Supplemental Materials Molecular Biology of the Cell Sadhu et al. Fluorescence normalized to no GFP control, log2 10 8 6 4 2 0 methionine -2 – + – + Met3-GFP Met5-GFP – + – + – + Met6-GFP Met10-GFP Met14-GFP Supplementary Figure S1: Fluorescence of different candidate reporter MET gene-GFP fusions. Fluorescence from methionine prototrophs carrying MET3-GFP, MET5-GFP, MET6GFP, MET10-GFP, MET14-GFP, or no GFP were assayed after growth overnight with or without methionine, by fluorescence microscopy (JRY9384, JRY9385, JRY9386, JRY9387, JRY9389, and JRY6331, respectively). Four technical replicates of at least 50 cells were queried from each strain and condition. GFP values were normalized to a control culture lacking GFP grown in the same growth medium, and were then log2 transformed. For some samples grown with methionine, GFP fluorescence measurements were marginally, and insignificantly, lower than in the control lacking GFP, leading to negative values after log2 transformation. Supplementary Figure S2: Spectral scan of a peptide from immunoprecipitated Met30-3xHA, showing Serine 47 was phosphorylated with an Ascore of 16.22. Supplementary Figure S3: Met30 Serine 71 was phosphorylated with an Ascore of 19.16. Supplementary Figure S4: Met30 Cysteine 95 appeared triply oxidized. Supplementary Figure S5: Met30 Serine 105 was phosphorylated with an Ascore of 15.03. Supplementary Figure S6: Met30 Cysteine 495 appeared triply oxidized. Supplementary Table S1: Peptides detected in Met30-HA immunoprecipitate Accession Met30-HA no-HA control spectral count coverage spectral count description coverage sp|P39014|MET30_YEAST 628 80.60% 0 0% F-box protein MET30 sp|P52286|SKP1_YEAST 350 63.90% 0 0% Suppressor of kinetochore protein 1 sp|Q12018|CDC53_YEAST 102 45.40% 0 0% Cell division control protein 53 sp|P0CH08|RL401_YEAST 17 17.20% 0 0% Ubiquitin-60S ribosomal protein L40 sp|P0CG63|UBI4P_YEAST 17 5.80% 0 0% Polyubiquitin sp|P0CH09|RL402_YEAST 17 17.20% 0 0% Ubiquitin-60S ribosomal protein L40 sp|Q08273|RBX1_YEAST 15 24.00% 0 0% RING-box protein HRT1 Spectral counts and coverage of all proteins that were detected at least 15 times in the MudPIT analysis of the Met30-3xHA immunoprecipitate, as well as for a mock immunoprecipitation. Ubi4 has perfect homology to a region of Rpl40; thus, peptides mapping to UBI4 mapped equally well to RPL40. Supplementary Table S2: Strains used in this study JRY # 9384 9385 9386 9387 9389 9356 9355 9357 9359 9360 9361 9391 9394 9395 9396 9469 9470 9508 9509 9472 9454 6330 6331 9510 9511 9512 description MET3-GFP::HIS3/MET3 met15Δ0/MET15 lys2Δ0/LYS2 ura3Δ0/ura3Δ0 his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 MET5-GFP::HIS3/MET3 met15Δ0/MET15 lys2Δ0/LYS2 ura3Δ0/ura3Δ0 his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 MET6-GFP::HIS3/MET3 met15Δ0/MET15 lys2Δ0/LYS2 ura3Δ0/ura3Δ0 his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 MET10-GFP::HIS3/MET3 met15Δ0/MET15 lys2Δ0/LYS2 ura3Δ0/ura3Δ0 his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 MET14-GFP::HIS3/MET3 met15Δ0/MET15 lys2Δ0/LYS2 ura3Δ0/ura3Δ0 his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 MET3-GFP::HIS3MX MATα met15Δ0 leu2Δ0 ura3Δ0 his3Δ1 MET3-GFP::HIS3MX MATa lys2Δ0 leu2Δ0 ura3Δ0 his3Δ1 met30-C95Y MET3-GFP::HIS3MX MATa lys2Δ0 leu2Δ0 ura3Δ0 his3Δ1 cho2-165Stop MET3-GFP::HIS3MX MATα met15Δ0 leu2Δ0 ura3Δ0 his3Δ1 cho2Δ::KanMX MET3-GFP::HIS3MX MATα met15Δ0 leu2Δ0 ura3Δ0 his3Δ1 cho2Δ::KanMX opi3Δ::KanMX MET3-GFP::HIS3MX MATα met15Δ0 leu2Δ0 ura3Δ0 his3Δ1 SAM1-G310D MET3-GFP::HIS3MX MATα met15Δ0 leu2Δ0 ura3Δ0 his3Δ1 SAM1-G250S MET3-GFP::HIS3MX MATα met15Δ0 leu2Δ0 ura3Δ0 his3Δ1 SAM1-G310D MET3-GFP::HIS3MX MATa lys2Δ0 leu2Δ0 ura3Δ0 his3Δ1 SAM2-C93Y MET3-GFP::HIS3MX MATa lys2Δ0 leu2Δ0 ura3Δ0 his3Δ1 JRY9508 [plasmid CEN-ARS-URA3 SAM1] JRY9508 [plasmid CEN-ARS-URA3 SAM1-G310D] sam1Δ::KanMX MET3-GFP::HIS3MX MATa lys2Δ0 leu2Δ0 ura3Δ0 his3Δ1 sam2Δ::KanMX MET3-GFP::HIS3MX MATa lys2Δ0 leu2Δ0 ura3Δ0 his3Δ1 JRY9391 [plasmid pRS316 (CEN-ARS-URA)] JRY9391 [plasmid CEN-ARS-URA3 SAM1] MATa met15Δ0 leu2Δ0 ura3Δ0 his3Δ1 (BY4741) MATα lys2Δ0 leu2Δ0 ura3Δ0 his3Δ1 (BY4742) JRY6330 [plasmid CEN-ARS-URA MET30-3xHA(204-ATCGTCA-210 -> CAGCAGC)] met30Δ::KanMX lys2Δ0 ura3Δ0 his3Δ1 leu2Δ0 MATα [plasmid CEN-ARS-URA MET30] met30Δ::KanMX lys2Δ0 ura3Δ0 his3Δ1 leu2Δ0 MATa [plasmid CEN-ARS-URA MET30(204-ATCGTCA-210 -> CAGCAGC)] Source this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study this study Jef Boeke Jef Boeke this study this study this study 9354 9490 9491 9492 9505 9494 9495 9497 9498 9477 9484 9485 9451 6369 JRY6330 [plasmid pJR3170 (CEN-ARS-URA MET30-3xHA)] met30Δ::KanMX lys2Δ0 ura3Δ0 his3Δ1 leu2Δ0 MATα [plasmid pJR3182 (CEN-ARS-URA MET30-3xHA)] met30Δ::KanMX ura3Δ0 his3Δ1 leu2Δ0 MATα [plasmid pJR3183 (CEN-ARS-URA MET30-C95A-3xHA)] met30Δ::KanMX lys2Δ0 ura3Δ0 his3Δ1 leu2Δ0 MATα [plasmid pJR3192 (CEN-ARS-URA MET30-C95D-3xHA)] met30Δ::KanMX lys2Δ0 ura3Δ0 his3Δ1 leu2Δ0 MATα [plasmid pJR3202 (CEN-ARS-URA MET30-C95Y-3xHA)] met30Δ::KanMX lys2Δ0 ura3Δ0 his3Δ1 leu2Δ0 MATa [plasmid pJR3185 (CEN-ARS-URA MET30-C455A-3xHA)] met30Δ::KanMX lys2Δ0 ura3Δ0 his3Δ1 leu2Δ0 MATa [plasmid pJR3195 (CEN-ARS-URA MET30-C455D-3xHA)] met30Δ::KanMX lys2Δ0 ura3Δ0 his3Δ1 leu2Δ0 MATα [plasmid pJR3197 (CEN-ARS-URA MET30-C95,455A-3xHA)] met30Δ::KanMX lys2Δ0 ura3Δ0 his3Δ1 leu2Δ0 MATα [plasmid pJR3193 (CEN-ARS-URA MET30-C95,455D-3xHA)] JRY6369 [plasmid pJR3182 (CEN-ARS-URA MET30-3xHA)] JRY6369 [plasmid pJR3197 (CEN-ARS-URA MET30-C95,455A-3xHA)] JRY6369 [plasmid pJR3193 (CEN-ARS-URA MET30-C95,455D-3xHA)] met30Δ::KanMX/MET30 met15Δ0/MET15 lys2Δ0/LYS2 ura3Δ0/ura3Δ0 his3Δ1/his3Δ1 leu2Δ0/leu2Δ0 MATα/MATa MATa met15Δ0 ura3Δ0 (BY4718) this study this study this study this study this study this study this study this study this study this study this study this study this study Jef Boeke Supplementary Table S3: Plasmids used in this study pJR # 3170 3182 3183 3192 3202 3185 3195 3197 3193 backbone pBY011D123 pBY011D123 pBY011D123 pBY011D123 pBY011D123 pBY011D123 pBY011D123 pBY011D123 pBY011D123 insert MET30-3xHA* MET30-3xHA MET30-C95A-3xHA MET30-C95D-3xHA MET30-C95Y-3xHA MET30-C455A-3xHA MET30-C455D-3xHA MET30-C95,455A3xHA MET30-C95,455D3xHA *pJR3170 was later found to have an S382L substitution, which had no discernable effect. pJR3182 is an otherwise identical plasmid lacking this substitution. Supplementary Table S4: Oligonucleotides used in this study target ACT1 sequence GGCATCATACCTTCTACAACGAATTG GTTTTGTCCTTGTACTCTTCCGGTAG MET3 TTCTTGCAATTCGGTGGTGG GACTCTAGCTGAATATCGGC
© Copyright 2026 ExpyDoc