SUPPLEMENTARY DATA Supplemental Table 1: List of primers used in this work. Restriction sites are given in italic. Primer Name P16woS_F 5´- 3´Sequence catcagttttaaagcacagagTgctcaatgttcttccaatatcg P16woS_R cgatattggaagaacattgagcActctgtgctttaaaactgatg P16_F_HindIII ttttAAGCTTTGGAACCATCTTTTGGGTTCC P16_R_NheI aaaaGCTAGCCCACGCCGTCGTAGATGAG LexA_F aaaaCCGGTCTTGCATCCAGCTGGGC LexA_R Atrboh_F_Bam_F aaaaGAATTCCCCGGGTCTAGAtttGGCTAGAG TCGACTAGCTTC tttggatccatgaaaccgttctcaaagaac Atrboh_F_Xho_R tttctcgaggaaatgctccttgtgaaattc CIPK5_F tttactagtatggaggaagaacggcgag CIPK5_R aaacccgggacaatcctcggaagaagtgttattattatc mutagenesis of P16 to delete SalI site reverse primer for mutagenesis of P16 to delete SalI site amplification of P16 promoter amplification of P16 promoter amplification of LexA amplification of LexA amplification of RbohF amplification of RbohF amplification of CIPK5 amplification of CIPK5 Supplemental Table 2: List of vectors generated in this work Indicated are the plasmid names, reporter genes, epitope tags, orientation of MCS, vector backbone and antibiotic resistance in bacteria and plants. Amp, Ampicillin; HA, hemagglutinin epitope tag, Kan, Kanamycin; Bar, Basta, Hyg, Hygromycin resistances; MCS, multiple cloning site. No 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 P16ΔS:sXVE:GUS (Fluorescent / tag GUS P16ΔS N of tag pUC Selection bacteria Amp P16ΔS:sXVE:GFPC GFP P16ΔS N of tag pUC Amp P16ΔS:sXVE:GFPN GFP P16ΔS C of tag pUC Amp none P16ΔS:sXVE:mCherryC mCherry P16ΔS N of tag pUC Amp none P16ΔS:sXVE:mCherryN mCherry P16ΔS C of tag pUC Amp none P16ΔS:sXVE:StrepIIC StrepII P16ΔS N of tag pUC Amp none P16ΔS:sXVE:StrepIIN StrepII P16ΔS C of tag pUC Amp none P16ΔS:sXVE:HAC HA P16ΔS N of tag pUC Amp none none Name Promoter MCS Vector Selection plant none none P16ΔS:sXVE:HAN HA P16ΔS C of tag pUC Amp SUPERR:sXVE:GUS GUS N of tag pUC Amp none SUPERR:sXVE:GFPC GFP SUPERR SUPERR N of tag pUC Amp none SUPERR:sXVE:GFPN SUPERR:sXVE:mCherryC GFP mCherry C of tag N of tag pUC pUC Amp Amp none none SUPERR:sXVE:mCherryN mCherry SUPERR C of tag pUC Amp none SUPERR:sXVE:StrepIIC StrepII SUPERR N of tag pUC Amp none SUPERR:sXVE:StrepIIN StrepII SUPERR C of tag pUC Amp none SUPERR:sXVE:HAC HA SUPERR N of tag pUC Amp none SUPERR SUPERR SUPERR:sXVE:HAN HA SUPERR C of tag pUC Amp none P16ΔS:sXVE:GUS:Bar GUS P16ΔS N of tag pGPTVII.Bar Kan Bar P16ΔS:sXVE:GFPC:Bar GFP P16ΔS N of tag pGPTVII.Bar Kan Bar P16ΔS:sXVE:GFPN:Bar GFP P16ΔS C of tag pGPTVII.Bar Kan Bar P16ΔS:sXVE:GFPC:Kan GFP P16ΔS N of tag pGPTVII.Kan Kan Kan P16ΔS:sXVE:GFPN:Kan GFP P16ΔS C of tag pGPTVII.Kan Kan Kan P16ΔS:sXVE:GFPC:Hyg GFP P16ΔS N of tag pGPTVII.Hyg Kan Hyg P16ΔS:sXVE:GFPN:Hyg GFP P16ΔS C of tag pGPTVII.Hyg Kan Hyg P16ΔS:sXVE:mCherryC:Bar mCherry P16ΔS N of tag pGPTVII.Bar Kan Bar P16ΔS:sXVE:mCherryN:Bar mCherry P16ΔS C of tag pGPTVII.Bar Kan Bar P16ΔS:sXVE:StrepIIC:Bar StrepII P16ΔS N of tag pGPTVII.Bar Kan Bar P16ΔS:sXVE:StrepIIN:Bar StrepII P16ΔS C of tag pGPTVII.Bar Kan Bar P16ΔS:sXVE:HAC:Bar HA P16ΔS N of tag pGPTVII.Bar Kan Bar P16ΔS:sXVE:HAN:Bar HA P16ΔS C of tag pGPTVII Kan Bar SUPERR:sXVE:GUS:Bar GUS SUPERR N of tag pGPTVII.Bar Kan Bar SUPERR:sXVE:GFPC:Bar GFP SUPERR N of tag pGPTVII.Bar Kan Bar SUPERR:sXVE:GFPN:Bar GFP SUPERR C of tag pGPTVII.Bar Kan Bar SUPERR:sXVE:GFPC:Kan GFP SUPERR N of tag pGPTVII.Kan Kan Kan SUPERR:sXVE:GFPN:Kan GFP SUPERR C of tag pGPTVII.Kan Kan Kan SUPERR:sXVE:GFPC:Hyg GFP SUPERR N of tag pGPTVII.Hyg Kan Hyg SUPERR:sXVE:GFPN:Hyg GFP SUPERR C of tag pGPTVII.Hyg Kan Hyg SUPERR:sXVE:mCherryC:Bar mCherry SUPERR N of tag pGPTVII.Bar Kan Bar SUPERR:sXVE:mCherryN:Bar mCherry SUPERR C of tag pGPTVII.Bar Kan Bar SUPERR:sXVE:StrepIIC:Bar StrepII SUPERR N of tag pGPTVII.Bar Kan Bar SUPERR:sXVE:StrepIIN:Bar StrepII SUPERR C of tag pGPTVII.Bar Kan Bar SUPERR:sXVE:HAC:Bar HA SUPERR N of tag pGPTVII.Bar Kan Bar SUPERR:sXVE:HAN:Bar HA SUPERR C of tag pGPTVII.Bar Kan Bar UBQ10:sXVE:GUS:Bar GUS UBQ10 N of tag pGPTVII.Bar Kan Bar Bar UBQ10:sXVE:GFPC:Bar GFP UBQ10 N of tag pGPTVII.Bar Kan UBQ10:sXVE:GFPN:Bar GFP UBQ10 C of tag pGPTVII.Bar Kan Bar UBQ10:sXVE:GFPC:Kan GFP UBQ10 N of tag pGPTVII.Kan Kan Kan UBQ10:sXVE:GFPN:Kan GFP UBQ10 C of tag pGPTVII.Kan Kan Kan UBQ10:sXVE:GFPC:Hyg GFP UBQ10 N of tag pGPTVII.Hyg Kan Hyg 51 52 53 54 55 56 57 UBQ10:sXVE:GFPN:Hyg GFP UBQ10 C of tag pGPTVII.Hyg Kan Hyg UBQ10:sXVE:mCherryC:Bar mCherry UBQ10 N of tag pGPTVII.Bar Kan Bar UBQ10:sXVE:mCherryN:Bar mCherry UBQ10 C of tag pGPTVII.Bar Kan Bar UBQ10:sXVE:StrepIIC:Bar StrepII UBQ10 N of tag pGPTVII.Bar Kan Bar UBQ10:sXVE:StrepIIN:Bar StrepII UBQ10 C of tag pGPTVII.Bar Kan Bar UBQ10:sXVE:HAC:Bar HA UBQ10 N of tag pGPTVII.Bar Kan Bar UBQ10:sXVE:HAN:Bar HA UBQ10 C of tag pGPTVII.Bar Kan Bar Supplemental Table 3. Sequence data from this article can be found in AGI locus identifier and on NCBI Gene CBL3 CIPK5 RBOHF RPL37aC UBQ10 promoter Accession number AT4G26570.2 AT5G10930 AT1G64060 AT3G60245 HQ693235 Supplemental Table 4. Accession numbers of the expression cassettes developed in this work, can be found on NCBI Name of construct P16ΔS:sXVE:GFPC P16ΔS:sXVE:GFPN P16ΔS:sXVE:mCherryC P16ΔS:sXVE:mCherryN P16ΔS:sXVE:GUS P16ΔS:sXVE:StrepIIC P16ΔS:sXVE:StrepIIN P16ΔS:sXVE:HAC P16ΔS:sXVE:HAN SUPERR:sXVE:GFPC SUPERR:sXVE:GFPN SUPERR:sXVE:mCherryC SUPERR:sXVE:mCherryN SUPERR:sXVE:GUS SUPERR:sXVE:StrepIIC SUPERR:sXVE:StrepIIN SUPERR:sXVE:HAC SUPERR:sXVE:HAN Accession number KC294588 KC294589 KC294590 KC294591 KC294592 KC294593 KC294594 KC294595 KC294596 KC294597 KC294598 KC294599 KC294600 KC294601 KC294602 KC294603 KC294604 KC294605 Supplemental Figure 1. β-estradiol concentration series for mCherry induction. (A) Leaves of N. benthamiana, transformed with P16ΔS:sXVE:mCherryC and SUPERR:sXVE:mCherryC, treated with β-estradiol concentrations from 0.01 µM to 100 µM to induce expression. Controls were mock treated with 0.1 % ethanol. (B) Western blots and immuno-detection with a RFP specific antibody. (C) Coomassie Brilliant Blue stained membranes to confirm equal loading of proteins, also from Figure 2. Supplemental Figure 2. Time course of induced mCherry expression. (A) Leaves of N. benthamiana, transiently transformed with P16ΔS:sXVE:mCherryC and treated with 100 µM β-estradiol or mock treated with 0.1% ethanol, were analyzed over a time course of five days. (B) The same procedure as in (A) but with SUPERR:sXVE:mCherryC infiltrated leaves. (C) A constitutive 35S:mCherry construct was transformed as a control and treated like samples in A and B. (D) Western blots and immuno-detection with an RFP specific antibody. dpin = days post induction, dpi = days post infiltration Supplemental Figure 3. Induced expression of mCherry in transiently transformed Arabidopsis leaf mesophyll protoplasts. Arabidopsis mesophyll protoplasts were transiently transformed with inducible constructs and a constitutive control respectively, treated with 5 µM β-estradiol and analyzed 15 hours after induction. (A) P16ΔS:sXVE:mCherryC:pUC, (B) SUPERR:sXVE:mCherryC:pUC or (C) constitutive active control 35S:GFP:pUC. Images of single protoplasts (scale 7.5 µm ) and overview (scale = 50 µm). Supplemental Figure 4. Bright field images corresponding to in Figure 5A and B shown fluorescent images of β-estradiol or mock treated protoplasts transformed with P16ΔS:sXVE:GFPC:pUC and SUPERR:sXVE:GFPC:pUC constructs. Supplemental Figure 5. P16ΔS:GUS and SUPERR:GUS expression in stably transformed Arabidopsis plants. (A) GUS staining of T2 Arabidopsis plants, transformed with P16ΔS:GUS. The P16ΔS promoter is mainly active in vascular tissue of leaves and flowers, in pollen and in growing root tips. (B) GUS staining of T2 Arabidopsis plants, transformed with SUPERR:GUS. SUPERR promoter is active in all parts of the plant but highly abundant in root tissue. Supplemental Figure 6. Maps of inducible expression cassettes inserted into pGPTVII backbones. Expression of the optimized inducible cassette is driven by UBQ10. Sequence of the sXVE fusion protein is followed by a 3’UTR, pea rbcS E9 and LexA operator sequence. The minimal -46 35S promoter drives target gene expression. The transcription is stopped by the Nos-terminator. Plasmids containing GFP, mCherry, GUS, StrepII or HA tag are available. Depending on the orientation of the reporter gene or tag the multiple cloning sites in the plasmids are slightly different. Restriction sites flanking the promoter, the expression cassette and the Nos-terminator allow convenient exchange of all elements. Supplemental Figure 7. Expression of mCherry driven by UBQ10 promoter in stably transformed Arabidopsis plants. (A) Seven day old seedlings were transferred to media containing 5 µM β-estradiol and induced for 24 hours. Images were taken from cotyledones and roots. (B) Images of leaves from 21 day old plants sprayed with 100 µM β-estradiol and induced for 48 hours. (C) Images of leaves and a petal from 42 day old plants sprayed with 100 µM β-estradiol and induced for 48 hours.
© Copyright 2026 ExpyDoc