Neuron, Volume 84 Supplemental Information Generation of Human Striatal Neurons by MicroRNA-Dependent Direct Conversion of Fibroblasts Matheus B. Victor, Michelle Richner, Tracey O. Hermanstyne, Joseph L. Ransdell, Courtney Sobieski, Pan-Yue Deng, Vitaly A. Klyachko, Jeanne M. Nerbonne, and Andrew S. Yoo A B 80 pTIGHT Human Postnatal Dermal Fibroblasts Bcl-xL DAPI +DOX miR-9/9*-124 PID 7 Percent of remaining cells PID 7 *** 60 40 20 +DOX L Bc l-x FP iR N As + tR + iR m m As miR-9/9*-124 0 N tRFP DAPI Human Postnatal Dermal Fibroblasts pTIGHT Figure S1 (Related to Figure 1). Effect of Bcl-xL on the number of remaining cells during miR-9/9*-124 -mediated neuronal reprogramming (A) Starting with approximately 100,000 cells seeded per well of a single 24-well plate, human fibroblasts were transduced with lentivirus to express miR-9/9*-124 with either Bcl-xL (top) or turbo red flourescent protein (tRFP). At 7 days post-infection (PID), the percentage of remaining cells were compared between Bcl-xL and tRFP-expressing cells. (B) We found a significantly higher number of surviving cells with Bcl-xL expression compared to tRFP. The graph represents quantifications of DAPI counts from 4 biological replicates. Scale bar = 50 μm. Error bars = s.e.m. *** = p<0.001 by student t-test. G Endogenous miR-9/9* and miR-124 are Expressed in miR-9/9*-124-CDM Converted MSNs H 700 600 Relative mRNA (A.U.) D ay O 2 ff D ay 4 n D ox O D ox Non-Transduced Fibroblasts miR-9/9*-124+CDM (Dox off) miR-9/9*-124+CDMn (Dox on) 9900 N.S. p = 0.7207 7600 N.S. p = 0.4109 5300 3000 2 -1 24 0 Continuous expression of miR-9/9*-124 for 30 days is necesssary to achieve high conversion efficiency miR-9/9*-124 Post-Infection Day 35 ** 400 MAP2/DAPI 500 ** 300 200 100 2 0 m miR-9/9*-124+CDM Dox Off at PID 15 Dox On for 30 days im ar y Non-Transduced Fibroblasts Pr Pr im ar y m iR iR -9 / -1 24 9* Relative Expression 800 N.S. p = 0.9070 iR ** 160000 130000 100000 70000 m * Dox withdrawal does not significantly reduce mature miRNAs levels * 0.5 Pr Tr i-m an iR sge -9 n /9 ic *12 4 Bc l-x L Dox Off at PID 30 0.5 -9 1.0 0.0 Dox On 1.0 4 D ay 1 O ff D ay 1.5 F -9 MAP2/DAPI miR-9/9*-124 + CDM Post-Infection Day 38 Dox On Dox Off iR 2.0 m E RNA Quantity (A.U.) Expression of transgenic miR-9/9*-124 and Bcl-xL is suppressed upon doxycycline withdrawl Mature miR-9 1.5 0.0 D ox 0.0 8 2 7 O ff 6 D ay 5 O n 4 D ox D 3 D ox Human Postnatal Dermal Fibroblasts 2 Dox Off Day 1 Dox On Day 2 1 -DOX 0 +DOX Days Transgenic Pri-miR-9/9*-124 0.5 D ox miR-9/9*-124 X Dox Off -DOX Relative mRNA (A.U.) Bcl-xL 2.0 1.0 Dox Off Day 4 pTIGHT Mature miR-9 turnover in response to doxycycline withdrawn iR Transgenic Pri-miR-9/9*-124 O ff +DOX C Transgenic Primary miRNA transcriptional kinetics in response to doxycycline m B pTight-miR-9/9*-124 transcriptional kinetics in response to doxycycline Relative mRNA (A.U.) A Figure S2 (Related to Figure 1). Kinetics of doxyxycline-dependent miR-9/9*-124 expression (A-C) (A) Diagram illustrating the doxycycline-dependent vector used to express miRNAs and Bcl-xL and the design of our experiment to test the transcriptional kinetics of this vector in response to doxycycline (Dox) Using a primer-set specific to the synthetic miRNA hairpin (Illustrated in orange), we tested the kinetics of Dox withdrawal on vector transcriptional activity in (B). We also determined that levels of mature miR-9 are reduced via qPCR with probes specific for the mature sequence in (C). (D-E) Human fibroblasts were transduced with miR-9/9*-124 + CDM and at 30 post-infection days (PID) withdrawn from Dox (Dox Off). At 38 PID, cells were lysed and RNA harvested to determine expression levels of transgene in comparison to cells that were maintained in Dox (Dox On). Data quantified in (E), in which we observe a reduction of over 70% in transgene expression. (F) qPCR levels of mature miRNAs persist even 8 days after Dox withdrawl. (G) Levels of endogenous primary miRNA transcripts are expressed at PID 38. Primers for miR-9/9* were designed for human loci 3, and miR-124 for loci 1. (H) Continuous expression of miRNAs for at least 30 days is necessary for efficient neuronal conversion. Error bars = s.e.m. Student’s t-test, N.S. = Not significant, * = p<0.05; ** = p<0.01 Scale bar = 20 μm. A +FOXP1 +RARB + RXRG +POU6F1 +GSH2 +ISL1 +LHX8 +CTIP2 +MYT1L MAP2/DAPI miR-9/9*-124 Only MAP2/DAPI +ZFP503 +DLX1 + DLX2 MAP2/DAPI +MEIS2 MAP2 DARPP-32 100 75 50 Fibroblast Sample 4 Fibroblast Sample 3 0 Fibroblast Sample 2 25 Fibroblast Sample 1 Percent of Cells Positive +CTIP2+ DLX1/2 + MYT1L C MAP2/DAPI B D Other combinations tested but not shown: CTIP2, FOXP1, FOXP2, ZFP503, RARB, RXRG (+/- MYT1L) CTIP2, DLX1, DLX2, FOXP1, FOXP2, ZFP503 (+/- MYT1L) CTIP2, DLX1, DLX2, ZFP503 (+/- MYT1L) CTIP2, DLX1, DLX2, RARB, RXRG (+/- MYT1L) CTIP2, DLX1, DLX2, ZFP503, RARB, RXRG CTIP2, DLX1, DLX2, FOXP1, FOXP2, ZFP503, RARB, RXRG CTIP2, RARB, RXRG (+/- MYT1L) CTIP2, DLX1, DLX2, FOXP1, FOXP2RARB, RXRG (+/- MYT1L) CTIP2, DLX1, DLX2, FOXP1, FOXP2 (+/- MYT1L) CTIP2, FOXP1, FOXP2, RARB, RXRG (+/- MYT1L) CTIP2, FOXP1, FOXP2, ZFP503 CTIP2, ZFP503, RARB, RXRG (+/- MYT1L) CTIP2, FOXP1, FOXP2, DLX1, DLX2, RARB, RXRG, GSH2, ZFP503 (+/- MYT1L) CTIP2, FOXP1, FOXP2, RARB, RXRG (+/- MYT1L) CTIP2, GSH2, ZFP503, DLX1, DLX2 (+/- MYT1L) CTIP2, GSH2, ZFP503 (+/- MYT1L) CTIP2, MYT1L, FOXP1 CTIP2, MYT1L, ZFP503 CTIP2, MYT1L, RARB, RXRG Figure S3 (Related to Figure 1). Representative images from testing striatal factors with miR-9/9*-124 (A) MAP2 and DAPI staining of miR-9/9*-124 only and in conjuction with single or multiple factors listed above each image. (B) The final cocktail, miR-9/9*-124 in combination with factors CDM is highly neurogenic. (C) Fibroblasts from multiple donors can be reprogrammed with similar efficiencies. Samples 1 and 2: postnatal fibroblasts. Data generated from sample 1 is displayed in Figure 1 of the main text. Sample 3 and 4: adult fibroblasts (from a 42 year old and a 22 year old individuals, respectively). Data generated from sample 3 is displayed in Figure 4 of the main text while data generated from sample 4 is displayed in Figure 5. (D) Additional factors tested in conjuction to miR-9/9*-124. Error bars = s.e.m. Scale bar = 20 μm. N.S. p= 0.7350 N.S. p= 0.2400 1.0 0.5 1.0 p= 0.0115 * N.S. p= 0.7453 N.S. p= 0.1436 0.5 0.0 Doxycycline-inducible transcriptional activation of CTIP2 FSP1/CTIP2 - DOX (Control) Ectopic expression of CDM does not induce miR-132 m iR -9 m iR -9 * m iR -1 24 -1 24 iR -9 * m iR m m iR -9 0.0 Non-Transduced Fibroblasts Fibroblast+CDM 2.0 1.5 C Relative RNA Expression Non-Transduced Fibroblasts Fibroblasts + CTIP2 N.S. p= 0.2196 FSP1/CTIP2 D Mature miR-9/9* or miR-124 Levels Upon Ectopic Expression of CDM Relative RNA Expression 1.5 B + DOX (5 days since induction) 2.0 N.S. p= 0.0821 Non-Transduced Fibroblasts Fibroblast+CDM 1.5 1.0 0.5 0.0 miR-132 Ectopic expression of CTIP2 does not induce Bcl-xL Relative RNA Expression Mature miR-9/9* or miR-124 Levels Upon Ectopic Expression of CTIP2 Relative RNA Expression A 1.5 N.S. p= 0.8584 DOX OFF DOX ON 1.0 0.5 0.0 Bcl-xL Figure S4 (Related to Figure 1). Striatal factors without miR-9/9*-124 do not induce neuronal miRs or Bcl-xL (A) Human dermal fibroblasts were transduced with CTIP2 alone and the levels of mature miRNAs were analyzed by qPCR with TaqMan Probes 7 days post-transduction. Results indicate levels of miR-9, miR-9* and miR-124 are not significantly changed in comparison to non-transduced fibroblast controls. (B) Similarly, CDM factors alone do not induce the expression of miR-9/9* and miR-124 as well as another neuronal miRNA, miR-132 (C), further supporting our conclusion that CDM factors without concurrent expression of miR-9/9*-124 are not capable of inducing neuronal conversion. (D) To investigate the possible link between CTIP2 and Bcl-xL in our system, we constructed a doxycycline (DOX)-dependent CTIP2 lentiviral vector. Human neonatal fibroblasts were transduced with this vector and cultured in the absence or presence of DOX as shown in the immunostaining data. (FSP1 is a marker specific to fibroblasts and used to generate contrast). After 5 days of DOX exposure, cells were lysed and the relative expression of Bcl-xL was analyzed by qPCR showing no significant change. Error bars = s.e.m. Student’s t-test, N.S. = Not significant. Scale bar = 20 μm. A GABA/DAPI GABA/DAPI human fibroblasts B GAD67/MAP2/DAPI GAD67/MAP2/DAPI human human fibroblasts fibroblasts Figure S5 (Related to Figure 1). A representative overall field of view of human postnatal fibroblasts converted into GABAergic neurons (A) Immunostaining with an antibody against GABA. (B) Immunostaining with antibodies against GAD67 and MAP2. Blue color marks DAPI signal. Insets in each figure represent complementary immunostaining data from human postnatal fibroblast controls. Scale bar = 20 μm. A converted cells VGLUT1/MAP2/DAPI B human cortical neurons VGLUT1/MAP2/DAPI Figure S6 (Related to Figure 1). miR-9/9*-124-CDM-converted cells immunostained for excitatory neurons (A) Immunostaining with antibodes against VGLUT1, a marker for glutamatergic neurons, and MAP2. (B) Human cortical neurons stained for VGLUT1. Note the absence of VGLUT1-positive cells the converted cells in comparison to human cortical neurons. Scale bar = 20 μm. A DARPP-32/GABA DARPP-32/GABA human fibroblasts B DLX5/TUBB3/DAPI DLX5/TUBB3/DAPI human fibroblasts Figure S7 (Related to Figure 1). Representative overall field of view of medium spiny neurons induced from human postnatal fibroblasts (A) Immunostaining with antibodes against DARPP-32 and GABA. (B) Immunostaining with an antibodies against DLX5 and TUBB3. Blue color marks DAPI signals. Insets in each figure represent complementary immunostaining data from starting human postnatal fibroblasts. Scale bar = 20 μm. A Relative RNA Expression 60 Non-Transduced Fibroblasts ** 50 miR-9/9*-124+CDM 40 30 20 N.S. p = 0.1715 10 3' 2 LX D D LX 1 3' U U TR TR 0 Figure S8 (Related to Figure 2). Endogenous DLX1 but not DLX2 is activated during miR-9/9*-124+CDM-mediated reprogrammingof human fibroblasts to medium spiny neurons (A) In order to determine if the endogenous transcripts of DLX1 and DLX2 are induced with ectopic expression of miR-9/9*-124 + CDM, we designed primers to target the 3’ UTRs of DLX1 and DLX2 since the transgenic cDNAs do not contain 3‘ UTRs of these genes. At 38 days post-infection, we extracted RNA and determined the levels of endogenous transcripts. Interestingly, we detect a large level of DLX1, but no increase in the expression of DLX2 in comparison to non-transduced fibroblasts. This data suggests that the endogenous DLX1 is activated during our reprogramming. Error bars = s.e.m. Student’s t-test, N.S. = Not significant, ** = p<0.01 A miR-9/9*-124 + CDM DARPP-32/GABA B miR-9/9*-124 + DM DARPP-32/GABA Figure S9 (Related to Figure 1). Demonstration of CTIP2 in promoting the fate of DARPP-32-positive cells (A) Human postnatal fibroblasts were converted using miR-9/9*-124 and CDM (CTIP2, DLX1/2 and MYT1L) and immunostained with antibodies against DARPP-32 and GABA. (B) Human postnatal fibroblasts were converted using miR-9/9*-124 and DM (DLX1/2 and MYT1L), and immunostained with antibodies againstDARPP-32 and GABA. Note that in DM condition, converted cells are GABAergic, but deficient in DARPP-32-positive cells. Scale bar = 20 μm. Laser Microdissected Human MSNs R2 = 0.769 Reprogrammed MSNs Figure S10 (Related to Figure 2). Pairwise comparison of sample groups from single-cell gene expression profile The degree of similarity in gene expression between single-cells microdisseced from postmortem human striatum and single-cells collected from reprogrammed MSNs was quantified in a pairwise comparison with a coefficient of determination (R2) of 0.769. Gene expression is represented as limit of detection (LOD) Ct value of 26 subtracted by observed Ct values of each gene tested, in reprogrammed cells (X axis) and laser-microdissected human MSNs (Y axis). 220000 ** 180000 **** 140000 FB LCM 100000 2500 **** 1500 m iR -1 * -9 iR m iR m 24 2 1 0 -9 Relative RNA Expression 260000 Figure S11 (Related to Figure 2). Mature miR-9/9* and miR-124 are expressed in human striatum To determine the levels of mature miR-9, miR-9* and miR-124 in native human medium spiny neurons, we conducted qPCR analysis using TaqMan probes in human postmortem striatum tissue from 89 yearold heathly individual. Results indicate that the miR-9/9*-124 are highly expressed in the human striatum. Error bars = s.e.m. Student’s t-test, ** = p<0.01; *** = p<0.001 MSNs derived from human neonatal fibroblasts – 12 weeks (monoculture) B 20 mV A 2 nA 300 ms -56 mV 5 ms MSNs derived from human neonatal fibroblasts – 6 weeks (monoculture) D 200 pA 20 mV C 500 pA 20 ms -58 mV 5 ms Peak Na Amplitude (pA) 2500 *** 2000 F G +GABA 1500 200 pA E 200 pA Functional maturation with time in vitro and in co-culture with primary neurons 1000 500 0 1s 6 weeks 12 Weeks Figure S12 (Related to Figure 3). Additional representative traces from patch-clamp recordings in tissue culture (A-D) MSNs derived from postnatal fibroblast at 12 weeks (A-B) and at 6 weeks (C-D) post-transduction. Left and right panels of each figure correspond to current-clamp and voltage-clamp traces, repectively. (E) Peak Na+ amplitude increases significantly with time in vitro. (F) EGFP-tagged converted cells increase in morphological complexity upon co-culturing. (G) Application of 5 μM GABA induces hyperpolarizing currents indicative of functional GABA receptors. Error bars = s.e.m. Student’s t-test, *** = p<0.001 Scale bar = 10 μm. A Neonatal Fibroblasts 6 weeks 12 weeks 6 weeks - coculture N AP RF Vrest (mV) Cm (pF) Rm (GΩ) 13 13 12 11 11 12 0 6 12 -45.45 ± 1.53 -45.52 ± 2.19 -58.35 ± 3.08 30.95 ± 6.06 16.29 ± 1.96 16.99 ± 2.34 1.7 ± 0.31 1.0 ± 0.14 1.7 ± 0.16 B Spontaneous Activity (Culture) Neonatal Fibroblasts -12 Weeks N 11 Response 8 C Acute Slice N EGFP 7 Non-EGFP 11 Input Resistance (Mohm) Vrest (mV) Delay to first spike (ms) Current step to first spike (pA) 184.97 ± 40.67 114.65 ± 12.48 -83.29 ± 2.40 -85.205 ± 1.67 271.50 ± 57.35 235.75 ± 27.97 125.71 ± 34.00 177.5 ± 15.78 AP Threshold (mV) Ramp -42.70 ± 3.36 -40.57 ± 4.42 AP Threshold (mV) step -44.85 ± 2.23 -45.62 ± 2.97 D Spontaneous Activity (Slice) 16 weeks post-transplantation N EGFP: 7 Non-EGFP: 11 Response 7 11 Table S1 (Related to Figures 3, 4 and 6). Electrophysiology recordings summary table. (A) Induced medium spiny neurons derived from nenonatal human fibroblasts at 6 and 12 weeks post-transduction as well as medium spiny neurons recorded at 6 weeks post-transduction in the presence of primary rat cortical neurons (Coculture). Abbreviations: N- Total number of cells recorded; AP- Total number of cells that fired action potentials (APs); RF- Total number of cells that showed repetitive firing; VrestResting membrane potential; Cm- Membrane capacitance; Rm- Membrane resistance. Data reported as mean ± S.E.M. (B) Spontaneous activity in reprogrammed cells cocultured with primary rat cortical neurons. (C) Intrinsic membrane properties of neurons recorded in slice. AP threshold and amplitude (measured from threshold to the peak) from ramp injection. (D) Spontaneous activity recorded from slice preparation. All data acquired from slice recordings has been quantified and presented in Figure 3. Gene Symbol ANK2 ASCL1 BCL11B BDNF CALB2 (Calretinin) CHAT CHRM4 DBH DCX DDC DLG4 (PSD95) DLX1 DLX2 DRD1 DRD2 EOMES (TRB2) GAD1 GAD2 GAPDH GPR6 GRP HPRT1 HTR2C HTR3A LHX6 MAP2 MAPT MYT1L NCAM1 NES NEUROD1 NGFR NKX2-1 OPRM1 OTX1 OTX2 PAX6 PCP2 PDYN PENK POU3F1 PPP1R1B (DARPP-32) PRPH PVALB RARB RPS18 SCN2A SCN3A SHANK3 SLC17A6 (VGLUT2) Forward TCACAACTGAGTCATCCATCAC TGGTGCGAATGGACTTTGGAA CAACCCGCAGCACTTGTC TGGCTGACACTTTCGAACAC TCACTCTTTGACATCATGCCA CCGGTTTGTCCTCTCCACTA TCTTTGCCATTCTGCTAGCC GAGTGGGAGATCGTGAACCA ATCTCTACGCCCACCAGTCC CACCCTGGGGACCACAAC AGCTGGAGCAGGAGTTCAC GGAAGGGCTCAGGAGGAAAC TTCGTCCCCAGCCAACAA GCCCTTTGGGTCCTTCTGTA CCTGAACTTGTGTGCCATCA CTGTGGCAAAGCCGACAATA ATCCTGGTTGACTGCAGAGAC CAAACATTTATCAACATGCGCTTC ACACCATGGGGAAGGTGAAG CCAAAGTCAGACTCACACCAT ACCGTGCTGACCAAGATGTA GCTTTCCTTGGTCAGGCAGTA CATGCACCTCTGCGCTATA ATGTGGCTGCAGTGGTTT ACGCTCAGACGCTGCAGAA CAACGGAGAGCTGACCTCA GAAGATTGGGTCCCTGGACAATA GCTCTGTGCTATCCTGATACC CCGTCATCCTGCTTGATCAG GCTGCGGGCTACTGAAAA GCCCCAGGGTTATGAGACTA CGACAACCTCATCCCTGTCTA GATGGTACGGCGCCAAC CAGCCATTGGTCTTCCTGTA CTGCTGGCGGCATTTGG CATTCTGCTGTTGTTGCTGTT TTGCCCGAGAAAGACTAGCA CGGGCCAGACCACCAA CATCTCTCCCATTCCTCAGA TTCCTCATTATCACTGCCATCC CCGCCAGTGTGTACATATCTC TCTCAAGTCGAAGAGACCCAAC CACAACCTCGTGCTCTTCC GCTGAACGCTGAGGACATCAA ACCATCGCAGACCAAATTACC CGGAAAATAGCCTTTGCCATCA TGTGGTGGTCATTCTCTCCA CTTTGTGGTGGTGATTCTCTCC CATAATCGCTGTGTGAGGTGA TGGGGCTACATCATCACTCA Reverse ATTACCTGCGATACAGCTTGG CTCCCAACGCCACTGACAA CCTCGTCTTCTTCGAGGATGG ATCACCCTGGACGTGTACAA GGAAATATGGAAGCACTTTGACG ATTTGGGACCACAGGACCATA CTCTGGCAGAAGGTGTTCAC ACCGACACGACCTTCTTCAA AGCGAGTCCGAGTCATCCAA TGCATCAACGTGCAGCCATA ACACGCTTCACCTTGTGGTA TAGCTTCTTGGTGCGCTGAA TGGCTTCCCGTTCACTATCC CAGAGGTTGAGGATGGATGCA GAGCTGTAGCGCGTATTGTA CTCATCCAGTGGGAACCAGTA CCAGTGGAGAGCTGGTTGAA CTATGACACTGGAGACAAGGC GTGACCAGGCGCCCAATA TCCTCTCACCAACACCACA GCTCCCTCTCTCAGAAACAGAA ACTTCGTGGGGTCCTTTTCAC ATCACAGGGATAGGAACTGATAC CTGGTTCTGGAGAGAATCGC GCCCGGCAGTTTTGAAACCA CTACAGCCTCAGCAGTGACTA AGGTCAGCTTGTGGGTTTCA GCTGTGATGGTTCTGGACAT GAGTTCAAGACGCAGCCA CTGAGCGATCTGGCTCTGTA TCTGTCCAGCTTGGAGGAC TTCTGCTTGCAGCTGTTCC CCATGCCGCTCATGTTCA TCAGCAGGTTTTCCCAGTAC ACTCGCTACCCTGACATCT CTTCGGGTATGGACTTGCTG TCTCCATTTGGCCCTTCGATTA TGTCACACGTTGGTCATCCA GGTGCTCCTTGTGTGCT CATGAAGAAGGATGCAGAGGAG CTTCCCTCTGCTCCCTTTC TGCAGGTGAGACTCAGCAA CTCAATCTTGCGCTCTAGTTCC TTCAGGCCGACCATTTGGAA TGGGGTATACCTGGTGCAAA TCCTCAACACCACATGAGCATA AACAGGGTAGGGGACACAAA GGAACAAGGTAGGGGACACA GTGGAGGAAGTGCAGATGAG GAAGTATGGCAGCTCCGAAA SLC17A8 (VGLUT3) SLC6A3 (DAT) SLC6A4 (SERT) SST TAC1 TBR1 TH TPH2 TUBB3 AACCACAACTGCTGTCAGAAA TTCCCCTACCTGTGCTACAAAA TGCTGGCTTTTGCTAGCTAC GTTCCAGGGCATCATTCTCC TTGGCACAATATGAAAAATAAACACTT ACGAACAACAAAGGAGCTTCA TCACCAAGTTCGACCCTGAC ATGGCTCAGATCCCCTCTACA CCTCCGTGTAGTGACCCTT AAAGCCAACCACCAGGAGTA GAAAAGTGGCATCCCAGCAA GAAGCTCGTCATGCAGTTCA AGACTCCGTCAGTTTCTGC TTCATTTGTGTCAATGGGCAAT TGGTACTTGTGCAAGGACTGTA CGATCTCAGCAATCAGCTTCC GGATCCGCAAGTAGTGGAACA GGCCTTTGGACATCTCTTCAG Bcl-xL GACATCCCAGCTCCACATC GTTCCCATAGAGTTCCACAAAAG DLX1 3'UTR GGCTGTTTGCCAATTCAGGG CTCCCCGTGCGCTTAAAGTA DLX2 3'UTR CCTTATCTTACCCCCACCGC TCCGCAAAGGCACCTAAACT Transgenic Pri-miR9124 Pri-miR-9 Loci 3 TGTCGGTCCCCTCTGGCTCT AGAAACGGGCCTCCCATTCG AAGAGCCAGAGGAGCCGA GAGAGAGCCGAGGTCAGGTA Pri-miR-124 Loci 1 CAAGGAAGGAGCGACCGAC TGCATCTCTAAGCCCCTGTC Table S2 (Related to Figure 2). Primer sequences from single-cell multiplex qPCR analysis and RT-qPCR. The bottom table provides primer sequences used for RT-qPCR (Figures S2, S4, S8, S11). Supplemental Experimental Procedures Plasmid Construction and Virus Preparation We modified the previously validated lentiviral construct to drive the expression of both miR-9/9* (NCBI and miRBASE accession numbers MIMAT0000441 and MIMAT0000442) and miR-124 (accession number MIMAT0000422) by replacing TurboRFP with Bcl-xL (NCBI Reference Sequence: NM_138578.1) to promote neuronal survival (Alavian et al., 2011) during neuronal conversion. MiR-9/9*-124 and Bcl-xL were co-driven by a doxycycline- responsive promoter, pTight (Open Biosystems) where doxcycycline was usually removed approximately 4 weeks post-infection. cDNA of CTIP2 (NCBI Reference Sequence: NM_001079883.1), DLX1 (NCBI Reference Sequence: NM_178120.4), DLX2 (NCBI Reference Sequence: NM_004405.3), MYT1L (NCBI Reference Sequence: NM_015025.2) were cloned downstream of the EF1α promoter in a separate lentiviral construct with neomycin selection. For doxycycline experiments, human fibroblasts were first infected with a lentiviral construct expressing rtTA under the EF1α promoter and stably selected with hygromycin, followed by transduction with pTight-miR-9/9*-124-Bcl-xL and neural factor-expressing lentiviruses. Infectious lentiviruses were collected 60-70 h after transfection of Lenti-X 293LE cells (Clontech) with appropriate amounts of lentiviral vectors, psPAX2 and pMD2.G (Addgene) using polyethyleneimine (Polysciences). Collected lentiviruses were pushed through a 0.45 μm PES filter and concentrated either by high-speed centrifugation at 70,000 x g for 2 hours or Lenti-X Concentrator (Clontech) following the manufacturer’s protocol. Cell Culture All fibroblast cultures (human postnatal foreskin fibroblasts (ATCC, PCS-201-010 and ScienCell, 2310) and adult dermal fibroblast (ATCC, PCS-201-012 and Coriell Cell Repositories, GM02171)) were maintained in fibroblast media (Dulbecco’s Modified Eagle Medium; Invitrogen) containing 10% fetal bovine serum (FBS; Hyclone), 0.01% βmercaptoethanol, 1% non-essential amino acids, 1% sodium pyruvate, 1% GlutaMAX, 1% 1M HEPES buffer solution and 1% penicillin/streptomycin solution (all from Invitrogen). The day before lentiviral infection, human fibroblasts were seeded at 2x105 cells/well onto gelatin-coated 12-well tissue culture dishes (Corning). Next day, cells were infected with the lentiviral supernatant in the presence of polybrene (Sigma-Aldrich, 8 μg /ml), spun at 1000 x g for 30 minutes, and left in the incubator overnight. Fresh fibroblast media with doxycycline (Sigma Aldrich, 1 μg/mL) (to induce miR-9/9*-124 expression) were added the next morning and left on for two days. Three days after infection, cells were trypsinized (0.25% Trypsin, Invitrogen) and re-plated onto polyornithine (Sigma-Aldrich, 0.01% solution)/laminin (Roche, 5 μg/mL)/fibronectin (SigmaAldrich, 2 μg/mL)-coated glass coverslips in fibroblast media with doxycycline. The day after re-plating, the medium was changed to Neuronal Media (ScienCell) supplemented with valproic acid (Calbiochem, 1 mM), dibutyryl cAMP (Sigma-Aldrich, 400 μM), human BDNF (Peprotech, 10 ng/ml), human NT-3 (Peprotech, 10 ng/ml), and retinoic acid (Sigma-Aldrich, 1 μM) with appropriate antibiotics. Doxycycline was replenished every two days for approximately 4 weeks. Media was replenished every four days by pipetting out half of the media and replacing an equal volume of fresh media. Addition of antibiotics was terminated after two weeks. Immunocytochemistry The following antibodies were used for the immunofluorescence studies: chicken antiMAP2 (Abcam, 1:10,000), mouse anti-β-III tubulin (Covance, 1:1,000), chicken anti- NeuN (Aves, 1:500), rabbit anti-SCN1a (Abcam, 1:500), rabbit anti-synapsin1 (Millipore, 1:800), mouse anti-Ankyrin G (Santa Cruz Biotechnology, 1:200), rabbit anti-GABA (Sigma, 1:2,000), mouse anti-GABA (Sigma, 1:500), mouse anti-GAD67 (Millipore, 1:1,000), rabbit anti-FOXP1 (Abcam, 1:500), rabbit anti-DLX5 (Abcam, 1:2,000), rabbit anti-DARPP32 (Santa Cruz Biotechnology, 1:400), and rabbit anti-VGLUT1 (Synaptic Systems, 1:1,000). The secondary antibodies were goat anti-rabbit, mouse, or chicken IgG conjugated with Alexa-488, -594, or -647 (Invitrogen). For SCN1a, biotinylated secondary antibodies were detected using TSA amplification kit (Invitrogen). Images were captured using a Leica SP5X white light laser confocal system with Leica Application Suite (LAS) Advanced Fluorescence 2.7.3.9723. Immunohistochemistry Mice were anesthetized with 200mg/kg Avertin (Sigma #T48402) and transcardially perfused with ice-cold 4% paraformaldehyde (vol/vol) in 0.1M phospate buffer saline (PBS). Brains were dissected, post-fixed for an additional 24 hours and cryoprotected in 30% sucrose solution for 48-72 hours. Brains were embedded in Tissue-Tek O.C.T. and once frozen, cut into 35μm slices. Free-floating slices were washed three times in PBS, permeabilized in 0.2% Triton-X for 10 minutes, and blocked in 5% BSA and 1% goat serum for 2 hours at room temperature. Sections were then incubated for 48 hours in chicken anti-MAP2 (Abcam, 1:500), rabbit anti-DARPP-32 (Cell Signaling, 1:200), rabbit anti-FOXP1 (Abcam, 1:400), mouse anti-GABA (Sigma, 1:500), rat anti-CTIP2 (Abcam, 1:500) and mouse anti-tyrosine hydroxylase (Millipore, 1:200). Following incubation, sections were washed three times in PBS and then incubated for 2 hours at room temperature with goat anti-rabbit, mouse, rat, or chicken IgG conjugated with Alexa-488, -594, or -647 (Invitrogen, 1:200). Sections were once again washed with PBS and incubated with DAPI (Sigma, 1:10,000) for 5 minutes followed by one last PBS wash. Sections were mounted on glass slides with Vectashield (Vector Labs) and images were captured using a Leica SP5X white light laser confocal system with Leica Application Suite (LAS) Advanced Fluorescence 2.7.3.9723. Single Cell Quantitative PCR Converted cells at 5 weeks were harvested by Trypsin 0.05% (Gibco) and single cells were collected by FACS sorting using BD Aria II (BD Biosciences) in 5 μl of reverse transcription reaction mix containing VILO Reaction Mix (Invitrogen), SUPERase-In (Ambion), NP-40 (Thermo Scientific) and nuclease-free water. Sorted samples were denatured for 90 seconds at 65°C and reverse-transcribed by adding SuperScript Enzyme Mix (Invitrogen) and T2 Gene 32 Protein (New England Biolabs). First strand cDNAs were then pre-amplified for 20 cycles in Preamplification mix containing 50 nM of all primers for genes of interest (see Table S2) and TaqMan Preamp Master Mix (Applied Biosystems). Pre-amplified samples were treated with Exonuclease I (New England Biolabs), diluted (5x) with DNA Suspension Buffer (TEKnova) and stored at 20°C. Sample and assay (primer pairs) preparation for 96.96 Fluidigm Dynamic arrays was done according to the manufacturer’s recommendation (Genome Technology Access Center, Washington University School of Medicine in St. Louis). Briefly, sample was mixed with 20x DNA Binding Dye Sample Loading Reagent (Fluidigm), 2x Sso Fast EvaGreen supermix with Low ROX (Bio-Rad Laboratories). Assays were mixed with 2x Assay loading reagent (Fluidigm) and DNA Suspension Buffer (Teknova) to a concentration of 500 nM in the final reaction. The 96.96 Fluidigm Dynamic Arrays (Fluidigm) were primed and loaded on an IFC Controller MX (Fluidigm Corp.) and qPCR experiments were run on the Biomark HD System (Fluidigm). Data was collected and analyzed using the Fluidigm Real-Time PCR Analysis software (v3.1.3). Melting curves were used to determine specificity of each reaction and assay primers were also verified by using four standard dilutions of human cDNA library prepared from human neurons (ScienCell). The collected cells were confirmed based on RSG18 (18S small ribosomal subunit), GAPDH and HPRT expression. Quantitative PCR Total RNA was extracted using TRIzol (Invitrogen, USA) according to the manufacturer's instruction. The RNA quality was determined by the ratio of absorbance at 260 nm and 280 nm to be approximately 2.0. Reverse-transcribed complementary DNA (cDNA) was synthesized from 1μg of RNA with SuperScript III First-Strand Synthesis SuperMix (Invitrogen, USA) or from 10 ng of microRNAs using specific stem-loop primer probes from TaqMan MicroRNA Assays (Invitrogen, USA). Subsequently, the cDNA was analyzed on a StepOnePlus Real-Time PCR System (AB Applied Biosystems, Germany). Expression data were normalized to housekeeping genes HPRT1 and RNU44 for coding genes and microRNAs, respectively, and analyzed using the 2-ΔΔCT relative quantification method. Primer sequences are provided in Supplemental Table S2. Laser Microdissection Striatal putamen sections were obtained from an autopsy sample of an 89 year-old individual. The frozen samples were sectioned onto Polyethylene naphthalate (PEN) membrane coated glass slides (Leica) at a thickness of 5 μm and stored at -80°C. Tissue sections were fixed in cold 75% ethanol for 2 minutes and stained with Cresyl Violet (Sigma Aldrich), gradually incubated in 75%, 90% and 100% ethanol. After samples were completely dried, fixed samples were loaded onto Leica Laser Microdissection system (LMD6500). Cresyl Violet-stained single cells were laserdissected and collected into an individual tube to be used for reverse transcription and gene expression analysis as described in Single Cell Quantitative PCR. Electrophysiology in Tissue Culture Whole-cell patch-clamp recordings were performed at 6 or 12 weeks after transduction with miR-9/9*-124-CDM, in cells of postnatal origin. Cells converted from human adult fibroblasts were analyzed at 6 weeks in the presence or absence of primary human neurons (ScienCell) as described in the main text. Data was acquired using pCLAMP 10 software with multiclamp 700B amplifier and Digidata 1550 digitizer (Molecular Devices). Electrode pipettes were pulled from borosilicate glass (World Precision Instruments) and typically ranged between 3–6 MΩ resistance. Intrinsic neuronal properties were studied using the following solutions (in mM): Extracellular: 140 NaCl, 3 KCl, 10 Glucose, 10 HEPES, 2 CaCl2 and 1 MgCl2 (pH adjusted to 7.25 with NaOH). Intracellular: 130 KGluconate, 4 NaCl, 2 MgCl2, 1 EGTA, 10 HEPES, 2 Na2-ATP, 0.3 Na3-GTP, 5 Creatine phosphate (pH adjusted to 7.5 with KOH). Membrane potentials were typically kept at 60 mV to -70 mV. In voltage-clamp mode, currents were recorded with voltage steps ranging from -20 mV to +90 mV. In current-clamp mode, action potentials were elicited by injection of step currents that modulated membrane potential from +10 mV to +80 mV. Local application of 5 μM GABA (Sigma #A5835) was achieved using a multibarrel perfusion system with a port placed within 0.5 mm of the patched cell. GABA-evoked currents were recorded using the previously listed external solution and the following intracellular solution (in mM): 130 CsCl, 2 NaCl, 10 HEPES, 0.1 EGTA (pH adjusted to 7.25 with NaOH). Postsynaptic potentials were detected spontaneously or evoked by perfusion of 200mM sucrose. Data was collected in Clampex and initially analyzed in Clampfit (Molecular Devices). Further analysis was done in GraphPad Prism 6 (GraphPad Software). Liquid junction potential was calculated to be 15.2 mV and corrected in calculating resting membrane potential according to previously published methods (Barry, 1994). Animals Immunodeficient NOD scid gamma (NSG) mice used for transplantation studies and breeding were purchased from The Jackson Laboratory. Once transplanted, mice were kept on doxycycline chow (LabDiet 2000ppm) to ensure proper expression of miR-9/9*124 which was cloned under the doxycycline-responsive promoter, pTight. Doxycycline chow was removed 30 days after transplantation and replaced with regular chow. Cell Harvesting and Transplantation Reprogrammed cells for transplantation were typically transduced with a Synapsin promoter-EGFP lentivirus at reprogramming day 2 and harvested for transplantation studies at reprogramming day 14. Adherent cell-cultures were mechanically dissociated and concentrated by centrifugation (4 minutes at 1000 RPM). Concentrated cell suspensions (~104 cells μl-1) were loaded into a 5μl Hamilton syringe (26s/2/2 Gauge/Length/Point) and 2μl were injected into the right striatum of NSG mice (P0-P1). Injection coordinates were guided by cranial transillumination and first verified in preliminary dye studies. Brain Slice Preparation and Recordings Coronal striatum slices were prepared as described previously (Andre et al., 2011; Ellender et al., 2011). Briefly, after being deeply anesthetized with with 1.25% Avertin, animals were perfused transcardially with ice cold cutting solution containing (in mM): 240 sucrose, 2.5 KCl, 1.25 NaH2PO4, 25 NaHCO3, 0.5 CaCl2, and 7 MgCl2 and saturated with 95% O2 and 5% CO2. Mice were decapitated and their brains were rapidly dissected out into ice cold cutting solution. Brain slices (275μm) were cut in ice cold cutting solution using a microtome (Leica VT1000S) and placed in a holding chamber where they were incubated in artificial cerebrospinal fluid (ACSF) containing (in mM): 130 NaCl, 24 NaHCO3, 3.5 KCl, 1.25 NaH2PO4, 0.5 CaCl2, 5.0 MgCl2, and 10 glucose, saturated with 95% O2/5% CO2, at 33°C for 30 minutes and then at 22-23°C for at least 30 min before transfer to the recording chamber. Electrophysiological recordings were made using an Axopatch 700B amplifier (Molecular Devices) interfaced with a Digidata 1332 and the pCLAMP 10.4 software (Axon Instruments). Data signals were acquired at 20kHz and filtered at 10kHz, prior to digitization. Recordings were made in whole-cell mode from GFP-positive striatal neurons and native medium spiny striatal neurons, visually identified with florescence and DIC microscopy as described previously (Deng et al., 2013). All recordings were conducted at room temperature (22°C). The recording electrodes were filled with the following (in mM): 144 K-gluconate, 0.2 EGTA, 3 MgCl2, , 4 MgATP, 0.5 NaGTP, and 10 HEPES, pH was brought to 7.3 using KOH. The extracellular solution (ACSF described above) was continuously perfused and saturated with 95% 02 and 5% CO2. A liquid-junction potential correction of -15mV was applied to voltage- and current-clamp recordings prior to analysis as previously described (Barry, 1994). AP threshold was calculated using the first derivative of the AP waveform (first evoked AP) and measured as the first point greater than 10 mV/ms. Spontaneous PSPs were measured in current-clamp at the resting membrane potential. To compare recorded properties between native mouse cells and human reprogrammed cells, a student’s t-test was used for p-values reported. In non-EGFP tagged mouse cells, two cells were excluded from analysis due to poor recording quality. Supplemental References Alavian, K.N., Li, H., Collis, L., Bonanni, L., Zeng, L., Sacchetti, S., Lazrove, E., Nabili, P., Flaherty, B., Graham, M., et al. (2011). Bcl-xL regulates metabolic efficiency of neurons through interaction with the mitochondrial F1FO ATP synthase. Nature cell biology 13, 1224-1233. Andre, V.M., Cepeda, C., Fisher, Y.E., Huynh, M., Bardakjian, N., Singh, S., Yang, X.W., and Levine, M.S. (2011). Differential electrophysiological changes in striatal output neurons in Huntington's disease. The Journal of neuroscience : the official journal of the Society for Neuroscience 31, 1170-1182. Barry, P.H. (1994). JPCalc, a software package for calculating liquid junction potential corrections in patch-clamp, intracellular, epithelial and bilayer measurements and for correcting junction potential measurements. Journal of neuroscience methods 51, 107-116. Deng, P.Y., Rotman, Z., Blundon, J.A., Cho, Y., Cui, J., Cavalli, V., Zakharenko, S.S., and Klyachko, V.A. (2013). FMRP regulates neurotransmitter release and synaptic information transmission by modulating action potential duration via BK channels. Neuron 77, 696-711. Ellender, T.J., Huerta-Ocampo, I., Deisseroth, K., Capogna, M., and Bolam, J.P. (2011). Differential modulation of excitatory and inhibitory striatal synaptic transmission by histamine. The Journal of neuroscience : the official journal of the Society for Neuroscience 31, 15340-15351.
© Copyright 2026 ExpyDoc