Recent findings from NGS studies in eye diseases Dr.P.Sundaresan Senior Scientist Aravind Medical Research Foundation Aravind Eye Hospital Madurai NGS conference-Genotypic-Bangalroe-11th Sep.2014 • 285 million people • USA- direct and indirect costs associated with adult visual disorders is $35.4 billion • Genetic factors play a significant role in all common ocular diseases. 547 ocular genes 25,000 genes Ocular diseases/leading cause of blindness worldwide. • Age-related cataract - results from clouding of the lens • Age-related macular degeneration leads to loss of central vision as a result photoreceptor cell death. • central corneal thickness (CCT) in. For instance, a thinner CCT is a risk factor for primary open angle glaucoma (POAG) and is also associated with keratoconus (KC) • Diabetic retinopathy (DR) is the most common microvascular complication of types 1 and 2 diabetes mellitus • Fuchs endothelial corneal dystrophy (FECD) is characterized by bilateral, progressive loss of corneal endothelial cells and thickening of Descemet’s membrane. • Primary Open Angle Glaucoma : Glaucoma refers to a heterogeneous group of disorders that are characterized by progressive loss of retinal ganglion cells and their axons that produces characteristic glaucomatousoptic neuropathy. • Primary angle closure glaucoma (PACG) is characterized by obstruction of the iridocorneal angle by the iris, which leads to impaired aqueous humor outflow and increased IOP. • Leber hereditary optic neuropathy (LHON) is a mitochondrial-mediated, maternally inherited disease that leads to degeneration of retinal ganglion cells and loss of central vision in early life. • Keratoconus (KC) is a degenerative corneal disorder characterized by localized thinning and protrusion of the corneal stroma. • Leber congenital amaurosis (LCA) is an autosomal recessive disorder that results from dysfunction and degeneration of photoreceptors. • The Human Genome Project -identified and mapped the 20 000–25 000 human genes • SNPs can be used as genetic markers in association studies. • To date the majority of large-scale genetics studies have used somewhere between 500 000 and 2 500 000 SNPs genotyped on high-throughput genotyping arrays. • Genome-wide association studies (GWAS) are designed to investigate the associations between SNPs and traits or diseases by comparing the frequency of alleles of a group of people with a particular disease (cases) to that of another group without that disease (controls). • In recent years, there has been a dramatic increase in gene discovery for ocular diseases, driven by large-scale genomewide association studies (GWASs), powerful meta-analyses, and next-generation sequencing technologies (eg, wholeexome sequencing). • Gene discovery has also fueled translational research geared toward development of gene-based screening tests and targeted gene therapies. The output of a GWAS can be displayed in a figure, referred to as a Manhattan plot KEY POINTS • Genome-wide association studies have shed considerable insight into the genetic mechanisms of eye disease. • Recently seven novel genes have been found to be associated with age- related macular degeneration and over 20 genes have been implicated in the development of myopia or refractive error. • A genome-wide association study of primary angle closure glaucoma identified significant associations at three separate regions A map of human genome variation from population-scale sequencing • Nature Volume: 467, Pages: 1061–1073 (28 October 2010) • The 1000 Genomes Project aims to provide a deep characterization of human genome sequence variation as a foundation for investigating the relationship between genotype and phenotype. Here we present results of the pilot phase of the project, designed to develop and compare different strategies for genome-wide sequencing with high-throughput platforms. We undertook three projects: low-coverage whole-genome sequencing of 179 individuals from four populations; highcoverage sequencing of two mother–father–child trios; and exon-targeted sequencing of 697 individuals from seven populations. We describe the location, allele frequency and local haplotype structure of approximately 15 million single nucleotide polymorphisms, 1 million short insertions and deletions, and 20,000 structural variants, most of which were previously undescribed. We show that, because we have catalogued the vast majority of common variation, over 95% of the currently accessible variants found in any individual are present in this data set. On average, each person is found to carry approximately 250 to 300 loss-of-function variants in annotated genes and 50 to 100 variants previously implicated in inherited disorders. We demonstrate how these results can be used to inform association and functional studies. From the two trios, we directly estimate the rate of de novo germline base substitution mutations to be approximately 10−8 per base pair per generation. We explore the data with regard to signatures of natural selection, and identify a marked reduction of genetic variation in the neighbourhood of genes, due to selection at linked sites. These methods and public data will support the next phase of human genetic research. Genetics of Eye diseases Single gene diseases Congenital cataract, Albinism , Corneal dystrophies Complex gene diseases Diabetic Retinopathy, Age related macular degeneration and cataract, Leber’s congenital amaurosis, Glaucoma, Pseudo exfoliation syndrome, Microphthalmia, Anophthalmia , Coloboma , Keratoconus Inheritance of cataract gene Mitochondrial disease Leber’s hereditary optic neuropathy (LHON) Albinism family Genetics studies on various eye diseases Phenotype Gene ---------------------------------------------------------------------------------------------------------------Aniridia - PAX6 CRYAA, CRYAB, CRYBA1CRYBA4, Cataract CRYBB1, CRYBB2, CRYGC, CRYGD, CRYGS, GJA3, GJA8, BFSP1 and HSF4. Primary Open Angle Glaucoma - MYOC, OPTN, WDR36 Congenital Glaucoma - CYP1B1 Exfoliation glaucoma - LOXL1 Biomarker study on Glaucoma Congenital Hereditary Endothelial Dystrophy - SLCA411 Fush’s Dystsrophy - COLA2 Diabetic Retinopathy - VEGF, PEDF, eNOS, iNOS, HTRA1, TNF RAGE, ALR2,ERO Oculocutaneous and Ocular Albinism - TYR, P, MC1R , TYRP1, MATP, GPCR143 BPES FOXL2 Retinoschisis - RS1 FEVR FZD4 LCA - CRX, RPE65, LHON - MCA – GDR6 RP - RPE65 Duane Syndrome - SALL4 Congenital Rubella Syndrome E2 Disease Gene No.of variations identified Aniridia Primary open angle glaucoma (POAG) PAX6 MYOC OPTN OPTC CYP1B1 CYP1B1 GJA3 GJA8 EPHA2 ARMS2 HTRA1 GDF3 GDF6 TYR P MC1R TYRP1 MATP GPR143 14 9 1 4 3 12 2 2 3 2 2 1 2 20 4 7 1 3 1 FOXL2 VEGF eNOS PEDF RAGE CFH HTRA1 ARMS2 ALR2/AKRIBI EDN1 ICAM-1 HFE EPO ND1 ND4 ND6 RPE65 RS1 FZD4 CFH SLC4A11 COL8A2 SLC4A11 VSX1 LOXL1 12 4 1 4 3 2 1 1 3 1 1 0 1 0 2 1 2 10 3 1 17 5 5 4 2 Total 179 Congenital glaucoma Congenitaland cataract Age related cataract Microphthalmia,Anaphthalmia,Coloboma (MAC) Oculocutaneous Albinism Ocular Albinism Blepharophimosis Ptosis Epicanthus inversus Syndrome Diabetic retinopathy (DR) Leber's hereditary optic neuropathy (LHON) Leber's congenital amaurosis (LCA) X-linked retinoschisis Familial exudative vitreoretinopathy Age related macular degeneration (AMD) Congenital hereditary endothelial dystrophy (CHED) Fuchs endothelial corneal dystrophy (FECD) Keratoconus Pseudoexfoliation Indian Genetic Disease Database • Eye Disorders • (www.igdd.iicb.res.in). 1. Collect sample 2. Fragment genomic DNA 3. Capture target sequences 4. Elute target-enriched 5. Perform next sample generation sequencing TACATTTGGGAAAAGTAAATTTGCTGAAAATAATCCCGGT AAGAAAGAAACACTTTTCATGTAATTAGCTTTTTTACATC AAACTTCAGAACCCAAAGTCATTGAGAATATTAGGGATCA CAGAACCACATGAGTCAGAATCATCAGAATATCCCACCAA AGGAGAAGGAAGGAGCAGAGGATTCAAAAGGAAATGGAAT GATGAATATGAAGAAATGTCAGAAATGAAAGAAGGGAAAG GAAATTGAATTCGATGAAATAAATGATACTTGCTTATCTG ... ... ~10 million reads 6. Align reads to reference sequence 16 fold coverage Next Generation Sequencing Challenges Highlight the use of NGS technology the problem, choice of technology, how the technology helped Genetic Basis for Ocular Health and Disease? Refractive Error Corneal Disorders • Anterior Segment Dysgenesis • Corneal Dystrophies Lens • Congenital Cataract •Age related cataract •Subluxation/Dislocation Glaucoma • PCG •JOAG •PDS/PG •PXF •POAG •NTG •CCT Concomitant and Non-Concomitant Strabismus Vitreous •Stickler •Wagner •FEVR Retinal Degeneration • Retinal Dystrophy •Macular Dystrophy •AMD Optic Nerve Degeneration • Optic Atrophy •LHON Phakomatosis • NF1/2 •Tuberous Sclerosis •VHL SLC4A11 A887P R869C L873P Q836X R755W, R755Q P773L V658V R605X GC box N553N C386R C218KfsX49 A269V K118 TfsX11 R125C, R125H A135A R158PfsX3 A160T R161R S213S Congenital Hereditary Endothelial Dystrophy 20p13 1 891 aa SLC4A11 100 KDa Mutations in sodium-borate cotransporter SLC4A11 cause recessive congenital hereditary endothelial dystrophy (CHED2). *Vithana EN, *Morgan P, *Sundaresan P, Ebenezer ND, Tan DT, Mohamed D, Anand S, Khine KO, Venkataraman D, Yong VH, Salto-Tellez M, Venkatraman A, Guo K, Hemadevi B, Srinivasan M, Prajna V, Khine M, Casey JR, Inglehearn CF, Aung T. Nature Genetics. 2006 Jul;38(7):755-7. * These authors contributed equally to this work Genetic loci linked to glaucoma Chromosomal GenBank Locus location OMIM no. Gene accession no. Reference ____________________________________________________________________________________________________ GLC1A (JOAG1) 1q 21-31 137750 Myocilin NM 000261 GLC1B GLC1C GLC1D GLC1E GLC1F GLC1G GLC1H 606689 601682 602429 602432 603383 609887 611276 Optineurin WDR36 - NM 021980 NM 139281 - Stoilova et al. 1996 Wirtz et al. 1997 Trifan et al. 1998 Sarfarazi et al. 1998 Wirtz et al. 1999 Monemi et al. 2005 Suriyapperuma et al. 2007 GLC1I 15q11-13 609745 GLC1J (JOAG2) 9q22 608695 - - Allingham et al. 2005 Wiggs et al. 2004 GLC1K (JOAG3) 20p12 608696 - - Wiggs et al. 2004 GLC1L (JOAG4) 3p21-22 137750 GLC1M (JOAG5) 5q22.1-q32 610535 GLC1N (JOAG6) 15q22-q24 61274 19q12 17q25.1-17q25.3 - 14q11.1-14q11.2 - 14q21.1-q21.3 17p13 10p12.33-p12.1 - 2q33.1-q33.3 2p14 2p15-16 1p 32 - - - - 2cen-q31 3q 21-24 8p 23 10p 15-14 7q 35-q36 5q 22.1 14q11-q13 10q 22 - - - - - - - - - - - - Sheffield et al. 1993 Baird et al. 2005 Pang et al. 2006 Wang et al. 2006b Wiggs et al. 2000 Wiggs et al. 2000 Wiggs et al. 2000 Wiggs et al. 2000 Wiggs et al. 2000 Nemesure et al. 2003 Nemesure et al. 2003 Wiggs et al. 2000 Lin et al. 2008 Charlesworth et al. 2005 Charlesworth et al. 2005 Genes reported to be associated with POAG • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • Gene symbol AGTR2 APOE IL1A EDNRA GSTM1 IGF2 IL1B MTHFR NOS3 NPPA OCLM OLFM2 OPA1 TAP1 TNF TP53 OPTC CYP2D6 PON1 CDH-1 LMX1B ANP P21 HSPA1A TLR4 CYP46A1 PAI-1 ADRB1 ADRB2 Gene name OMIM no. Angiotensin II receptor, type 2 300034 Apolipoprotein E 107741 Interluekin 1 alpha 147760 Endothelin receptor, type A 131243 Glutathione S-transferase, mu-1 138350 Insulin-like growth factor II 147470 Interluekin 1 beta 147720 5,10-methylenetetra-hydrofolate reductase Nitric oxide synthase 3 163729 Natriuretic peptide precursor A 108780 1p36.2 Oculomedin 604301 Olfactomedin 2 Optic atrophy 1 605290 Transporter, ATP-binding cassette, major 1170260 6p21.3 histocompatibility complex, Tumour necrosis factor 191160 Tumour protein p53 191170 Opticin 605127 Cytochrome P450, Subfamily IID, Polypeptide 6 Paraoxonase 1 168820 Cadherin 1 192090 Lim Homeobox Transcription Factor 1 602575 9q34.1 Atrial natriuretic polypeptide 108780 P21 116899 Heat shock 70 kDa protein 1A 140550 Toll-like receptor 4 603030 Cytochrome P450, Family 46, Subfamily A, 604087 14q32.1 Polypeptide 1 plasminogen activator inhibitor-1 173360 beta-adrenergic receptors 1 109630 beta-adrenergic receptors 2 109690 Chromosomal location Xq22-q23 19q13.2 2q14 4q31.2 1p13.3 11p15.5 2q14 607093 1p36.3 7q36 Tunny et al. 1996 1q31.1 19p13.2 3q28-q29 Lin et al. 2004 Reference Hashizume et al. 2005 Copin et al. 2002 Wang et al. 2006a Ishikawa et al. 2005 Juronen et al. 2000 Tsai et al. 2003 Lin et al. 2003b Junemann et al. 2005 Tunny et al. 1998 6p21.3 17p13.1 1q32.1 124030 22q13.1 Lin et al. 2003a Lin et al. 2002 Acharya et al. 2007 Yang et al. 2009 7q21.3 16q22.1 Park et al. 2009 1p36.2 6p21.2 6p21.3 9q32-q33 Fourgeux et al. 2009 Inagaki et al. 2006a Lin et al. 2006 7q21.3-q22 10q24-q26 5q32-q34 Mossbock et al. 2008 Inagaki et al. 2006b Inagaki et al. 2006b Fujiwara et al. 2003 Funayama et al. 2006 Aung et al. 2002 Tunny et al. 1996 Tsai et al. 2004 Tosaka et al. 2007 Shibuya et al. 2008 Pathways involved in pathogenesis of POAG Pedigree of the recruited family Molecular Genetics of Globe Anomalies in Indian Population BACKGROUND MAC: ETIOLOGY • Complex aetiology with chromosomal, monogenic and environmental causes identified • Diverse patterns of genetic inheritance and variable severity due to genetic heterogeneity of ocular malformations • Of the large number of genes (> 65), SOX2, OTX2, RAX, PAX6, CHX10, STRA6, candidate genes GDF3 and GDF6 are important MICROPHTHALMIA AND ANOPHTHALMIA CLUSTER FROM BIHAR A cluster of ano/micro has been reported from a small area of Bihar in >45 babies in the year 2009-2010 MAC: Prevalence Anophthalmia and Microphthalmia combined : 30 in 100,000 population Microphthalmia: 11 % of blind children Coloboma: 3.2-11.2 % of blind children Madhya Pradesh 18.80 % Tamilnadu 20.60 % Karnataka 28.70 % Andhrapradesh 18 % North East 30.60 % Delhi 27.40 % Maharashtra 35.00 % Uttar Pradesh 33 % PURPOSE To find out the spectrum of genetic variations in candidate genes in patients with microphthalmia, anophthalmia and coloboma (MAC) in Indian cohorts METHODOLOGY STUDY SUBJECTS MAC patients from South Indian cohort clinically diagnosed at Aravind eye hospital , Madurai and patients from Bihar state were recruited for the study Total number of clinically well diagnosed MAC cases = 120 (25 from Bihar state and 95 from South India) Total number of family members = 200 (including both Bihar and South Indian cohorts) Total number of healthy control = 100 METHODOLOGY 1. TARGETED RE-SEQUENCING 9 genes screened by targeted re-sequencing in 56 samples Steps in targeted re-sequencing: Capture specific regions of interest PCR amplification Template preparation Sequencing and imaging By Illumina MiSeq Data analysis 2. SANGER SEQUENCING 5 genes (SOX2, OTX2, PAX6, RAX & ABCB6 ) were screened by Sanger sequencing in 64 MAC samples 1. TARGETED RE-SEQUENCING Custom Target Enrichment and multiplex sequencing of 9 genes (SOX2, OTX2, CRYBA4, VSX2, FOXE3, GDF3, BMP4, STRA6 and GDF6) for 56 DNA samples Custom amplicon seq. on Illumina MiSeq platform 2 μg of purified genomic DNA Total number of primer probes designed to amplify targeted regions (9 genes) = 181(100% coverage) Library Preparation: Amplicon Seq. on MiSeq Bar-coded samples Paired end Seq. Analysis Pipeline Quality Check & Filter Alignment Variant Calling Variant Annotation Quality Check and Filter Average Q30 score was used as a cutoff to remove low quality bases Alignment The filtered reads were aligned to the reference genome (GRCh37/hg19) using BWA program Variant Calling Samtools mpileup program The variants with quality score >= 50 and read depth of at least 5 were taken further for annotation Annotation The variants found in the sample were annotated using inhouse pipeline (VariMAT) The variants found were compared with various databases including OncoMD (www.scigenom.com), OMIM, ClinVar (http://www.ncbi.nlm.nih.gov/clinvar) and SNPedia for identifying clinically relevant variants Targeted re-sequencing: List of variations Gene Amino # of Acid sample change Change Variant Class Phenotype RE- micro with cyst, LEp.G289D Missense normal VSX2 1 G>A STRA6 1 A>C STRA6 2 A>T STRA6 1 T>C p.L645R Missense RE- clinical anop, LE- micro 1.Micro & ON coloboma 2. p.L152M Missense Micro & CR coloboma Missense p.Y374C BE- Microphthalmos CRYBA4 2 T>A p.F25L GDF6 1 C>T OTX2 1 Missense BE- microphthalmos p.A242T Missense Clinical anophthalmos Frame Ins C shift Insertion BE- anophthalmos 2. SANGER SEQUENCING Identification of Mutations in SOX2, OTX2, RAX, PAX6 & ABCB6 64 MAC samples (20 from Bihar and 44from South India) were screened for mutations in SOX2, OTX2, RAX, PAX6 and ABCB6 genes DNA isolation Direct sequencing ClustalW PCR Blast Functional analysis of ABCB6 mutation Sanger sequencing: List of variations S.N. 1 Gene RAX Location Exon-2 2 OTX2 Exon-3 3 OTX2 Exon-3 ABCB6 Exon1 PAX6 Intron 5 c.141+4 4 5 Type of variation Novel Homozygous subs p. Arg 179 Trp Novel Compound heterozygous mutation p. Gln104 X, p. Gln106 His Novel heterozygous frame shift Mutation (deletion) p. Thr186 Fs Novel Heterozygous Mutation (subs) p. Ala 57 Thr heterozygous substitution Splicing error Phenotype Bilateral anophthalmos RE :Micro. with irregular pupil RE: anop., LE: microphthalmos coloboma Lens coloboma & aniridia PolyPhen and SIFT score for missense mutations Gene Mutation PolyPhen SIFT RAX p.R179W PROBABLY DAMAGING (1.00) AFFECT PROTEIN FUNCTION (0.00) OTX2 p.Q106H PROBABLY DAMAGING (0.970) AFFECT PROTEIN FUNCTION (0.01) ABCB6 p.A57T BENIGN (0.001) AFFECT PROTEIN FUNCTION (0.00) VSX2 p.G289D BENIGN (0.040) TOLERATED (0.59) STRA6 p.L645R PROBABLY DAMAGING (0.999) AFFECT PROTEIN FUNCTION (0.00) STRA6 p.Y374C PROBABLY DAMAGING (0.999) AFFECT PROTEIN FUNCTION (0.00) GDF6 p.A242T BENIGN (0.047) TOLERATED (0.94) Novel p. Ala57Thr Mutation in ABCB6 Morpholino Knockdown of abcb6 in Zebrafish and Rescue Studies The abcb6 transcripts are expressed in the developing CNS tissue, including that of the eyes, suggesting a function for abcb6 in eye development To test the hypothesis that disruption of the normal function of ABCB6 can cause coloboma, zebrafish model was developed to study eye development MO knockdown by using two specific antisense oligonucleotides targeting.. abcb6 ATG-inhibition (5’-CACAGAAACTCTTCATCTCCACCAT-3’)(abcb6MO1), abcb6 splice-blocking (5’-TGCTACCAGCAAGCGTACCTGTTGC-3’) (abcb6MO2) and standard control (5’-CCTCTTACCTCAGTTACAATTTATA-3’) morpholinos injected into the egg yolk of 1–2-cell-stage embryos For rescue studies, MOs were coinjected into 1–2-cellstage zygotes with either wild type (WT) or mutant ABCB6 mRNA Morpholino Knockdown of abcb6 Rescue Studies Graph depicting the proportions of embryos with coloboma associated with the injection of either abcb6MO1 or abcb6MO2 and the proportions rescued by coinjection of MOs with WT and mutant ABCB6 mRNA CONCLUSIONS All pathogenic mutations identified in South Indian population No mutations identified in Bihar patient (strongly suggests the involvement of teratogens in Bihar A/M cluster) This study identified 12 mutations (9 novel) in 12 genes as; 3 in OTX2, 3 in STRA6, 1 in RAX, 1 in PAX6, 1 in VSX2, 1 in ABCB6, 1 in CRYBA4 and 1 in GDF6. Seven Mutations were identified by NGS technique whereas five mutations by Sanger sequencing Mutations in SOX2 are rare in Indian population (as no mutations were identified in 120 MAC cases) CONCLUSIONS First report of association of ABCB6 gene with globe anomalies The phenotype caused by disruption of ABCB6 can be explained by haploinsufficiency - Mutation identified in ABCB6 is heterozygous - Decreased mRNA expression caused by morpholino knockdown in zebrafish replicates the coloboma phenotype - Knockdown phenotype can be corrected with the coinjection of MOs with WT mRNA, but not with mutant ABCB6 mRNA Establishment of Human Retinal Mitoscriptome Gene Expression Signature for Diabetic Retinopathy and Diabetic Using Human Cadaver Eye mtDNA: Genome & Organization * A circular molecule * Genome size: ~16569bp * Maternally inherited * Genes: -2 rRNAs -22 tRNAs -13 proteins * Only non-coding region is d-loop * Other proteins encoded by nuclear DNA! mtDNA variations: Structural and Functional complexity Genotype-Phenotype correlation Apoptosis Lipid Metabolism Nucleotide Metabolism Amino Acid Metabolism Carbohydrate Metabolism ? CELL Electron Transport Chain ? tRNAs RNA Polymerase Ribosome Complex I Complex V Complex II Complex III Complex IV Mitochondria Nucleus Variations http://blog.openhelix.com/wp-content/uploads/2008/11/nhgri_cnv_cyndy_post2.jpg http://spittoon.23andme.com/wp-content/uploads/2009/09/prostatemen.jpg Mitochondria & COMPONENTS NOT SUFFICIENT FOR OPTIMAL FUNCTIONS 22 tRNAs 2 rRNAs 13 proteins HAS TO BE IMPORTED AS PER REQUIREMENT >1500 proteins 5S rRNA tRNAs ncRNA.....smallRNAs? Objectives To under the role of Mitochondria’s involvement in development of Diabetic Retinopathy • To obtain the retinal mitoscriptome gene expression signature using “Agilent - microarray” for diabetic and diabetic retinopathy human cadaver eye Methodology: I. Clinical Characterization -Cadaver Eye Dr. R. Kim – AEH, Madurai Dr. S.R.Karthick – AEH, Madurai Stereomicroscope examination Digitised images III. Custom based Microarray AMADID number: G2509F_045815 Genotypic Pvt Limited, Bengaluru, India RNA extraction cRNA Conversion Performed Microarray (Agilent – 8*15K platform ) – Around 1500 mitoscriptome gene probes (GSE53257) III. Microarray data - Validation Taqman Relative quantification - Real time PCR AMRF, Madurai Experimental Design In present study, we have compared three biological conditions to obtain human mitoscriptome gene expression signature for DR and diabetes Each group includes 4 biological replicates with additional technical replicate to validate the microarray experiment Comparison was carried out between retinas of: DR (n=6) and age matched normal control (n=5) groups Diabetic (n=5) and age matched normal control (n=5) groups DR (n=6) and diabetic (n=5) groups Hierarchical cluster shows differentially expressed genes among postmortem DR, Diabetic and age matched normal control group retinas Notes: The red color indicates up- regulated genes and the green color indicates down regulated genes Results-Gene expression analysis Differences in human mitoscriptome gene expression between DR and age matched normal control groups • Among 1100 genes 59 genes were differentially expressed in DR cadaver retinas as compared to normal control group retinas • In those 59 genes, 8 (≥0.6) were up regulated and 51 (≤0.6) were down regulated Differences in human mitoscriptome gene expression between diabetic and age matched normal control groups • Among 1100 genes 39 genes were differentially expressed in diabetic cadaver retinas as compared to normal control retina • In those 39 genes, 8 were up regulated and 31 were down regulated Differences in human mitoscriptome gene expression between DR and diabetic groups • Among 1100 genes 39 genes were differentially expressed in DR cadaver retinas as compared to diabetic control retina • In those 39 genes, 3 were up regulated and 36 were down regulated Expected Outcome • Understand the role of Mitochondria’s involvement in development of DR • Identification of valuable biomarkers in health and disease condition • Developing new diagnostic methods and therapeutic approaches to their prevention and treatment • Performing molecular diagnosis for • Aniridia , • Oculocutanous & ocular albinism and • LHON patients • • • • • • • • Understanding the outcome of the project Pooling the samples Reseqencing Positive control validation Huge data Pathway analysis Sample size and cost Thank you
© Copyright 2026 ExpyDoc