1393 4 501 -510 (Betula pendula Roth) Genetic diversity in white birch (Betula pendula Roth) stands using microsatellite markers 1 1* 1 1 -1 Esmaeilpour M1, Taheri Abkenar K1, Aalami A*1, Eslam Bonyad A1 1. PhD Student, Assistant Professors, Associate Professor, University of Guilan [email protected] : !" #$% &'!% ()! * (92/9/24 :04" . -92/3/1 :, .) "#$ %& ' ( )* + ,. /,2 6 ! )&C&< D< ;&< AB< ,& .7 ! , ( 68 : ;&< 6<=>? K 7 G H .7 6:, JD ,CG 13 : , E 62F? CG H&I 68 !"# ,! 6:C,J ,Q NOP 72< NOP 72< )JL M: , ' )J < ! 68 ;&< L7.3,CG ), FST (FS< L D ,<* .7 R< J JD "#$ )J,CG 6 .,K &GI E )J(2! )7& ,E 6:& T$6JEP ,CG &= P <6 K ;&< 7&JG K 7 2< 7 34 ' )J(2! 68 ;&< 6O8O V DU< H !< L ,QY NOP 72< NOP 72< N87&X )JNOP 7 W, ,B ,G .(:J(2! N )* H M: , &\J .7 7JG 7C&: (2! Z 6:C,J 6[ )JNOP SSR K 7& 7 68 )&C&< X G :, )J(2! 7:6 ,Z 68 )&C&< )JP . 6:: !< (2! ")O (]^ )J&8<" ),! 6 < ... (Betula pendula Roth) ' )J < 68 ;&< F( i< qV (% D )) ((" .al. 2005) & H <`Le D f) i< M% `Le - "; < (Betula pendula Roth) 7 8 .(Freeland 2005) B CD $E F( (2n=2x=28) (=>? , aH K ! C(V g % < J8 K .(Atkinson 1992) (H% 400 Mb )H We ()L(N X mh% DX, (?< F( % M% N O (P) FL% K` M 8r ()E$O f) < >E% Q8 RST (% (Zyryanova 2010) - % F .(Omidi and Farzin 2012) ()H% WB E UO)% H >N (H S #VS KLW >B()] `$O g <<%X c>d% % < % < Y7>V . X se AFLP <YXBX $! F Y< ^ >H()] Z)[ B \] ^ 0F ((W _`% K F t K .(Zane et al. 2002) (H% ()LHF K a `$O L bST c>d% S `$O Z)% (>)e #EEh X )V e 8 K D 8 f) F VO >)e c>d% UO)% ! <u" m KL< .H% UO)% K 0! g KL% % K ( <%X < F S >)e 8 f) B (h% i)" (V!% < \B $``[ " `Le 12 D f) X% K` :( < UN gh% 8)H C(V >V O (H e >V Q (Fraxinus excelsior) 8 F B c>d% < BZLe e $ 7 F< (H(<% F< K )`% #S Z% W>)e %F )F j(< F .(H% H `Le 13 D 8 (Morand et al. 2002) l % #VS g)e ` 0 KW " XdB (% UO)% (Pinus sylvestris) >)ev 8 F )E "!< Z% gk% &LH <g)e ^ -g! K D XL (Robledo Arnuncio et al. 2005) F , 8)H CX>!% (% F <% K)] E,% (Salehi X8 <g)e 0 8 c>d% < l F > O . e% Y" CD D f) 8 K D f) Shanjani and Vendramin 2007) , ()%F (" #[ >)e < bST (% (Sorbus ; \L 8 F `Le iH `Le K D f) X% )%F L!% #VO (Rasmussen and Kollmann " <g)e torminalis) `Le K` .(Thormann et al. 1994) <`Le w> F `Le W] D f) 2008) F l)%) source-sink &E )V g)e ` (Zolfaghari et al. \7 <g)e (Quercus branti) ()) (< )V (H% <`Le source (Dalbergia YH m8 _`% 8 D f) 2009) RST <% sink m8 _`% <`Le % (H d <g)e monticola) F D J>8 i, F fO (H% S F `Le 16 D 8 (Andrianoelina et al. 2009) F FF nN ()% kkd < WB (` $] ] <g)e (Betula maximowicziana) 7 8 (% .(H% (>)e #EEh ((e #P .(Tsuda et al. 2010) K"D Jk8 Z%e #VO KH CX>!% D Z)% M% 7 ^ 0F L< e t K ah% ,oe i)" `Le 8 F( K K D f) F VO y< $ `Le K)pL< .(H% WB g8 K D f) < K D 8 l UEh D )) (%B e < (H (% ;] (e ( z t N !E% % F B YW% (Lowe et L< X=T WB )H % 1393 $% /4 # /!" / 502 ... (Betula pendula Roth) ' )J < 68 ;&< C,> TE (H f$H &), % 150 ~ < ()LHF K RST $W << (%B ^ ^ (H DS kd% F }" (H ,P .H = Y( # B YT Y< ; .H% gE)% ((e ~ -20 H ; d U>m% & B YT ^% (' % .H% DS }? H4 e 46 fL% 7 >[ z)" F W g d$ F }" !H ([ 70 & (H vd DNA (H C L <{ F \d ,k O 8 #(% <DS %L) .H% gT TE DNA & F ( %FB ( <{ .(1&(e) .(H% C EN 13000 V EN 15 .((H (W ;8 . PCR <i) DNA vd 0 F)W a (H ,`% <%X < F7B F UEh K % ([ 70 & (H BZLe <{ ( PCR i) .(2&(e) (H S Kulju et al. (2003) .((H 8 % Z% D }? , N !H 200 DNA C 100g%H % 25 W YT % 700 L< (H " { F C >% 100 (E% >% F7B < F ^%% 0/4 dNTPs ^%% 0/2 EDTA ^%>% 20 } ^%>% 100) vd , Taq YXB (T ; ( ;) PCR , YX)% (> ^% Y( (> ^% 1/4 &"% LT -LT ([ 25 mE \B F S W YT W d < g8 PVP - 40 C >% 10 (CTAB ([ Touchdown #[ T % .(H ( % gE)% >% 1/5 ~ }? .H% w>d% 8 95 % EN g%H & >T% O .(H TO N e 65 % EN 60 #(% (H >T% DNA (H H e ) &""X :C,> &>h% % 700 }? . % e 94 M 30g%H C( < 8] 10g%H C (H w>d% 8 ,P ~ < (1 : 24 $! < F7B &k e 65 M 30 ((e ~ (e &>h% .H% DS }? . < F7B a! e 72 EN ; ,P B ^% z)" NaCl &>h% YT ck .H% gE)% % M 30 g%H C( < 8] 26 g%H C >T% & ~ YT }? .H% w>d% 8 (2&(e) F7B < )% &k % M 30 94 %B g[T &>h% ,P ( e -20) U>m% X W a! 4 >T% . e 72 EN ; H4 20 S)% % EN 10 #(% H% CL F }" . e 72 % EN 5 g%H 8 B Z% (H DS <~ }? .H% &D F, F (H #`mN ;S We PCR i) % ^% Y( # ([ 70 & .H% ([ F B &D ( ([ < (%Bg>" e 37 % EN 30 #(% ,P Proteinase K .(H C (% C( F S FHB S &>h% (H DS <~ .H% H4 %B X !H ^% Y( # ([ 70 & (e (Peakall and Smouse GenAlEx 6.4 X,C L)< t &>h% j4T F }" DS <~ .(H% (... 3 2 1) (V #[ <( <L 2006) ,) TE % 100 .(H ;8 , N n % < K (=>? e e 4 % (H ,P (EDTA -} -8H F S D f) B .(H C <%X DNA F8 We .H% (W H ; #(% (` :, #[ GenAlEx 6.4 X,C ;L YW% < }? .H% ( % 300 TE &>h% YT 503 1393 $%/4 # /!" / ... (Betula pendula Roth) ' )J < 68 ;&< UEh K (H L <`Le #kd% C -1&(e ,oe _V ,oe &O (%) sm F fS (H L 8 (` `Le C 36ԝ°38 55ԝ°1 2344 10 !> F% 35ԝ°59 53ԝ°13 2579 16 (F% () 36ԝ°65 51ԝ°48 2 3 (F% WH 35ԝ°44 51ԝ°23 2404 12 F$ ;WH 37ԝ°34 44ԝ°35 1741 5 ( F% ) 7 rB %% UEh K (H S <%X < #kd% C -2 &(e ( e) &k % (GA)4AA(GA)10 (TC)8(TTTC)2 (TC)8(TA)8(TG)11TT(TG)3 (CT)3CC(CT)2CC(CT)13AT(CT)5 (GTAT)3(GT)5 (AG)17 (TC)26 C12CTCC(CT)7TT(CT)5 (CT)12CCTT(CT)4 (GT)18(GA)14 (GA)7 (CT)11GC(AATG)2 (CT)18 (5-3) F7B C ACGCTTTCTTGATGTCAGCC TCACCAAGTTCCTGGTGGAT AGACCATGCCTGGGCCTT CGCAACAAAACACGATGAGA CCGCCGGTAACACTAAACC GAGGGAAGAAAATTCAACGG CTCCTTAGCTGGCACGGAC CCCTTCTTCATAAAACCCTCAA AACCCTCGTTTGGCTACTGA GAACAGTTACTAGTCAAACTGAAAACC TTGAGATAGACGATAGAGGTAAAGCA AGGCATTTCTCCAATTTTCTT AAGGGCACCTGCAGATTAGA AAAATTGCAACAAAACGTGC GAGGAAGTCTCAGCTGACGTG TCCTTTTCAGTTTTCTGATTTCTG GTTTTGGGTTTCCACTTCCA ACTGGTAATACCTTTACCAAGCC GGGGATCCAGTAAGCGGTAT CACACGAGAGATAGAGTAACGGAA TGAAACGAACGGAAGAGTTG ATACGCCAGACTTTCATCCG GGCCAACAGATATAAAACGACG TTTTAAATGCCCACCTTCCC AACGGACAAATTCACGGGTA GGAGTTCATGGATTGGAGGA L1.10 L2.2 L2.7 L3.1 L3.4 L4.4 L5.4 L5.5 L7.1 L7.3 L7.4 L7.8 L022 &` F jh }? .(H $h% X H 8H M% I = - H 8H Ne = 1/(1- He) M% gB (` gB F ; < c>d% < {$)-< #F< (` / N) (H (<% F< pi ln pi X F .(Hartl and Clark 1997) (%B ( <`Le - l % F< HO = (`Le e% < -)`% D 8 K, (AMOVA) % } [(/ FST) -] / D e (Hartl and Clark 1997) He =1pi .(Peakall et al. 1995) (H S X <`Le K = (He- X%B 8H (Frankham et al. 2002) Nm = X FST Nei (1978) &%, t D >[, }% FST = VAP / (VAP+VWP) $ 8H FIS Ho) / He .(H $h% X,C KL< ;L c>d% <`Le K .(H S < F7B F ; < (Peakall et al. 1995) Nei (1972) >[, t <`Le K >[, C ( ()% <`Le F ; < D <%" K)pL< (Cornuet Bottleneck X,C ;L D )) .(H Y gB (` < gB (` gH()] <gB ([ 1393 $% /4 # /!" / 504 ... (Betula pendula Roth) ' )J < 68 ;&< 1/25 `m% K <%X <e H 8H >B &(% <%X iWe &(% and Luikart 1996) L2.7 1/64 L5.5 0/92 F (H $h% C C iWe &(% (Infinite Allele Model: IAM) (h% 7 8 (% l UEh K z t . o >T% &(% (Stepwise Mutation Model: SMM) `m% < $! ^ iWe L3.4 (Piry et al. 1999) (Two-phased model of mutation: TPM) <%X ; gB (` ] < F (H !> ( j8 %V %B <%FB (Bowcock (H% e B iWe ( iX, D i -iWe &` F jh X,C K .(H $h% 8 <`Le <%X < .et al. 1991) ] <`Le (Drift-mutation equilibrium) -% ^ l % F< gB (` ^L`% $L F t (,% nS (H D )) l % F< gB (` &% .()H PCR #%FB O KLP .(%FB% F< (Streiff et al. 1998) 0/84 17 $)" \] w> (<% C(V <D C(V g L3.1 .(Bruschi et al. 2003) (H $h% 0/73 8/2 g! w> .( S <XB ( 7 8 l % F< gB (` a% (Kulju (H $h% 0/603 6/4 (), <g)e )*+ , F (T PT z E% K et al. 2003) >[ Z% F 8 F ^ S DNA vd g$N F S>d% g%V r CF^ $ .( )<L< (Gupta et al. (H% < K % ;D #EEh - `Le F( (Hamrick et al. 1992) E Y! f 8) g 7 8 .2011) B F .()!< g8 D f) X% (Wright 1931) L< < K8 <{ ;D aH , -% l , E Y! 7 8 F F YT K V .(H% , (B UO)% ` $ .(H ^ K D f) DNA vd 4 . F(! g),>" >), #$ D i $ <g)e `Le ;] -8 (`% gT% ()%F H K ^ S (E% K D 8 . (H f) i< d < )V g KL< . F P .(H $h% L7.3 % (FIS) X%B P (Howland H% \!h% DNA vd (Recalcitrant) L022 L7.8 L7.4 L2.2 < S)% (FIS) X%B -)W (`% <gL` t K .et al. 1991) < <`Le <#FL< $L F % 0 W (H S DNA vd F K^ 7 L7.3 ) e . 4% Porebski et al. (1997) 0 gL F UEh K S bST e ( (FIS) X%B P DNA &kT gL` )V (%B ( B ` ` )` H K t f) . [ gN % < 7 8 S F< L7.3 <D F `m% % <`Le gB 54 g g[T z t K l F K F <`Le ^ e gB (` K% .(1gH 3 &(e) (H (<% B F .(H RST ()!< f) % K (H $h% 4/5 `m% K <%X < 4 < $! ^ FST X% L7.3 K L3.4 L2.7 L2.2 < KL L5.4 K)pL< (< <`Le K <#S (% W e M% gB (` a% .( gB (` X% #`m% id< B )V % B F % K (H $h% 3/16 `m% K <%X < . W)" K () )H K% .( M% gB (` X% K L3.4 505 1393 $%/4 # /!" / ... (Betula pendula Roth) ' )J < 68 ;&< (H `m% <D <%X < F S D f) YW% <%" $h% -3&(e F< F< (H (<% l % H (effective) 0/7 0/54 0/72 1/31 - 0/5 0/78 0/89 0/75 0/4 0/22 0/25 0/39 0/4 0/43 0/26 $ 8H X%B P FST FIS 0/25 0/08 0/2 D e 8H M% gB gB (` C 3/5 4 L1.10 1/58 4/01 6 L2.2 0/78 1/64 4/5 6 L2.7 0/28 0/8 1/68 4/9 6 L3.4 0/2 0/9 0/96 0/07 0/68 1/37 3/1 5 L4.4 0/19 0/18 1/06 0/37 0/57 0/96 2/53 3 L5.4 0/27 0/66 0/67 0/1 0/47 0/92 1/89 4 L5.5 0/19 0/6 1/05 0/24 0/65 1/19 2/86 4 L7.1 0/4 0/95 0/35 0/02 0/6 1/13 2/72 4 L7.3 0/27 - 0/2 0/6 0/52 0/66 1/2 2/91 4 L7.4 0/07 - 0/3 2/99 0/63 0/58 0/96 2/37 4 L7.8 0/34 - 0/2 0/48 0/54 0/62 1/09 2/61 4 L022 0/28 0/23 0/85 0/39 0/66 1/25 3/16 4/5 K% 300 bp 200 bp 100 bp -F% `Le (14 5 () `Le 4 1 F( (M .L5.4 <%X F7B Se F S 7 <D DNA -1gH .WH `Le 22 20 %% `Le (19 15 `Le l % F< [k8 <gB ^ FST (E% KH >V K (% l <gB ([ w% E% K .(H (<% WH >h% <0F `$O \d <, (% K% H 8H M% gB (` gB (` gH()] >h% 0F FST 8H K ) KLP (< l % F< [k8 <gB (` .(Merila and Crokrak `Le B F .(4&(e) (H (<% () `Le <`Le ;D <()B, KLW% F D e 2001) -% X 7 KZ KLP () UEh K D e K% . M% WB g% E% K D f) c>d% <%" (H . S>d% g%V M h (%B ( 0/85 f) F `Le K WR % Jk8 8 ,oe Z% g$N F >%V D e K gE% <M (% `Le KW )V 8 ^ D W)" ()B #EEh !F (H i)" r H $ .H , source-sink &E 7 `$O < D e id" Z% H% , .H \)e (Founder) 4) , M F ( .H d% `Le (H gE)% ((e <D L< 4) c>d% <`Le K f) <8H !E% `Le D f) F ( id ( ()H% M% gB (` gB (` gH()] <gB ([ KL (H 0X $% !$L< 1393 $% /4 # /!" / 506 ... (Betula pendula Roth) ' )J < 68 ;&< `m% % <`Le D f) a$% <%" -4&(e %% ;WH WH () F% D f) <%" 100 100 83 100 100 gH()] <gB ([ 2/0 1/9 1/6 2/82 2/06 < M% gB (` K% 2/41 3/16 1/83 3/75 2/91 < gB (` K% 0/76 0/74 0/52 1/1 0/78 H 8H 0 0/08 0 0/25 0/08 [k8 <gB (` K% 0/49 0/41 0/37 0/62 0/46 l % F< 8 K)] (H (<% `m% % `Le z < g)e ` H K ()!< >[ g Y< jh >V (% l &L`%7 ! (" , m8 !F f) i< B .(Morand et al. 2002) (H (<% F< $L H 8H K egN . <g)e #(%()> D #S (AMOVA) % } X t ;WH %% F% () <`Le #S ([ 34 (T `m% K 7 <`Le K (H ;] fP% K , i< WH ^ (H (<% ([ 66 (T <`Le D % w$ KL< . m <`Le B T!% F S .(H% < g8 K ^ f) % <`Le [k8 <gB (` w% z `Le K f) ? 7 <`Le RAPD (h% M h X WB (4&(e) H f) PT UEh $! (H (<% ([ 64 (T [k8 <gB .(, N f) i< % .(Martin et al. 2008) ()<% ^ e [k8 O `Le ; ()!< <gB 7 c>d% <`Le D 8 #S `m% -% <gB K , .(HL , `Le ( FST $ 8H (E% % < F S < iWe F ^ $! X% g ( <g)e (Martin et al. 2008) 0/6 ? <g)e .(Matus and Hayes 2002)(H (%B e <%X ( 0/28 UEh K (Tsuda et al. 2004) 0/16 K"D {$) - < &` F jh 9 UEh K Freeland ) F XL D #S ()< (%B &` K F jh ( L022 L2.7 L1.10 <`Le K 0/106 F (FST) $ 8H (E% .(2005 &` C(V < () `Le .( WH <`Le K 0/307 () F% -< &` C(V e ; W) WH `Le Em)% F ,oe >[, e . o% ;WH &` F jh X PT `m% .(5 &(e) {$) `Le K F D >[, < %% KL% (H (<% <%X < %% `Le H% W)" (2gH) <`Le D <CX% F H FL< iX, >V .(H , l (e RST (T )V L 8 (` (h% ^LT `$O \d M () F% `Le ) e gN K)pL< <%X f) e ] (H (H Xe ;WH %% &LH <g)e id WH .(Freeland 2005) () o L F( (% `m% % -% \!h% LH (h% F v8 < g)e id 8 F " `Le F `m% L ; iL #S K 8 (2gH) () z H <%X z)" F S (Fraxinus excelsior) . F F `Le {$) -< &` F jh 507 1393 $%/4 # /!" / ... (Betula pendula Roth) ' )J < 68 ;&< `m% % <`Le <%X <% {$) -< &` F jh -5 &(e %% ;WH WH () F% < L1/10 D D D L 2 /2 D L2/7 D D D D L3/4 D D D D L4/4 D D D L 5 /4 D D D L 5 /5 D D L 7 /1 D D D L 7 /3 D D D L 7 /4 D D L 7 /8 L 022 {$) -< &` F jh (D UPGMA 0 F (%B ( `m% % c>d% `Le z)" % D >[, C ( - 2gH <%X <% t `m% % <`Le K (}% mN K" ) Nei D >[, (}% mN ^) (FST) $ 8H E% – 6 &(e (H S %% ;WH WH () 0/202 0/21 0/305 0/106 0/16 0/13 0/2 0/15 0/307 0/207 0/816 F% `Le F% 0/303 () 0/59 0/903 WH 0/81 0/305 0/496 ;WH 0/205 0/608 0/57 %% `Le .( C D )) %FB gH()] ( F% `Le D )) %FB z -F ( j8 %V %B <%FB ;WH F< F %B <%FB F C(y< $E %% `Le .( )`% F< <%FB Y< () `Le .(( )`% %B %FB ( F%) 7 rB ZN &(%) SMM !> ( j8 %V %B 8 F )`% F< F %V 8 F )`% F< F (C C iWe .(7&(e) L (` L g WH `Le .(( 1393 $% /4 # /!" / 508 ... (Betula pendula Roth) ' )J < 68 ;&< E (>T% &(%) TPM (C C iWe &(%) SMM ((h% >B &(%) IAM :<%X <% t <`Le D )) -7 &(e .((H (<% l % F< F (` O %% ;WH () F% &(% 4/7 6/3 7/1 7/1 IAM 5/8 6/8 7/2 6/1 SMM 5/4 6/6 6/8 6/4 TPM 9 3 10 6 IAM 9 3 7 6 SMM 9 3 9 6 TPM 0/01 0/04 0/07 0/ 35 IAM 0/05 0/02 0/5 0/57 SMM 0/03 0/03 0/17 0/49 TPM 0/01 0/01 0/01 0/38 IAM 0/47 0 0/03 0/03 SMM 0/36 0/07 0/07 0/14 TPM 0/1 0/59 0/04 0/ 57 IAM 0/16 0/99 0/23 0/83 SMM 0/13 0/98 0/04 0/66 TPM -+. Andrianoelina O, Favreau B, Ramamonjisoa L, Bouvet JM (2009) Small effect of fragmentation on the genetic diversity of Dalbergia monticola, an endangered tree species of the eastern forest of Madagascar, detected by chloroplast and nuclear microsatellites. Annals of Botany 104: 1231-1242. Atkinson MD (1992) Betula pendula and B. pubescens. Journal of Ecology 80: 837-870. Bowcock AM, Kidd JR, Mountain JL, Hebert JM, Carotenuto L, Kidd KK, Cavalli-Sforza LL (1991) Drift, admixture and selection in human evolution: a study with DNA polymorphisms. Proceedings of the National Academy of Sciences USA 88: 839-843. Bruschi P, Vendramin G, Bussotti F, Grossoni P (2003) morphological and molecular diversity among Italian Populations of Quercus petraea. Annals of Botany 91: 707-716 Cornuet JM, Luikart G (1996) Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics 144: 2001-2014. Dirienzo A, Peterson AC, Garca JC, Valdes AM, Slatkin M (1994) Mutational processes of simple sequence repeats in human populations. Proceedings of the National Academy of Sciences USA 91: 3166-3170. 509 1393 $%/4 # /!" / <%FB E O %V P-value P-value ( j8 P-value !> -F( z <%X < r CF^ $ &(%) TPM iWe &(% F S D )) .(Dirienzo et al. 1994) ZN (>T% (<% F< F %% ;WH `Le -% [ (H D )) ()< (% (H `Le K "D RST <;)" e H (H f) i< qV $7 ((" K .H e .(Freeland 2005) B M #(H ! $ % H !> `$O Z)% g F ()! >)( L< W % (F% Y, \] %W 7 $``[ < F { <L 48 .(L% X? (H Frankham R, Ballou JD, Briscoe DA (2002) Introduction to Conservation Genetics. Cambridge University Press, Cambridge, UK.-Freeland JR (2005) Molecular Ecology. John Wiley and Sons Press, England, 63-106. Gupta AK, Rai MK, Phulwaria M, Shekhawat NS (2011) Isolation of genomic DNA suitable for community analysis from mature trees adapted to arid environment. Gene 487: 56-159. Hamrick JL, Godt M, Sherman-Broyles SL (1992) Factors influencing levels of genetic diversity in woody plant species. New Forests 6: 95-124. Hartl DL, Clark AG (1997) Principles of Population Genetics. Sunderland, Massachusetts, Sinauer Associates, USA. Howland D, Oliver RP, Davy AJ (1991) A method of extraction of DNA from Birch. Plant Molecular Biology Reporter 9: 340-344. Kulju KM, Pekkinen M, Varvio S (2003) Twenty-three microsatellite primer pairs for Betula pendula. Molecular Ecology Notes 4: 471-473. Lowe AJ, Bosier D, Ward M, Bacles C, Navarro C (2005) Genetic resource impacts of habitat loss and degradation; reconciling empirical evidence and predicted theory for neotropical trees. Heredity 95:255-273. Martin C, Parra T, Clemente-Munoz M, HernandezBermejo JE (2008) Genetic diversity and structure of the endangered Betula pendula subsp. fontqueri populations in the south of Spain. Silva Fennica 42: 487-498. Matus IA, Hayes PM (2002) Genetic diversity in three groups of barley germplasm assessed by simple sequence repeat. Genome 45: 1095-1106. Merila J, Crokrak P (2001) Comparison of genetic differentiation at marker loci and quantitative traits. Journal of Evolutionary. Biology 14: 892-903. Morand ME, Brachet S, Rossignol P, Dufour J, Frascaria Lacoste N (2002) a generalized heterozygote deficiency assessed with microsatellites in French common ash populations. Molecular Ecology 11: 377- 385. Nei M (1972) Genetic distance between populations. American Naturalist 106: 283-292. Nei M (1987) Molecular Evolutionary Genetics. Columbia University Press, New York, USA. Peakall R, Smouse PE (2006) Genalex 6, genetic analysis in excels population genetic software for teaching and research. Molecular Ecology 6: 288-295. Peakall R, Smouse PE, Huff DR (1995) Evolutionary implications of allozyme and RAPD Variation in diploid populations of dioecious buffalograss Buchloe dactyloides. Molecular Ecology 4: 135-147. Piry S, Luikart G, Cornuet JM (1999) Bottleneck: a computer program for detecting recent reductions in the ... (Betula pendula Roth) ' )J < 68 ;&< effective population size using allele frequency data. Journal of Heredity 90: 502-503. Porebski S, Bailey L, Baum R (1997) Modification of a CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Molecular Biology Reporter 15: 8-15 Omidi M, Farzin N (2012) Biotechnology approaches for improvement of medicinal plants. Modern Genetics Journal 4: 209-220. (In Farsi). Rasmussen KK, Kollmann J (2008) Low genetic diversity in small peripheral populations of a rare European tree (Sorbus torminalis) dominated by clonal reproduction. Conservation Genetics 9:1533-1539 Robledo Arnuncio JJ, Collada C, Alia R, Gil1 L (2005) Genetic structure of montane isolates of Pinus sylvestris L. in a Mediterranean refugial area. Journal of Biogeography 32: 595-605. Salehi Shanjani P, Vendramin GG (2007) Genetic differentiation between generations of beech (Fagus orientalis) populations in Caspian forests. Iranian Journal of Biology 20: 1-14. (In Farsi). Streiff R, Labbe T, Bacilieri R, Steinkellner H, Glossl J, Kremer A (1998) Within population genetic structure in Quercus robur and Quercus petraea assessed with microsatellites. Molecular Ecology 7: 317-328. Thormann CE, Ferreira ME, Camargo LEA, Tivanga JG (1994) Comparison of RFLP and RAPD to estimating genetic relationships within and among cruciferous species. Theoretical Appliaed Genetic 88: 973-980. Tsuda Y, Goto S, Ide Y (2004) RAPD analysis of genetic variation within and among four natural populations of Betula maximowicziana. Silvae Genetica 53: 234-239. Tsuda Y, Sawada H, Takafumi O, Katsuhiro N, Hiroki N, Yuji I (2010) Landscape genetic structure of Betula maximowicziana in the Chichibu mountain range, central Japan. Tree Genetics and Genomes 6:377-387. Wright S (1931) Evolution in Mendelian populations. Genetics 16: 97-159. Zane L, Bargelloni L (2002) Strategies for microsatellite isolation: a review. Molecular Ecology 11: 1-16. Zyryanova O (2010) White birch trees as resource species of Russia. Their distribution, ecophysiological, features, multiple utilizations. Eurasian Journal of Forest Research 13: 25-40. Zolfaghari R, Akbarinia M, Mardi M, Ghanati F (2009) Genetic diversity in Persian oak (Quercus branti) from Kohkiluye and Boyerahmad using SSR. Iranian Journal of Rangelands and Forests Plant Breeding and Genetic Research 16: 172-182 (In Farsi). 1393 $% /4 # /!" / 510
© Copyright 2024 ExpyDoc