA CTCGCGTGTC TCTCTATGCG TGATACGTCT CATAGTAGTG CGAGAGATAC ATACGACGTA TCACGTACTA CGTCTAGTAC TCTACGTAGC MID-19 MID-20 MID-21 MID-22 MID-23 MID-24 MID-25 MID-26 MID-27 MID-28 MID-29 MID-30 MID-31 MID-32 MID-33 MID-34 TGTACTACTC ACGACTACAG CGTAGACTAG TACGAGTATG TACTCTCGTG TAGAGACGAG TCGTCGCTCG ACATACGCGT ACGCGAGTAT ACTACTATGT ACTGTACAGT AGACTATACT AGCGTCGTCT AGTACGCTAT ATAGAGTACT CACGCTACGT MID-35 MID-36 MID-37 MID-38 MID-39 MID-40 MID-41 MID-42 MID-43 MID-44 MID-45 MID-46 MID-47 MID-48 MID-49 MID-50 CAGTAGACGT CGACGTGACT TACACACACT TACACGTGAT TACAGATCGT TACGCTGTCT TAGTGTAGAT TCGATCACGT TCGCACTAGT TCTAGCGACT TCTATACTAT TGACGTATGT TGTGAGTAGT ACAGTATATA ACGCGATCGA ACTAGCAGTA (Sequence of 10 bases that have a sequence-error optimized design) More MID sequences are available if your experiment requires more than 48 unique MIDs. Eurofins Genomics I Anzinger Str. 7a I 85560 Ebersberg I Germany I eurofinsgenomics.com I [email protected] I +49 8092 8289-0
© Copyright 2026 ExpyDoc