Short loop-targeting oligoribonucleotides antagonize Lin28 and enable pre-let-7 processing and suppression of cell growth in let-7 deficient cancer cells. Martina Roos1, Mario A. E. Rebhan1, Matije Lucic1, David Pavlicek1, Ugo Pradere1, Harry Towbin1, Gianluca Civenni2, Carlo V. Catapano2, Jonathan Hall1* 1 Supplementary Materials Tables and Figures Page Table S1: Sequences of oligonucleotides, masses calculated and masses observed 3 Figure S1: Looptomirs assayed for binding to truncated biotinylated pre-let-7a-2 bound to the 4 surface of a streptavidin-coated biosensor by surface plasmon resonance (SPR) spectroscopy Figure S2: Inhibition by looptomirs of Lin28A binding to immobilized pre-let-7a-2. 4 Figure S3: Looptomirs inhibit Lin28A binding (upper panel) but not hnRNPA1 to pre-let-7a-2. 5 Figure S4: Cellular localization of Cy5-labelled L29-13 in Huh7 cells. 5 Figure S5: Detection of endogenous Lin28B by immunofluorescence in HepG2 and Huh7 cells 6 Figure S6: Levels of mature let-7a 48 h after transfections of L29-13, L30-14 and Lcon 6 Figure S7 Uncropped Western blot membranes showing Lin28B and B-Actin in HepG2 lysates 7 Figure S8: Western blot showing levels of let-7 target Lin28B after treatment of HepG2 cells 7 Figure S9 Secondary structures of pre-miR-18a, pre-mir-122 and pre-let-7a-2. 8 2 Table S1: Sequences of oligonucleotides used in the study, masses calculated and masses observed. Oligoribonucleotide name Sequence 5’ -> 3’ Type Mass calc.[g/mol] Mass obs [g/mol] Let-7a-2 total complementary + primer + restriction sites CCTCCACTTCAGCCAGGACTCGAGTTTTCATTTTGAAG GGGCCTCACCGAGTGGGGGCATCATCAAAAACTTTAA CTATACAACCTACTACCTCAGGAGTCCCCTCACCTCCT CTAAGGTTGGGCAGGGTGACCCTGAAGTGAGCACAG CCTAGGGCTGAGCTGGGGACCTGGTGCGGCCGCTGA GTCTTCGGACCTCGC DNA - - Let-7a-2 total complementary mutated + primer + restriction sites CCTCCACTTCAGCCAGGACTCGAGTTTTCATTTTGAAG GGGCCTCACCGAGTGGGGGCATCATCAAAAACTTTAA CTATACAACCTACGAACGCAGGAGTCCCCTCACCTCC TCTAAGGTTGGGCAGGGTGACCCTGAAGTGAGCACA GCCTAGGGCTGAGCTGGGGACCTGGTGCGGCCGCTG AGTCTTCGGACCTCGC DNA - - Pre-let-7a-2 T7 DNA template GGAAAGCTAGGAGGCTGTACAGTTATCTCCCTTGATG TAATTCTAAACTATACAACCTACTACCTCCTATAGTGA GTCGTATTAGGATCC DNA - - T7 DNA Polymerase Promotor GGATCCTAATACGACTCACTATAG DNA - - siRNA lin28b5’ AAAUCCUUCCAUGAAUAGUTT RNA/DNA 6852 - siRNA lin28b3’ ACUAUUCAUGGAAGGAUUUTT RNA/DNA 6909 - siRen 5’ GAGCGAAGAGGGCGAGAAAUU RNA 6901.31 6902.5 siRen 3’ UUUCUCGCCCUCUUCGCUCUU RNA 6436.78 6436.2 Pre-let-7a-2 UGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAA GGGAGAUAACUGUACAGCCUCCUAGCUUUCC RNA 21'502.9 21'503.3 Pre-mir-18a + Biotin(X) UAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAG CAUCUACUGCCCUAAGUGCUCCUUCUGGX RNA - - Pre-mir-122 + Biotin (X) UGGAGUGUGACAAUGGUGUUUGUGUCUAAACUAUCA AACGCCAUUAUCACACUAAAUAX RNA - - Pre-let-7a-2 truncated + linker + Biotin(X) AGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAA CUGUACAGCCUCTTTTTTUX RNA/DNA 18'039.3 18'039.6 Lcon AUGUAGUUCCCUC 2’-OMe RNA 4'220.8 4'220.1 L35-09 AUCUCCCUU 2’-OMe RNA 2'838.9 2'838.3 L33-11 AUCUCCCUUGA 2’-OMe RNA 3'541.4 3'540.8 L31-13 AUCUCCCUUGAUG 2’-OMe RNA 4'220.8 4'220.1 L31-09 CCCUUGAUG 2’-OMe RNA 2'918.0 2'917.2 L30-14 AUCUCCCUUGAUGU 2’-OMe RNA 4'541.0 4'540.3 L30-13 UCUCCCUUGAUGU 2’-OMe RNA 4'197.8 4'197.1 L29-13 CUCCCUUGAUGUA 2’-OMe RNA 4'220.8 4'220.2 L29-13 + Cy5-label CUCCCUUGAUGUA 2’-OMe RNA 4833.61 4832.8 L29-09 CUUGAUGUA 2’-OMe RNA 2'943.0 2'942.4 General primer 1 forward CCTCCACTTCAGCCAGGA DNA - - General primer 1 revers GCGAGGTCCGAAGACTCA DNA - - 3 a for binding to tru uncated biotinylated pre--let-7a-2 bou nd to the surrface of a Fig. S1: Looptomirs assayed streptaviidin-coated biosensor b by surface plassmon resona ance (SPR) spectroscopy s y. Fig. S2: Inhibition by b looptomirs s of Lin28A binding to immobilized i pre-let-7a-2 (see Fig. 1 in main nt). documen 4 Fig. S3 Binding curvves of loopto omirs inhibiti ng Lin28 bin nding (upperr panel) but not hnRNPA A1 (lower panel) to o pre-let-7a-2 2. The bindin ng curves of tthe two prote eins were assed in paralllel. Figure S S4: Cellular localization l of o looptomirss. Huh7 cells were trans sfected with Cy5-labelled d L29-13 (Table S S1) at 20 nM concentratio ons under sta ditions (See Methods). M L229-13 accum mulates in andard cond the nucle eus and the cytoplasm 12 h post tran nsfection as shown by liv ve fluorescennce images of o L29-13 (in green). Scale ba ar indicate 15 μm; pictu ocessing details are givven in Mate erials and ure post pro Methodss. 5 Figure S S5: Detection n of endogen nous Lin28B B (in green) by immunofluorescence in HepG2 and a Huh7 cells; sca ale bars indiccate 15 μm. Picture post processing details are given in Mateerials and Me ethods. Figure S S6: Endogeno ous levels off mature let-7 7a 48 h afterr transfection ns of L29-13,, L30-14 and d Lcon into liver Hep pG2 cells, me easured by TaqMan T RT- qPCR (norm malized to Lcoon). 6 Figure S S7 Uncroppe ed Western blot b membran nes showing g Lin28B and d B-Actin dettection in He epG2 cell lysate an nd Lin28B, HMGA2 H and B-Actin B detecction in Huh7 7 cell lysate. Figure S S8: Western blot showing g levels of le et-7 target protein p Lin28B after treattment of Hep pG2 cells with loop ptomirs. Uncropped pictu ures are show wn in Fig. S7 7 7 o pre-miR-1 18a, pre-mir--122 and pre-let-7a-2 ass predicted by Mfold Fig. S9: Secondary structures of 3; Zuker and Jacobson, 1998)). 1 (Waugh et al., 2002; Zuker, 2003 Literature n, P., Altman, R., Brown, J.W., Case, D., Gautheret, D., Harvvey, S.C., Le eontis, N., Waugh, A., Gendron ook, J., Westhof, E., et all. (2002). RN NAML: a stan ndard syntax for exchangging RNA info ormation. Westbro RNA 8, 7 707-717. Zuker, M M. (2003). Mffold web server for nucle eic acid foldin ng and hybridization preddiction. Nucleic Acids Res 31, 3406-3415. Zuker, M M., and Jaccobson, A.B. (1998). Ussing reliabiliity informatio on to annottate RNA secondary structure es. RNA 4, 669-679. 8
© Copyright 2026 ExpyDoc