Creatine Deficiency Syndromes: A Clinical, Molecular and Functional Approach Joseph Dingbobga Tanyi Ndika The studies described in this thesis were carried out at the Metabolic Unit, Department of Clinical Chemistry, VU University Medical Center in Amsterdam, The Netherlands. This research was carried out under the tutelage of the Graduate School Neurosciences Amsterdam Rotterdam (ONWAR) as part of the Brain Mechanisms in Health and Disease research program of the Neuroscience Campus Amsterdam. This work was financed by the Neuroscience Campus Amsterdam and the Metabolic Laboratory, Department of Clinical Chemistry, VU University Medical Center in Amsterdam, The Netherlands. The publication of this thesis was financially supported by: - Department of Clinical Chemistry, VU University Medical Center and VU University, Amsterdam VU University, College van Decanen, Amsterdam Reading committee: prof.dr. C.B.M. Oudejans prof.dr. T.J. de Grauw dr. A. Thijs dr. S. Mahmutoglu dr. O. Braissant ISBN: 978-90-5383-093-2 Cover picture: Creatine monohydrate powder. Source: www.relentlessgains.com Printed by DPC/Huisdrukkerij, VU University Medical Center, Amsterdam, The Netherlands Copyright © Joseph Dingbobga Tanyi Ndika. All rights reserved VRIJE UNIVERSITEIT Creatine Deficiency Syndromes: A Clinical, Molecular and Functional Approach ACADEMISCH PROEFSCHRIFT ter verkrijging van de graad Doctor aan de Vrije Universiteit Amsterdam, op gezag van de rector magnificus prof.dr. F.A. van der Duyn Schouten, in het openbaar te verdedigen ten overstaan van de promotiecommissie van de Faculteit der Geneeskunde op donderdag 19 juni om 11.45 uur in de aula van de universiteit, De Boelelaan 1105 door Joseph Dingbobga Tanyi Ndika geboren te Bamenda, Kameroen promotoren: prof.dr. G.S. Salomons prof.dr.ir. C.A.J.M. Jakobs copromotor: dr. C. Martinez-Muñoz The ability of the genes to vary and, when they vary (mutate), to reproduce themselves in their new form, confers on these cell elements, as Muller has so convincingly pointed out, the properties of the building blocks required by the process of evolution. Thus, the cell, robbed of its noblest prerogative, was no longer the ultimate unit of life. This title was now conferred on the genes, subcellular elements, of which the cell nucleus contained many thousands and, more precisely, like Noah's ark, two of each kind. Boris Ephrussi1 Dedicated to my parents; Henry Tanyi (in loving memory) and Beatrice Tanyi 1 Nucleo-cytoplasmic Relations in Micro-Organisms: Their Bearing on Cell Heredity and Differentiation (1953), p.2-3 TABLE OF CONTENTS PAGE Chapter 1 General Introduction and Outline of the Thesis. Chapter 2 Developmental progress and creatine restoration upon long-term creatine 29 supplementation of a patient with arginine:glycine amidinotransferase deficiency. Thirteen new patients with guanidinoacetate methyltransferase 39 deficiency and functional characterization of nineteen novel missense variants in the GAMT gene. Post-transcriptional Regulation of the Creatine Transporter Gene: 49 Functional Relevance of Alternative Splicing. Chapter 3 Chapter 4 9 Chapter 5 Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes. 61 Chapter 6 RNA sequencing of creatine transporter (SLC6A8) deficient fibroblasts reveals impairment of the extracellular matrix. 69 Chapter 7 Summary, concluding remarks and perspectives 99 Appendices Nederlandse samenvatting 107 Acknowledgements 110 Curriculum vitae 113 List of publications 114 9 Chapter 1 General Introduction and Outline of the Thesis "Creatine Kinase is located near sites where the real action occurs" Theo Wallimann 10 11 Introduction Creatine, Phosphocreatine and Creatine Kinase system Creatine (methyl guanidine-acetic acid) – which is the Greek word for meat, was first identified in 1832 as a component of skeletal muscle by the French scientist, Michel Eugène Chevreul. Phosphocreatine was discovered about a hundred years later (1927) with the observation that its levels changed between resting and contracting muscle [1,2]. Phosphorylation of creatine (Cr) to phosphocreatine (PCr) and back catalyzed by the creatine kinase enzymes (CK, EC 2.7.3.2) is crucial for the supply of high energy phosphates (Fig. 1) in tissues and cells with high and fluctuating energy demands like skeletal and cardiac muscle, brain, spermatozoa and photoreceptor cells [3]. The ATP/ADP ratio, local concentrations of ATP, ADP and AMP are amongst key regulators influencing numerous metabolic processes, reviewed in [4], as such it doesn’t suffice to merely increase the levels of ATP in these tissues. An example of this can be found in neurons, where the rate of ATP hydrolysis can be increased by several orders of magnitude within seconds for their energy needs, however their intracellular ATP levels remain surprisingly constant. This led to the concept of the stability paradox [5] which purports that there are ... “immediately available, fast and efficiently working energy supporting and back-up systems that connect sites of energy consumption to those of energy production via phosphoryl transfer networks” (reviewed in [6]). In this regard, it is believed that the Cr/PCr/CK system has evolved to play a major role in the regulation of intracellular energy metabolism. CK is the only existing phosphagen kinase in vertebrates, with at least five subunit isoforms that are expressed in a tissueand cell- specific manner with defined subcellular locations; a brain type (CK-B), a muscle type (CK-M), a hetero-dimeric heart type (MB-CK) and two mitochondrial creatine kinases (mt-CK) that exist as homo-octamers (a sarcomeric mt-CK and a ubiquitously expressed mt-CK) [4,7]. It has long been recognized that efficient energy metabolism requires the close spatial organization of the enzymes generating ATP, co-localization of sites of ATP synthesis with sites of ATP consumption, and the sustained delivery of high energy phosphates to ATPases in cases where ATP generation is separated from consumption [8]. The primary mode of regulation of the CK isoenzymes is by subcellular compartmentation (enabling the functional coupling of the CK reaction to various cellular ATPases) and Cr/PCr due to their relatively smaller size when compared to ATP/ADP as well as their superior concentrations in cytosol (ATP, 3-5mM; ADP, 20-40µM; Cr, 5-10mM; PCr, 20-35mM) [4] by definition (Fick’s law) have a higher diffusion coefficient. Taken together, this renders the Cr/PCr/CK system very effective in providing sudden and sufficiently high concentrations of high energy phosphates during conditions of rapid ATP hydrolysis. In summary; Cr/PCr are most suited to act as shuttle molecules between sites of ATP hydrolysis (ATPases) and sites of ATP production (glycolysis and mitochondrial oxidative phosphorylation) or the CK/PCr system can be directly coupled to ATPases to regenerate ATP from ADP (Fig. 1). 12 Figure 1: Creatine/Phosphocreatine/Creatine Kinase system (obtained with permission from Wallimann et al. [9]): Creatine (Cr) is transported into cells expressing creatine kinase (CK) via the creatine transporter (CRT) and is utilized in a number of ways; Cr can be coupled to mitochondrial oxydative phosphorylation (via mtCK) or glycolysis (via CK-g) to yield phosphocreatine (PCr). In the cytosol, interconversion between Cr and PCr by CK-c serves to replenish ATP from ADP. And finally, at sites of ATP consumption (for example by ATPases), PCr is recruited by CK-a to regenerate ATP from ADP. Creatine synthesis and transport: Creatine and phosphocreatine are spontaneously broken down to creatinine which is then excreted into the urine. The rate of loss has been estimated to be about 1.7% of the total body pool per day [10]. This loss of creatine requires continuous replacement which occurs through a combination of endogenous synthesis and uptake from the diet. Creatine synthesis is carried out by two enzymes using arginine, glycine and methionine. The entire glycine molecule is incorporated into creatine whereas arginine and methionine provide their amidino and methyl groups respectively. Creatine synthesis (Fig. 2) takes place in two steps; in a first step Larginine glycine amidino transferase (AGAT/GATM, EC 2.1.4.1) catalyzes the transfer of the amidino group from arginine to glycine to yield ornithine and guanidinoacetate (GAA). The next step involves the transfer of a methyl group from S-adenosylmethionine (SAM) to GAA to produce creatine and Sadenosylhomocysteine (SAH) catalyzed by the enzyme guanidinoacetate N-methyl transferase (GAMT, EC 2.1.1.2) [11]. Synthesized creatine or that which is taken in with the diet is distributed via the bloodstream and is able to cross lipid-rich biological membranes mainly via the action of a specialized carrier - the creatine transporter (SLC6A8) [12]. Tissues and cells with high and fluctuating energy requirements like the skeletal muscle, brain, kidneys, and retina, express high levels of SLC6A8, which by virtue of its homology to the GABA family of transporters has been classified as a Na+/Cl- -dependent neurotransmitter transporter (also known as solute carrier transporter of family number 6 - SLC6), that are responsible for transport of solutes (GABA, serotonin, dopamine, glutamate, etc) against a high concentration gradient [13]. 13 Figure 2: Creatine synthesis and transport (adapted with permission from Wada et al. [14]): AGAT catalyzes the synthesis of guanidinoacetic acid (GAA) using equimolar amounts of arginine and glycine. GAMT subsequently transfers a methyl group from S-adenosylmethionine to GAA forming creatine. Highest expression levels of AGAT and GAMT have been detected in the kidney and liver respectively, suggesting these organs are primarily responsible for creatine synthesis. Synthesized creatine is secreted into the blood from where it can be taken up into tissues, across the plasma membrane by the creatine transporter. Creatine is spontaneously broken down and excreted into urine as creatinine. Inborn errors of creatine metabolism Creatine is distributed in the entire organism, with highest levels detected in skeletal muscle (30mM) and brain (10mM) [10]. Accordingly, one of the most striking effects of creatine supplementation (coupled to an exercise program) is an increase in muscle mass [15–18], indicating that the increase in energy demands as a result of exercise stimulates an increase in muscle creatine metabolism. This so called ergogenic property of creatine has been studied in detail [19,20] and five mechanisms have been proposed for this effect: increase in phosphocreatine and glycogen levels, rapid regeneration of phosphocreatine, increase in expression of growth factors, decrease inflammation and muscular damage as well as an increase in muscle volume due to the osmotic effects of creatine. Thus it can be expected that “defective muscle functions” will be the main symptom of creatine deficiency. However following the identification of the first patients with creatine deficiency [21–23] encompassing more than 200 clinically diagnosed cases to date (www.lovd.nl/GATM, www.lovd.nl/GAMT, www.lovd.nl/SLC6A8), it has become evident that impaired muscle function is not the major consequence of altered creatine metabolism. These disorders drastically affect brain function with intellectual disability being the most prevalent phenotypic outcome [24] . It is worth noting that although the brain constitutes only about 2% of the body’s mass, it may spend up to 20% of the body’s energy consumption [25]. Meaning that a very high turnover of ATP is necessary to sustain cerebral function and consequently the brain will be severely affected by creatine deficiency. 14 Creatine synthesis defects AGAT deficiency (OMIM: 602360) and GAMT deficiency (OMIM: 601240) are autosomal recessivelyinherited errors of creatine synthesis with the main clinical manifestations of defective creatine synthesis being; intellectual disability, speech and language delay, autistic-like behavior and epileptic seizures. However clinical presentation can be quite non-specific and include other symptoms like hypotonia, growth delays, self-mutilating behavior and movement disorders. Affected individuals can be diagnosed by analysis of creatine, guanidinoacetate, and creatinine in urine, plasma and cerebrospinal fluid [26]. It is of note that, irrespective of the presence of a functional creatine transporter in these patients, the biochemical hallmark of AGAT and GAMT deficiency is a decrease or absence of the creatine peak as revealed by cranial proton magnetic resonance spectroscopy (1HMRS). The main metabolic difference between AGAT and GAMT deficiency is the elevated GAA levels in GAMT deficiency patients. Patients with GAMT deficiency may also suffer from a predominantly extrapyramidal movement disorder and more severe epilepsy compared to AGAT deficient patients [27,28]. Creatine transport defect To date four creatine transporters have been described; SLC6A8 (CT1, CRT1, CRTR or CrT) located on chromosome Xq28, SLC6A10pA and SLC6A10pB – two duplicated unprocessed pseudogenes of SLC6A8 located on chromosome 16p11.2 [29], and more recently the monocarboxylate transporter (MCT12) was also shown to be capable of creatine transport [30]. A defect in the SLC6A8 gene was the first inborn error of creatine transport identified (Salomons, 2001). Creatine transport deficiency as a result of a mutation in the SLC6A8 gene mapped at the Xchromosome (OMIM: 300036) is X-linked, and as expected the symptoms are most severe in males, with female carriers presenting with a milder phenotype. The most common symptoms overlap with those due to creatine biosynthesis deficiency and these include; intellectual disability, autism-like behaviour, movement disorders and epilepsy. Individuals with SLC6A8 deficiency may also have, mild generalized muscular hypotrophy, dysmorphic facial features, microcephaly and gastrointestinal disturbances [31–33]. Female carriers (heterozygotes) usually present with learning disabilities [34]. Current estimates indicate that mutations in the SLC6A8 gene could be responsible for around 2% of cases of X-Linked intellectual disability [35], and about 1% of cases with intellectual disability of unknown aetiology [36]. Although the two SLC6A8 paralogues (SLC6A10pA and SLC6A10pB) at chromosome 16p11.2 share 95.8% sequence similarity with SLC6A8, their predicted amino acid sequence harbours a nonsense mutation in “exon 4” (with respect to CTR1), indicating that a creatine transporter protein cannot be translated from the SLC6A10 mRNA and they are most likely pseudogenes [37,38]. However, a translocation breakpoint on chromosome 16p11.2 was mapped to disrupt the 5' flanking sequence of SLC6A10pA in a patient presenting with autism (developmental as well as severe language delay with no evident dysmorphic features) [39,40]. No data on brain/plasma/urinary creatine levels was provided for this patient. Another case of creatine transport-related deficiency has been recently reported in a patient harboring a non-synonymous p.Gly407Ser mutation in the SLC16A12 gene. SLC16A12 encodes a solute carrier of the monocarboxylate transporter family (MCT12). Mutations in SLC16A12 were initially identified as the underlying defect in age-related cataract and renal glucosuria [41,42]. MCT12mediated creatine transport was found to be independent of Na+/Cl- and pH dependent, but the most interesting difference with creatine transport by CTR1 was the bidirectional nature of MCT12 creatine transport [30] because so far the nature of creatine efflux from cells was unknown. Taken together, the fact that a mutation identified in SLC16A12 decreases creatine uptake in vitro, and that Slc16a12 15 knockout rats have elevated urinary creatine, as well as the tissue-/cell-specific differences in expression patterns between SLC16A12 and SLC6A8, led the authors to conclude that MCT12 and CTR1 may have distinct, but possibly synergistic functions in terms of creatine homeostasis. Not surprisingly, due to the presence of functional creatine synthesis and transport in patients SLC16A12 deficiency (OMIM: 611910), the classical neurological phenotype of creatine deficiency is not seen in these patients. Incidentally, the Km of the MCT12 creatine transport was found to be 567.4µM, which is higher than that of CTR1 creatine transport, determined to be around 17-77 µM in human and rat (reviewed in [43]). As such MCT12 has a correspondingly lower affinity for creatine than CTR1, and the latter is most likely the primary transporter responsible for intracellular uptake of creatine. However this does not minimize the importance of MCT12 as it is the first transporter identified that is capable of creatine efflux from cells. Diagnosis of creatine deficiency syndromes In addition to biochemical screening of creatine, creatinine and guanidinoacetate in body fluids, molecular genetic tests are also performed for sequence variants in AGAT (GATM), GAMT or SLC6A8 genes. Moreover, functional assays have been developed for AGAT and GAMT enzyme activities [44,45] as well as creatine uptake [22,46] in primary fibroblasts and lymphoblasts. Table 1 summarizes the current approaches used in diagnoses of creatine deficiency syndromes. Reference values for the investigated metabolites and details of the diagnostic methodologies can be found in the references cited therein. 16 Table 1: Diagnostic criteria for creatine deficiency syndromes Diagnosis SLC6A8 deficiency GAMT deficiency AGAT deficiency Brain Creatine Low to absent Low to absent Low to absent Plasma Creatine Increased Decreased Decreased Urinary Creatine Increased Decreased Decreased CSF Creatine Normal to Increased Decreased Normal Plasma GAA Normal Increased Decreased Urinary GAA Normal Increased Decreased CSF GAA Not done Increased Not done Plasma Creatinine Normal Normal Decreased Urinary Creatinine Low Low Low CSF creatinine Decreased Not done Not done presence of sequence Not applicable Not applicable presence of sequence Not applicable Metabolic Creatine1, Creatinine2 Guanidinoacetate3 (GAA) Sequencing (DNA/RNA) SLC6A8 variants/deletions/insertions GAMT Not applicable variants/deletions/insertions GATM Not applicable Not applicable presence of sequence variants/deletions/insertions Functional SLC6A8 Creatine uptake assay in Not applicable Not applicable GAMT enzyme activity in Not applicable primary fibroblasts GAMT Not applicable lymphoblasts/fibroblasts GATM Not applicable Not applicable AGAT enzyme activity in lymphoblasts/fibroblasts 1_[47–50] 2_[48,50] 3_[47–52] Understanding the pathophysiology of creatine deficiency The dawn of this millennium has seen tremendous progress being made in the areas of genomics, transcriptomics, proteomics and metabolomics. This is evident by the increasing number of 17 individuals, and the different genetic diseases being diagnosed using next generation sequencing technologies. It has been no different for the creatine deficiencies and there is an ever growing list of individuals in the literature diagnosed with an inborn error of creatine metabolism. In this post genomic era, the need to understand the pathophysiological processes common amongst otherwise unrelated genes is now stronger, because it is indeed the first step towards developing therapeutic strategies. As mentioned above, creatine synthesis deficiency occurs following a defect in either AGAT or GAMT genes. The key difference between patients with AGAT or GAMT deficiency is the prevalence of intractable epilepsies with GAMT deficiency. Elevated GAA levels in GAMT patients are responsible for its more severe phenotype [53,54]. Further clarifications on the pathogenicity of defective creatine synthesis to the brain emerged, when it was revealed via in situ hybridization that SLC6A8 is only expressed by microcapillary endothelial cells at the blood–brain barrier (BBB). Suggesting that the BBB has a limited permeability for peripheral creatine and this limitation has to be compensated for by endogenous creatine synthesis in the brain [55–57]. In the context of the pathogenicity of a creatine transporter defect – despite the presence of functional creatine synthesis enzymes, three models have been proposed. The first model derives from the fact that although on a global scale the brain is capable of creatine synthesis the cellular expression of AGAT and GAMT can be dissociated [58]. Specifically, in cortical grey matter only 12% of cells were found to express both AGAT and GAMT, and a further 43% expressing either AGAT (22%) or GAMT (21%) [58,59]. Due to the expression patterns of AGAT + SLC6A8 (6.7%) and GAMT + SLC6A8 (7.9%) in these cells and the previously established strong decrease of creatine in the brain of SLC6A8 deficient patients, the authors propose that the creatine transporter could be required for the provision of GAA synthesized in AGAT-expressing cells to GAMT-expressing cells. This model is supported by the finding of elevated GAA levels in one SLC6A8 deficient patient [60] and more recent experiments that show SLC6A8-mediated efflux of GAA into the CSF as well as an SLC6A8mediated/Na+- and Cl-- dependent uptake of GAA by choroid plexus epithelial cells [61]. In a second model, based on in vitro creatine uptake experiments using primary cultures of rat type I astrocytes and cerebellar granule cells the creatine transporter was apparently more effective in building up intracellular creatine than endogenous synthesis [62]. Hypothetically this is in line with experiments done by Tachikawa et al., [63] that show that the Km for GAA transport by CTR1 (269µM-oocytes, 412µM-HEK293) was at least 10 fold higher than that for creatine. It follows that with such a relatively higher affinity to take up creatine, cells could potentially accumulate exogenous creatine faster than they can get rid of GAA, and the ensuing high levels of accumulating creatine will then act as a negative feedback for GAA synthesis by downregulating AGAT expression [64]. Finally, taking into account; the evidence that creatine is released at the synapse in an action-potential dependent manner [65], the homology of CTR1 to other SLC6 transporters (for example the dopamine, glycine, noerepinephrine, serotonin and transporters) that are known to facilitate neurotransmitter reuptake at the synaptic cleft [66] as well as the presence of normal creatine levels in CSF of SLC6A8 deficient patients, the most recent model purports to explain the cerebral creatine deficiency in SLC6A8 deficient patients as arising from the failure to recycle creatine at the synapse following its release [67]. Supplemental and therapeutic use of creatine Due to its known role in muscle physiology, creatine has been predominantly used as a nutritional supplement to improve muscle performance in healthy individuals [68,69]. The most popular use of creatine has been as a performance-enhancing substance by athletes. Over the last two decades, the discovery of patients with primary creatine disorders has played a major role in understanding the 18 physiological relevance of creatine. The predominantly neurological symptomatology of creatine deficiency, as well as co-occurring muscular deficits established the basis for its increased use (with varying degrees of success) as a supplement not only in the treatment of primary creatine deficiency disorders but also as a neuroprotective agent (in Parkinson’s disease, Huntington’s disease, Ischemia, Amyotrophic lateral sclerosis, etc.), an anti-inflammatory agent, as well as an in mitochondrial cytopathies. A more extensive overview of the benefits of creatine supplementation is covered by [6,10,70–72]. For the purpose of this thesis only the relevance of creatine supplementation to creatine synthesis and transport deficiency will be highlighted. In the literature the total dose of creatine administered to patients with creatine deficiency ranges from 100 to 800 mg/kg/bw/day. AGAT deficiency Replenishment of brain creatine in AGAT and GAMT patients as measured with 1H-MRS is slow, usually requiring a high dose (which is on average about 20 times the daily requirement) of creatine and/or long-term supplementation to achieve brain creatine levels greater than or equal to 60% of controls [48]. Nonetheless a positive clinical outcome almost always ensues creatine supplementation. Observations made on patients suggest that, compared to GAMT deficiency, AGAT deficiency is associated with a milder phenotype, and/or with a better response to creatine supplementation. In response to creatine supplementation, AGAT patients undergo a general improvement of cognitive functions (improved speech, fading autism) which also includes progress in psychomotor development, however mild intellectual disability still persists [73]. Even more remarkable, was the abrogated manifestation of classical creatine deficiency symptoms in a patient diagnosed with AGAT deficiency at birth and treated pre-symptomatically [74], suggesting that onset of treatment is crucial in determining phenotypic response to creatine therapy. GAMT deficiency Similarly, onset of symptoms in GAMT deficiency can also be prevented by pre-symptomatic treatment of neonatal GAMT deficiency [75]. Creatine supplementation in the earliest GAMT patients quickly revealed that brain creatine replenishment without targeted decrease of GAA levels is not as potent in improving clinical symptoms in patients as combining creatine supplementation with ornithine supplementation and dietary arginine (protein) restriction; which confer a significant decrease in urinary and plasma GAA concentrations and a significant improvement of epilepsy and EEG findings [54,76,77]. Pre-symptomatic treatment suggests treatment onset could determine phenotypic response to treatment. This is emphasized in a recent study involving analysis of treatment outcome in 48 patients diagnosed with GAMT deficiency [78], wherein 4 patients treated before the age of 9 months had normal or almost normal developmental outcomes. Moreover there was a positive correlation between treatment onset and severity of intellectual disability/developmental delay in the entire patient group. SLC6A8 deficiency Creatine supplementation has been largely inefficient in treating SLC6A8 deficient patients [27]. When combined with L-arginine and L-glycine to enhance creatine biosynthesis results have been far more encouraging, especially in females since they tend to have mild SLC6A8 deficiency (heterozygous) [79]. The only positive effects reported in males has been an increased muscle mass and improved gross motor skills [80]. Consequently the use of alternatives like lipophilic creatine derivatives that could cross the blood brain barrier by passive diffusion has been gaining popularity in recent years. These studies remain promising with especially positive results in vitro [81–84] and in an SLC6A8 deficient 19 mouse model supplemented with cyclocreatine [85]. Nonetheless no breakthroughs have yet been attained in human subjects due to a number of issues amongst which are (but not limited to); the highly spontaneous conversion/enzymatic degradation of some derivatives to creatinine [86–88], inability to maintain sufficiently high brain concentrations of these compounds [89] and of course some toxicity issues have been noticed as well [81]. 20 Objectives and Outline of Thesis In view of the clinical relevance of creatine, especially within the context of patients affected with cerebral creatine deficiency, the objective of this thesis was centered on two themes; 1– to explore potential avenues which can be used to improve diagnosis of patients and, 2– unraveling aspects on creatine transport regulation with a view towards improved treatment outcome in patients with a defect in creatine biosynthesis. The absence of pathologic manifestations in AGAT or GAMT deficient individuals treated presymptomatically underscores the importance of early diagnosis. This illustrates the urgency of a proper diagnosis of patients early on in life. Hereto we thought to enlarge the awareness of these disorders by describing the clinical phenotype and long term treatment results in AGAT deficiency (Chapter 2). GAMT deficiency had been described already more thoroughly, but studies on missense mutations were still lacking. Since missense mutations are usually difficult to interpret we implemented a functional study for this type of mutations and characterized all current known missense variants. In addition we investigated 13 new GAMT patients with missense mutations (Chapter 3). In both AGAT and GAMT deficiencies, treatment aims are in replenishment of the cerebral creatine pool by dietary creatine supplementation. In case of GAMT deficiency additional supplements are being used aiming at the decrease of the cerebral accumulation of guanidinoacetate. By exploring the regulation of the creatine transporter, this treatment regimens can potentially be improved. Therefore we investigated the potential presence and function of yet unidentified creatine transporter isoforms or alternative transporters capable of creatine transport. Two creatine transporter isoforms were identified with a similar expression profile to that of the creatine transporter. Via overexpression assays, we investigated if they are capable of (regulation of) creatine transport or if they influence SLC6A8-mediated creatine uptake (Chapter 4). Defects in the creatine transporter are fairly common amongst individuals with X-linked intellectual disability. However screening for potentially pathogenic variants on the SLC6A8 gene has so far not included its yet unknown promoter region. Because it is now evident from whole genome sequencing data that disease variants are also being found within such non-coding regions we sought to identify the promoter region of SLC6A8 (Chapter 5). The sequence similarity between SLC6A8 and its paralogous loci on chromosome 16 (SLC6A10P) is approximately 95%. However as opposed to SLC6A8, expression of the SLC6A10P pseudogenes had only been reported in brain and testis. We hypothesized that the sequence variants in the corresponding pseudogene promoters could account for their limited expression. Consequently we also cloned and investigated the transcriptional promoter of the SLC6A10P pseudogene (Chapter 5). So far attempts to treat patients with SLC6A8 deficiency have been unsuccessful, largely as a result of the impermeability of the blood brain barrier to creatine. By gaining insight into the molecular pathophysiology of creatine deficiency, alternative treatment strategies that bypass the need for creatine supplementation should be developed. To further improve our understanding of altered pathways in the background of creatine deficiency we carried out genome–wide differential RNA expression in SLC6A8 deficient fibroblast cells. The applied technique (RNAseq) and its outcome is described in Chapter 6. 21 References [1] P. Eggleton, G. Eggleton, The inorganic phosphate and a labile form of organic phosphate in the gastrocnemius of the frog, Biochem. J. 21 (1927) 190–195. [2] C. Fiske, Y. Subbarao, THE NATURE OF THE “INORGANIC PHOSPHATE” IN VOLUNTARY MUSCLE, Science (80-. ). 65 (1927) 401–403. [3] D. Watts, 12 Creatine Kinase (Adenosine 5ʹ-Triphosphate-Creatine Phosphotransferase), Enzym. 8 (1973) 383–455. [4] T. Wallimann, M. Wyss, D. Brdiczka, and function of creatine kinase isoenzymes in tissues with high and fluctuating energy demands: the’phosphocreatine circuit'for cellular energy homeostasis., Biochem. …. 281 (1992) 21–40. [5] P.W. Hochachka, Intracellular convection, homeostasis and metabolic regulation, J. Exp. Biol. 206 (2003) 2001–2009. [6] R.H. Andres, A.D. Ducray, U. Schlattner, T. Wallimann, H.R. Widmer, Functions and effects of creatine in the central nervous system., Brain Res. Bull. 76 (2008) 329–43. [7] T. Wallimann, M. Tokarska-Schlattner, U. Schlattner, The creatine kinase system and pleiotropic effects of creatine., Amino Acids. 40 (2011) 1271–96. [8] A. Ames, CNS energy metabolism as related to function., Brain Res. Brain Res. Rev. 34 (2000) 42–68. [9] T. Wallimann, M. Tokarska-Schlattner, U. Schlattner, The creatine kinase system and pleiotropic effects of creatine., Amino Acids. 40 (2011) 1271–96. [10] M. Wyss, R. Kaddurah-Daouk, Creatine and creatinine metabolism, Physiol. Rev. 80 (2000) 1107–1213. [11] R. da Silva, I. Nissim, Creatine synthesis: hepatic metabolism of guanidinoacetate and creatine in the rat in vitro and in vivo, … Metab. 9 (2009) 256–261. [12] A. Möller, B. Hamprecht, Creatine transport in cultured cells of rat and mouse brain., J. Neurochem. 52 (1989) 544–50. [13] G.E. Torres, S.G. Amara, Glutamate and monoamine transporters: new visions of form and function., Curr. Opin. Neurobiol. 17 (2007) 304–12. [14] T. Wada, H. Shimbo, H. Osaka, A simple screening method using ion chromatography for the diagnosis of cerebral creatine deficiency syndromes., Amino Acids. 43 (2012) 993–7. [15] J. Volek, N. Duncan, S. Mazzetti, Performance and muscle fiber adaptations to creatine supplementation and heavy resistance training, Med. Sci. …. (1999) 1147–1156. [16] S. Racette, Creatine supplementation and athletic performance., J. Orthop. Sports Phys. Ther. 33 (2003) 615–621. 22 [17] J.D. Branch, Effect of creatine supplementation on body composition and performance: a meta-analysis., Int. J. Sport Nutr. Exerc. Metab. 13 (2003) 198–226. [18] L.G. Ferreira, C.D.T. Bergamaschi, M. Lazaretti-Castro, I.P. Heilberg, Effects of Creatine Supplementation on Body Composition and Renal Function in Rats, Med. Sci. Sport. Exerc. 37 (2005) 1525–1529. [19] E.S. Rawson, A.M. Persky, Mechanisms of muscular adaptation to creatine supplementation, Int. Sport. J. 8 (2007) 43–53. [20] R.M. Murphy, D.G. Stephenson, G.D. Lamb, Effect of creatine on contractile force and sensitivity in mechanically skinned single fibers from rat skeletal muscle., Am. J. Physiol. Cell Physiol. 287 (2004) C1589–95. [21] S. Stöckler, D. Isbrandt, F. Hanefeld, B. Schmidt, K. von Figura, Guanidinoacetate methyltransferase deficiency: the first inborn error of creatine metabolism in man., Am. J. Hum. Genet. 58 (1996) 914–22. [22] G.S. Salomons, S.J. van Dooren, N.M. Verhoeven, K.M. Cecil, W.S. Ball, T.J. Degrauw, et al., Xlinked creatine-transporter gene (SLC6A8) defect: a new creatine-deficiency syndrome., Am. J. Hum. Genet. 68 (2001) 1497–500. [23] C.B. Item, S. Stöckler-Ipsiroglu, C. Stromberger, a Mühl, M.G. Alessandrì, M.C. Bianchi, et al., Arginine:glycine amidinotransferase deficiency: the third inborn error of creatine metabolism in humans., Am. J. Hum. Genet. 69 (2001) 1127–33. [24] A. Schulze, Creatine deficiency syndromes., Mol. Cell. Biochem. 244 (2003) 143–50. [25] R.G. Shulman, D.L. Rothman, K.L. Behar, F. Hyder, Energetic basis of brain activity: implications for neuroimaging., Trends Neurosci. 27 (2004) 489–95. [26] S.G. ercimek-Mahmutoglu S, Stöckler-Ipsiroglu S, Creatine Deficiency Syndromes, GeneReviewsTM. (2011). [27] S. Stockler, P.W. Schutz, G.S. Salomons, CHAPTER 8 CEREBRAL CREATINE DEFICIENCY SYNDROMES : CLINICAL ASPECTS , TREATMENT AND PATHOPHYSIOLOGY, (2007) 149–166. [28] F. Nasrallah, M. Feki, N. Kaabachi, Creatine and creatine deficiency syndromes: biochemical and clinical aspects., Pediatr. Neurol. 42 (2010) 163–71. [29] P.J. Höglund, D. Adzic, S.J. Scicluna, J. Lindblom, R. Fredriksson, The repertoire of solute carriers of family 6: identification of new human and rodent genes., Biochem. Biophys. Res. Commun. 336 (2005) 175–89. [30] J. Abplanalp, E. Laczko, N.J. Philp, J. Neidhardt, J. Zuercher, P. Braun, et al., The cataract and glucosuria associated monocarboxylate transporter MCT12 is a new creatine transporter., Hum. Mol. Genet. 22 (2013) 3218–26. [31] G.M.S. Mancini, C.E. Catsman-Berrevoets, I.F.M. de Coo, F.K. Aarsen, J.H.J. Kamphoven, J.G. Huijmans, et al., Two novel mutations in SLC6A8 cause creatine transporter defect and 23 distinctive X-linked mental retardation in two unrelated Dutch families., Am. J. Med. Genet. A. 132A (2005) 288–95. [32] P. Póo-Argüelles, a Arias, M. a Vilaseca, a Ribes, R. Artuch, a Sans-Fito, et al., X-Linked creatine transporter deficiency in two patients with severe mental retardation and autism., J. Inherit. Metab. Dis. 29 (2006) 220–3. [33] J.M. van de Kamp, O.T. Betsalel, S. Mercimek-Mahmutoglu, L. Abulhoul, S. Grünewald, I. Anselm, et al., Phenotype and genotype in 101 males with X-linked creatine transporter deficiency., J. Med. Genet. 50 (2013) 463–72. [34] J.M. van de Kamp, G.M.S. Mancini, P.J.W. Pouwels, O.T. Betsalel, S.J.M. van Dooren, I. de Koning, et al., Clinical features and X-inactivation in females heterozygous for creatine transporter defect., Clin. Genet. 79 (2011) 264–72. [35] E.H. Rosenberg, L.S. Almeida, T. Kleefstra, R.S. deGrauw, H.G. Yntema, N. Bahi, et al., High prevalence of SLC6A8 deficiency in X-linked mental retardation., Am. J. Hum. Genet. 75 (2004) 97–105. [36] A.J. Clark, E.H. Rosenberg, L.S. Almeida, T.C. Wood, C. Jakobs, R.E. Stevenson, et al., X-linked creatine transporter (SLC6A8) mutations in about 1% of males with mental retardation of unknown etiology., Hum. Genet. 119 (2006) 604–10. [37] E.E. Eichler, F. Lu, Y. Shen, R. Antonacci, V. Jurecic, N.A. Doggett, et al., Duplication of a generich cluster between 16p11 . 1 and Xq28 : a novel pericentromeric-directed mechanism for paralogous genome evolution, 5 (1996) 899–912. [38] G.S. Iyer, R. Krahe, L. a Goodwin, N. a Doggett, M.J. Siciliano, V.L. Funanage, et al., Identification of a testis-expressed creatine transporter gene at 16p11.2 and confirmation of the X-linked locus to Xq28., Genomics. 34 (1996) 143–6. [39] N. Bayou, R. M’rad, A. Belhaj, H. Daoud, R. Zemni, S. Briault, et al., The creatine transporter gene paralogous at 16p11.2 is expressed in human brain., Comp. Funct. Genomics. 2008 (2008) 609684. [40] N. Bayou, R. M’rad, A. Belhaj, H. Daoud, L. Ben Jemaa, R. Zemni, et al., De novo balanced translocation t (7;16) (p22.1; p11.2) associated with autistic disorder., J. Biomed. Biotechnol. 2008 (2008) 231904. [41] B. Kloeckener-Gruissem, Mutation of Solute Carrier SLC16A12 Associates with a Syndrome Combining Juvenile Cataract with Microcornea and Renal Glucosuria, Am. J. …. (2008) 772–779. [42] J. Zuercher, J. Neidhardt, I. Magyar, S. Labs, A.T. Moore, F.C. Tanner, et al., Alterations of the 5’untranslated region of SLC16A12 lead to age-related cataract., Invest. Ophthalmol. Vis. Sci. 51 (2010) 3354–61. [43] D. Christie, Functional insights into the creatine transporter, in: G.S. Salomons, M. Wyss (Eds.), Creat. Creat. Kinase Heal. Dis., Springer, 2007: pp. 99–118. [44] E. a Struys, E.E. Jansen, H.J. ten Brink, N.M. Verhoeven, M.S. van der Knaap, C. Jakobs, An accurate stable isotope dilution gas chromatographic-mass spectrometric approach to the 24 diagnosis of guanidinoacetate methyltransferase deficiency., J. Pharm. Biomed. Anal. 18 (1998) 659–65. [45] N.M. Verhoeven, B. Roos, E.A. Struys, G.S. Salomons, M.S. van der Knaap, C. Jakobs, Enzyme Assay for Diagnosis of Guanidinoacetate Methyltransferase Deficiency, Clin. Chem. . 50 (2004) 441–443. [46] E.H. Rosenberg, C.M. Muñoz, T.J. Degrauw, C.N. Jakobs, G.S. Salomons, Overexpression of wildtype creatine transporter (SLC6A8) restores creatine uptake in primary SLC6A8-deficient fibroblasts., J. Inherit. Metab. Dis. 29 (2006) 345–6. [47] L.S. Almeida, N.M. Verhoeven, B. Roos, C. Valongo, M.L. Cardoso, L. Vilarinho, et al., Creatine and guanidinoacetate: diagnostic markers for inborn errors in creatine biosynthesis and transport., Mol. Genet. Metab. 82 (2004) 214–9. [48] S. Mercimek-Mahmutoglu, S. Stöckler-Ipsiroglu, G. Salomons, Creatine Deficiency Syndromes, 2009. [49] M. Joncquel-Chevalier Curt, D. Cheillan, G. Briand, G.S. Salomons, K. Mention-Mulliez, D. Dobbelaere, et al., Creatine and guanidinoacetate reference values in a French population., Mol. Genet. Metab. 110 (2013) 263–7. [50] D. Haas, H. Gan-Schreier, C.-D. Langhans, A. Anninos, G. Haege, P. Burgard, et al., Diagnosis and therapeutic monitoring of inborn errors of creatine metabolism and transport using liquid chromatography-tandem mass spectrometry in urine, plasma and CSF., Gene. 538 (2014) 188– 94. [51] S. Mercimek-Mahmutoglu, S. Stoeckler-Ipsiroglu, a Adami, R. Appleton, H.C. Araújo, M. Duran, et al., GAMT deficiency: features, treatment, and outcome in an inborn error of creatine synthesis., Neurology. 67 (2006) 480–4. [52] M.S. Comeaux, J. Wang, G. Wang, S. Kleppe, V.W. Zhang, E.S. Schmitt, et al., Biochemical, molecular, and clinical diagnoses of patients with cerebral creatine deficiency syndromes., Mol. Genet. Metab. 109 (2013) 260–8. [53] A. Neu, H. Neuhoff, G. Trube, S. Fehr, K. Ullrich, J. Roeper, et al., Activation of GABA A Receptors by Guanidinoacetate : A Novel Pathophysiological Mechanism, 307 (2002) 298–307. [54] a Schulze, F. Ebinger, D. Rating, E. Mayatepek, Improving treatment of guanidinoacetate methyltransferase deficiency: reduction of guanidinoacetic acid in body fluids by arginine restriction and ornithine supplementation., Mol. Genet. Metab. 74 (2001) 413–9. [55] O. Braissant, H. Henry, M. Loup, B. Eilers, C. Bachmann, Endogenous synthesis and transport of creatine in the rat brain: an in situ hybridization study, Mol. Brain Res. 86 (2001) 193–201. [56] O. Braissant, H. Henry, A.-M. Villard, M.-G. Zurich, M. Loup, B. Eilers, et al., Ammonium-induced impairment of axonal growth is prevented through glial creatine., J. Neurosci. 22 (2002) 9810– 20. [57] O. Braissant, C. Bachmann, H. Henry, Expression and function of AGAT, GAMT and CT1 in the mammalian brain, … Creat. Kinase Heal. …. (2008) 67–81. 25 [58] O. Braissant, H. Henry, AGAT, GAMT and SLC6A8 distribution in the central nervous system, in relation to creatine deficiency syndromes: a review., J. Inherit. Metab. Dis. 31 (2008) 230–9. [59] O. Braissant, E. Béard, C. Torrent, H. Henry, Dissociation of AGAT, GAMT and SLC6A8 in CNS: relevance to creatine deficiency syndromes., Neurobiol. Dis. 37 (2010) 423–33. [60] P.E. Sijens, K.T. Verbruggen, M. Oudkerk, F.J. van Spronsen, R.J. Soorani-Lunsing, 1H MR spectroscopy of the brain in Cr transporter defect., Mol. Genet. Metab. 86 (2005) 421–2. [61] M. Tachikawa, J. Fujinawa, M. Takahashi, Y. Kasai, M. Fukaya, K. Sakai, et al., Expression and possible role of creatine transporter in the brain and at the blood-cerebrospinal fluid barrier as a transporting protein of guanidinoacetate, an endogenous convulsant., J. Neurochem. 107 (2008) 768–78. [62] C. Carducci, its precursors by cerebellar granule cells and astrocytes suggests some hypotheses on the physiopathology of the inherited disorders of creatine metabolism, BMC …. 13 (2012) 41. [63] M. Tachikawa, J. Fujinawa, M. Takahashi, Y. Kasai, M. Fukaya, K. Sakai, et al., Expression and possible role of creatine transporter in the brain and at the blood-cerebrospinal fluid barrier as a transporting protein of guanidinoacetate, an endogenous convulsant., J. Neurochem. 107 (2008) 768–78. [64] D.M. McGuire, M.D. Gross, J.F. Van Pilsum, H.C. Towle, Repression of rat kidney Larginine:glycine amidinotransferase synthesis by creatine at a pretranslational level., J. Biol. Chem. 259 (1984) 12034–8. [65] L. Almeida, G. Salomons, F. Hogenboom, Exocytotic release of creatine in rat brain, Synapse. 123 (2006) 118–123. [66] G.E. Torres, R.R. Gainetdinov, M.G. Caron, Plasma membrane monoamine transporters: structure, regulation and function., Nat. Rev. Neurosci. 4 (2003) 13–25. [67] J.M. Van De Kamp, C. Jakobs, New insights into creatine transporter deficiency : the importance of recycling creatine in the brain, (2013) 155–156. [68] D. Willoughby, Creatine Supplementation in Strength-Power Sports, in: J. Stout, J. Antonio, D. Kalman (Eds.), Essentials Creat. Sport. Heal. SE - 2, Humana Press, 2008: pp. 25–44. [69] J. Cramer, Creatine Supplementation in Endurance Sports, in: J. Stout, J. Antonio, D. Kalman (Eds.), Essentials Creat. Sport. Heal. SE - 3, Humana Press, 2008: pp. 45–99. [70] M. a Tarnopolsky, M.F. Beal, Potential for creatine and other therapies targeting cellular energy dysfunction in neurological disorders., Ann. Neurol. 49 (2001) 561–74. [71] M. Wyss, A. Schulze, Health implications of creatine: canoral creatine supplementation protect against neurological and artherosclerotic disease?, 112 (2002) 243–260. [72] J.T. Brosnan, M.E. Brosnan, Creatine: endogenous metabolite, dietary, and therapeutic supplement., Annu. Rev. Nutr. 27 (2007) 241–61. 26 [73] M. Bianchi, M. Tosetti, Treatment monitoring of brain creatine deficiency syndromes: a 1H-and 31P-MR spectroscopy study, Am. J. …. (2007) 1–7. [74] R. Battini, M.G. Alessandrì, V. Leuzzi, F. Moro, M. Tosetti, M.C. Bianchi, et al., Arginine:glycine amidinotransferase (AGAT) deficiency in a newborn: Early treatment can prevent phenotypic expression of the disease, J. Pediatr. 148 (2006) 828–830. [75] A. Schulze, R. Battini, Pre-symptomatic treatment of creatine biosynthesis defects., Subcell. Biochem. 46 (2007) 167–81. [76] A. Schulze, E. Mayatepek, P. Bachert, B. Marescau, P.P. De Deyn, D. Rating, Therapeutic trial of arginine restriction in creatine deficiency syndrome, Eur. J. Pediatr. 157 (1998) 606–607. [77] A. Schulze, P. Bachert, H. Schlemmer, I. Harting, T. Polster, G.S. Salomons, et al., Lack of creatine in muscle and brain in an adult with GAMT deficiency., Ann. Neurol. 53 (2003) 248–51. [78] S. Stockler-Ipsiroglu, C. van Karnebeek, N. Longo, G.C. Korenke, S. Mercimek-Mahmutoglu, I. Marquart, et al., Guanidinoacetate methyltransferase (GAMT) deficiency: Outcomes in 48 individuals and recommendations for diagnosis, treatment and monitoring., Mol. Genet. Metab. 111 (2014) 16–25. [79] S. Mercimek-Mahmutoglu, M.B. Connolly, K.J. Poskitt, G. a Horvath, N. Lowry, G.S. Salomons, et al., Treatment of intractable epilepsy in a female with SLC6A8 deficiency., Mol. Genet. Metab. 101 (2010) 409–12. [80] V. Valayannopoulos, N. Boddaert, A. Chabli, V. Barbier, I. Desguerre, A. Philippe, et al., Treatment by oral creatine, L-arginine and L-glycine in six severely affected patients with creatine transporter defect., J. Inherit. Metab. Dis. 35 (2012) 151–7. [81] L. Perasso, G.L. Lunardi, F. Risso, A. V Pohvozcheva, M. V Leko, C. Gandolfo, et al., Protective effects of some creatine derivatives in brain tissue anoxia., Neurochem. Res. 33 (2008) 765– 75. [82] L. Perasso, E. Adriano, P. Ruggeri, S. V Burov, C. Gandolfo, M. Balestrino, In vivo neuroprotection by a creatine-derived compound: phosphocreatine-Mg-complex acetate., Brain Res. 1285 (2009) 158–63. [83] A. Trotier-Faurion, S. Dézard, F. Taran, V. Valayannopoulos, P. de Lonlay, A. Mabondzo, Synthesis and Biological Evaluation of New Creatine Fatty Esters Revealed Dodecyl Creatine Ester as a Promising Drug Candidate for the Treatment of the Creatine Transporter Deficiency, J. Med. Chem. 56 (2013) 5173–5181. [84] P. Garbati, E. Adriano, A. Salis, S. Ravera, G. Damonte, E. Millo, et al., Effects of amide creatine derivatives in brain hippocampal slices, and their possible usefulness for curing creatine transporter deficiency., Neurochem. Res. 39 (2014) 37–45. [85] Y. Kurosawa, T. DeGrauw, Cyclocreatine treatment improves cognition in mice with creatine transporter deficiency, J. Clin. …. 122 (2012) 2837–2846. 27 [86] B.N. La Du, H. Snady, Handbook of Experimental Pharmacology, in: B.B. Brodie, J.R. Gillette, H.S. Ackerman (Eds.), Concepts Biochem. Pharmacol., Springer Berlin Heidelberg, 1971: pp. 477–499. [87] G. Lunardi, a Parodi, L. Perasso, a V Pohvozcheva, S. Scarrone, E. Adriano, et al., The creatine transporter mediates the uptake of creatine by brain tissue, but not the uptake of two creatinederived compounds., Neuroscience. 142 (2006) 991–7. [88] E. Adriano, P. Garbati, G. Damonte, a Salis, a Armirotti, M. Balestrino, Searching for a therapy of creatine transporter deficiency: some effects of creatine ethyl ester in brain slices in vitro., Neuroscience. 199 (2011) 386–93. [89] C. Fons, a Arias, a Sempere, P. Póo, M. Pineda, a Mas, et al., Response to creatine analogs in fibroblasts and patients with creatine transporter deficiency., Mol. Genet. Metab. 99 (2010) 296–9. 28 29 Chapter 2 Developmental progress and creatine restoration upon long-term creatine supplementation of a patient with arginine:glycine amidinotransferase deficiency "It’s not that I’m so smart, it’s just that I stay with problems longer" Albert Einstein 30 31 Molecular Genetics and Metabolism Developmental progress and creatine restoration upon long-term creatine supplementation of a patient with arginine:glycine amidinotransferase deficiency Joseph D.T. Ndika a, 1, Kathreen Johnston b, 1, James A. Barkovich c, Michael D. Wirt d, Patricia O'Neill e, Ofir T. Betsalel a, Cornelis Jakobs a,⁎, Gajja S. Salomons a a Metabolic Unit, Department of Clinical Chemistry, VU University Medical Center, Amsterdam, The Netherlands Genetics Department, Kaiser Permanente, San Francisco, CA, USA Departments of Radiology and Biomedical Imaging, Neurology, and Pediatrics, University of California, San Francisco, CA, USA d Clinical Services Blanchfield Army Community Hospital, Fort Campbell, KY, USA e Rehabilitation Services Department, Kaiser Permanente, San Francisco, CA, USA b c a r t i c l e i n f o Article history: Received 22 December 2011 Received in revised form 19 January 2012 Accepted 19 January 2012 Available online 27 January 2012 Keywords: AGAT Creatine deficiency Developmental delay Creatine supplementation a b s t r a c t Background: Arginine:glycineamidinotransferase (AGAT/GATM) deficiency has been described in 9 patients across 4 families. Here we describe the clinical outcome and response to creatine supplementation in a patient of the second family affected with AGAT deficiency—a 9-year-old girl. Patient and methods: Delayed motor milestones were noticed from 4 months of age and at 14 months moderate hypotonia, developmental delay and failure to thrive. Laboratory studies revealed low plasma creatine as well as extremely low levels of guanidinoacetic acid in urine and plasma. Proton magnetic resonance spectroscopy (MRS) of the brain showed absence of creatine. DNA sequence analysis revealed a homozygous mutation (c.484+ 1 G > T) in the AGAT/GATM gene. AGAT activity was not detectable in lymphoblasts and RNA analysis revealed a truncated mRNA (r.289_484del196) that is degraded via Nonsense Mediated Decay. At 16 months, Bayley's Infant Development Scale (BIDS) showed functioning at 43% of chronologic age. Oral creatine supplementation (up to 800 mg/kg/day) was begun. Results: At age 9 years she demonstrated advanced academic performance. Partial recovery of cerebral creatine levels was demonstrated on MRS at 25 months of age. Brain MRS at 40 months of age revealed a creatine/NAA ratio of about 80% of that in age-matched controls. Conclusions: 8 years post initiation of oral creatine supplementation, patient demonstrates superior nonverbal and academic abilities, with average verbal skills. We emphasize that early diagnosis combined with early treatment onset of AGAT deficiency may lead to improvement of developmental outcome. © 2012 Elsevier Inc. All rights reserved. 1. Introduction Creatine deficiency syndromes (CDS) are a set of inborn errors of metabolism whose common biochemical feature is the absence of creatine/phosphocreatine in the brain. Clinical manifestations are often characterized by intellectual disability, speech and language delay, autistic-like behavior and epilepsy [1]. Biosynthesis of creatine begins with the synthesis of guanidinoacetic acid (GAA) from arginine and glycine by L-argine:glycineamidinotransferase (AGAT; OMIM 602360). Creatine is then synthesized by the transfer of a methyl group from S-adenosyl methionine to GAA by guanidinoacetate methyl transferase (GAMT; OMIM 601240). Biosynthesized or dietary creatine is taken up via the creatine transporter (CTR), encoded ⁎ Corresponding author at: Department of Clinical Chemistry, VU University Medical Center Amsterdam, De Boelelaan 1117, PK 1X 014, 1081 HV Amsterdam, The Netherlands. Fax: +31 20 4440305. E-mail address: [email protected] (C. Jakobs). 1 Contributed equally. 1096-7192/$ – see front matter © 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.ymgme.2012.01.017 for by the SLC6A8 gene (OMIM 300036). Genetic deficiencies in either the creatine biosynthesis enzymes or transporter protein result in CDS [2–4]. Treatment of creatine biosynthesis defects leads to improvement in movement disorder, epilepsy and developmental progress. The treatment of GAMT deficiency consists of creatine and ornithine supplementation and an arginine restricted diet; and AGAT deficiency is treated with creatine supplementation alone, whereas no successful treatment strategy yet exists for SLC6A8 deficiency. AGAT (official HGNC symbol is GATM, however to avoid confusion we refer to it as AGAT—as used in all previously reported patients) and GAMT deficiencies are autosomal recessive disorders, and SLC6A8 deficiency is an X-linked disorder. AGAT deficiency is the least frequently reported of the three disorders, with a total of nine patients from four families [3,5–11]. We report here the diagnostic work-up and long-term outcome of the creatine supplementation therapy in the second family diagnosed with AGAT deficiency [8,9]. Additionally we review all patients with AGAT deficiency reported in the literature and developed a novel database—the Leiden Open Variation Database 32 Table 1 RT-PCR primer sequences. No. Forward/reverse sequence 1 2 mRNA AGAT location Amplicon size (bp) 5′TACATCGGATCTCGGCTTGG 3′ AGAT Exon 1/Exon 2 Wild type: 716 5′TCAGCAGCATCAAAGCATGGC 3′ Exon 5 ΔExon 3: 520 5′GCTGGTGATGTGAGCTGAGT 3′ GAPDH – Wild type: 819 5′TCAAGGCTGAGAACGGGAAGC 3′ (LOVD), to include genetically relevant data of all patients (http:// www.LOVD.nl/GATM). 2. Case report: diagnosis and treatment This 9-year-old girl was born at term after an uneventful pregnancy to non-consanguineous parents of Chinese ancestry. Gross motor delay was first noted at 4 months of age when she was not pushing up when placed in prone position. She started sitting with support at 6 months and sat independently at 9 months. Upon evaluation at 10 months of age, she had moderate central hypotonia. She sat independently but did not have appropriate righting responses when she began to fall, and bore weight when held vertically by locking her knees. Poor weight gain was also noted. 4 months later she was evaluated for developmental delay. She stood with support but did not cruise, and could not independently get to a sitting position. She transferred objects hand to hand and said consonant sounds such as “mama” non-specifically. Physical examination revealed weight 7.76 kg (below 5th percentile), length 69.5 cm (below 5th percentile) and head circumference at 5th–10th percentiles. She had moderate diffuse hypotonia. Her deep tendon reflexes were normal. She had a unilateral single palmar flexion crease and unilateral preauricular skin tag. 2.1. Laboratory diagnosis Laboratory analysis revealed moderate generalized organic aciduria (2–5 times the upper limits of normal), a hallmark of low creatinine excretion; thus a creatine synthesis defect was considered. Urinary and plasma guanidinoacetate (GAA) were markedly reduced (0.22 mmol/mol creatinine; ref 53.9 ± 26.9 SD and 0.07 μM; control 1.34 ± 0.64 SD respectively) with very low creatine in plasma (2.3 μM; control 75.6±21.6 SD); all measured as previously described [12]. This result suggested AGAT deficiency. DNA sequence analysis of the AGAT gene revealed a novel homozygous mutation—c.484 + 1 G > T. This mutation as predicted by Alamut™ software causes the A 1 RT - 2 + - - 2.2. Creatine supplementation: dosage, cerebral replenishment, side effects The initial creatine dose was 400 mg/kg/day, corresponding to 15–20 times the daily creatine requirement. Throughout therapy, the oral creatine dose has varied from 400 to 800 mg/kg/day (Fig. 2). Dosing adjustments were based on evaluation of cerebral creatine content, serum creatine levels, urine exams and clinical status including developmental progress. Proton MR spectroscopy data were acquired from a 2 × 2 × 2 cm voxel that included frontal white matter and basal ganglia in the left cerebral hemisphere. It revealed an increase in cerebral creatine content when measured prior to and post treatment onset (Fig. 2). However, the brain creatine content was essentially unchanged at 55–60% of normal between 8.5 and 17 months of therapy (25 to 34 months of age). In an effort to improve brain creatine content and developmental outcome, the creatine dose was gradually increased from 400 to 800 mg/kg/day over 4 weeks beginning at 34 months of age. Repeat brain MRS 5 months later showed improvement in brain creatine/ NAA from approximately 60% to 80% of normal. She was noted however to have 4+ creatinine crystals for the first time in her urine. To avoid possible renal toxicity, the creatine dose was decreased to 400 mg/kg/day for 1 month and then increased back to 500 mg/kg/ day. The family was advised to increase fluid intake. There has been B 3 + erroneous splicing of exon 3. AGAT enzyme activity was not detectable in cultured lymphoblasts [13]. Both parents are heterozygous for this same mutation. In order to confirm erroneous splicing in patient's mRNA, RT-PCR was performed (see Table 1 for primer sequences). RNA was isolated from the patient's lymphoblasts using the SV Total RNA Isolation System (PROMEGA). Following cDNA synthesis the general PCR conditions were as follows: initial denaturation cycle of 15 min at 95 °C; followed by 38 cycles of 45 s at 94 °C, 45 s at 61 °C, and 1 min at 72 °C; and a final extension of 10 min at 72 °C. Direct sequencing was performed on purified PCR products by use of BigDye Terminator v3.1 and an ABI 3100 sequence machine (PE Applied Biosystems). The obtained electropherograms were analyzed by use of the Mutation Surveyor™ software package (SoftGenetics). This confirms a truncated mRNA lacking exon 3—r.289_484del196, which predicts the substitution of alanine at position 97 by valine and an alternative reading frame that ends in the 11th codon of exon 4 (p.Ala97ValfsX11). The truncated mRNA is subjected to nonsense mediated decay (NMD) as it is only faintly detectable on RNA samples obtained from AGAT deficient lymphoblasts cultured with cycloheximide (250 μg/mL). This is in contrast to control mRNA isolated from lymphoblasts cultured without cycloheximide (Figs. 1A/B). + blank p.= (GATM) 716 bp 1 2 3 1 2 4 4 5-8 9 AGAT 819 bp GAPDH 5-8 9 p.Ala97ValfsX11 Fig. 1. Identification of truncated AGAT transcript as well as confirmation of nonsense mediated decay (NMD) in AGAT deficient lymphoblasts by RT-PCR. (A) Prior to RNA isolation, patient's lymphoblast cells were either treated without (1) or with (2) cycloheximide. Lymphoblasts of control (3) were not treated with cycloheximide. The control cell line shows expected fragment size (716 bp), while the cycloheximide-treated cells show low expression of the truncated AGAT mRNA (control Δ exon 3: 520 bp). In the absence of cycloheximide treatment no AGAT mRNA could be detected (1). In PCR reactions that lacked Reverse Transcriptase (RT) (−) no GAPDH or AGAT amplicons were present indicating that the RNA was not contaminated with gDNA. (B) Fig. 1B shows a scheme of the consequences of the splice site mutation (c.484 + 1 G > T) as revealed by RT-PCR and sequence analysis. Wild type AGAT mRNA is translated from exon 1–9 (upper transcript). Due to the canonical splice site mutation exon 3 is skipped resulting in a frameshift with Ala 97 being the first replaced amino acid by Val and a new reading frame which leads to a premature stop codon in exon 4 (lower transcript). 33 A B NAA Cho Oral creatine dose vd Cr/NAA ratio in WM 1 Oral creatine dose (mg/kg/d) 800 Cr/NAA ratio 0.25 700 2 8 months Cr treatment 3 17 months Cr treatment 4 23 months Cr treatment 0.2 600 500 0.15 400 Cr/NAA ratio Oral Cr Dose (mg/kg/d) Prior to treatment Cr 0.3 900 0.1 300 200 0.05 100 0 0 2 3 3.5 8.5 9 9.5 11 13 17 17.5 18.5 19.5 22 23.5 Months of therapy 0 4 3 2 1 0 Fig. 2. Creatine Restoration in AGAT Deficient Patient. (A) Oral Creatine Dose vs Cr/NAA Ratio. Treatment efficacy was monitored by measuring brain creatine before treatment and at intermittent creatine doses following creatine supplementation. (B) Single voxel long echo (TE = 288 ms) frontal white matter proton magnetic resonance spectra were acquired at 1.5 T. (1) Initial MR spectrum collected prior to oral creatine supplementation at age 16.5 months. Note the absence of the creatine resonance at 3.02 ppm consistent with the diagnosis of AGAT deficiency. (2–4) The creatine resonance at 3.02 ppm demonstrates a progressive increase in peak area over 23 months of oral creatine supplementation, but remains below normal levels. no evidence of gastrointestinal disease or malabsorption. As urine specimens continued to be negative for crystals, 31 months after initiating therapy the dose was increased to 600 mg/kg/day and then to 700 mg/kg/day 2.5 months later. She has remained on this dose since then (50 months chronologic age and at 33.5 months of therapy). Urinalysis has been monitored every 3–6 months, and has been normal except for intermittent appearance of crystals on rare occasions. Kidney function tests and renal ultrasounds performed every 6 months showed no abnormalities, except for one occasion—6 years and 9 months into therapy, when blood creatinine was 0.81 mg/dL (reference range 0.3–0.7). Repeat creatinine measurements 1, 2, and 9 months later were normal—most recently 0.62 mg/dL. 2.3. Occupational, physical and speech-language therapy From age 16 months she received occupational and physical therapy for global developmental delay. But because of improvements in her developmental milestones following creatine supplementation, both services were discontinued at age 24 months (7.2 months into creatine therapy). At 20 months of age, 3 months into creatine therapy, she babbled but did not say mama or dada specifically. A further evaluation at age 26 months revealed a delay in comprehensive and expressive language skills of 2 to 6 months. A month later speech therapy was introduced in conjunction with continued creatine supplementation. She received speech-language therapy throughout (except for a long break from age 54 to 63 months) until discontinued at age 9.25 years. 2.4. Developmental progress (Table 2) Neuropsychological assessment showed greatly improved functioning on the Bayley Scales of Infant Development, second edition (BSID II) from 43% at diagnosis to 100% 23 months into creatine therapy. BSID-II scores of 100 ± 15 represent the mean ± 1SD; score ≤70 is 2SDs below the mean. Patient continued to demonstrate strengths in her cognitive and academic development even though there was a significant discrepancy between verbal and nonverbal abilities (WPPSI-III test). She scored in the bottom of the average range on verbal subtests (Verbal IQ-91), and in the high average to superior range on nonverbal tests of intellectual ability (Performance IQ-112). She also scored in the very superior range on tests of purely nonverbal skills (Toni-3 and Leiter Tests). Formal IQ testing has not been repeated since age 5 years. At age 9 years (7.5 years of therapy) educational assessments according to School District of California Standardized Testing (State target for all students is 350–600) revealed the following results: English-Language Arts score of 424 (advanced is 402–600), Mathematics score of 506 (advanced is 414–600). She has been in regular preschool and elementary school classes. There have been no behavioral difficulties, and no evidence of attention deficit hyperactivity disorder or autistic spectrum disorder. The child is cooperative, friendly, and delightful. 2.5. Language development (Table 2) Upon diagnosis at age 16 months patient demonstrated comprehensive and expressive language skills in the 6–12 months range. She indicated needs with vocalization and used vowel and consonant sounds non-specifically. Contribution of creatine supplementation and speech therapy to patient's language development were evaluated using a number of tests from age 36 to 104 months. In terms of expressive language the patient has shown an overall improvement in her rate of single word recall from long-term memory (EOWPVT test [14]), despite an unusual variable pattern of progression. Her pragmatic use of language as noted by observation is improved for initiation of conversation, answering and inquiring. Concerning her receptive language, she showed consistent average performance on the basic concept subtest (CELF tests [15]), important to the follow-through of verbal instructions, from the 49th percentile at age 75 months to the 58th percentile at age 104 months. Despite the patient's tendency to lose skill development in one area (reasoning and thinking) of receptive language, as she gained in another (recognition of the main idea, story comprehension), her collective scores on the Listening Test [16] did reflect consistent growth from >7 months delay at age 75 months down to 6 months delay at age 34 Table 2 Summary of developmental and speech tests carried out during the course of therapy. Symptom assessed Developmental progress Chronologic age Duration of creatine Test Scores (and Percentiles) (months) suppl. (months) and age equivalents (months) 16 0 BSID-II Mental scale N/A(1) 7 Motor scale N/A(1) 29 12.2 BSID-II 67(1) 23 80(9) 25 40 23.2 BSID-II 96(39) 40−42 101(53) 40-42 19.2 WPPSI-III Full scale IQ 94(34) Performance IQ 100(50) Verbal IQ 36 47 30.2 WPPSI-III 107(34) 107(25) 60 43.2 WPPSI-III 104(61) 105(50) 112(79) 47 30.2 Leiter 140 60 43.2 Leiter 145 60 43.2 Toni-3 135 Age equiv. Age equiv. Uncorrected Nonverbal Ratio IQ** Age equiv. 7 90(25) 91(27) (Mean=100, SD=16) Nonverbal Ratio IQ (Mean =100, SD = 16) Expressive language 41 24.2 EOWPVT Standard score 98(45) development 47 30.2 EOWPVT 90(25) 39 60 43.2 EOWPVT 112(79) 73 92 75.2 EOWPVT 89(23) 78 99 82.2 EOWPVT 98(45) 95 104 87.2 EOWPVT 103(58) 110 39 Comprehensive language 61 44.2 CELF-P2 Standard score: Core language* 96(36) development 69 52.2 CELF-P2 102(55) 77 60.2 CELF-4 96(39) 85 68.2 CELF-4 99(47) 75 58.2 LT Standard score 89(23) <68 83 66.2 LT 99(49) 77 104 87.2 LT 102(46) 100 Score Age equiv. th 5 grade 104 87.2 LAC 93 Age equiv. Sub-Listening Test scores (and Percentiles) Chronologic age (months): 75 83 104 Main idea Details 83(12) 90(27) 106(58) 87(49) 117(84) Concepts 97(49) 107(66) 92(29) 105(58) Reasoning 96(43) 90(28) 91(26) Story comprehension 81(12) 90(28) 110(70) BSID-II: Bayley's Scale of Infant Development - II CELF-4: Clinical Evaluation of Language Fundamentals -4 WPPSI-III: Wechsler Preschool and Primary Scale of Intelligence -III LT: Listening Test EOWPVT: Expressive One Word Picture Vocabulary Test LAC : Lindamood Auditory Conceptualization Test CELF-P2: Clinical Evaluation of Language Fundamentals - Preschool 2 +/− : with or without speech language therapy *Combined result of both expressive and receptive language subtests **Uncorrected Nonverbal Ratio IQ is derived using norms that were published in 1968 and overestimate Nonverbal IQ when used in the year 2007 83 months and 4 months delay at age 104 months. Finally her phonemic processing was quantified using the Lindamood Auditory Conceptualization test (LAC)—a criterion referenced tool giving only grade level equivalencies. The patient did well, scoring at a 5th grade equivalency which was 2 years advanced beyond her actual 3rd grade level at the time. Speech-language therapy continued once a week until 9.25 years of age notwithstanding her low average to average performance on speech-language evaluations, because of the relative weakness of her verbal skills compared to her nonverbal skills. 3. Discussion Oral creatine supplementation in creatine biosynthesis deficiencies (AGAT and GAMT deficiencies), as opposed to creatine uptake deficiency (SLC6A8 deficiency), results in a better developmental outcome. AGAT deficiency patients have a less severe phenotype and a more favorable response to treatment compared to GAMT deficiency patients, possibly due to the neurotoxic effect(s) of elevated guanidinoacetate in GAMT deficiency patients [17]. At the time of treatment onset in our patient little was known about the optimum 35 creatine dose, so the goal was to titrate creatine supplementation to maximize the cerebral creatine level and developmental progress while avoiding side effects. Although creatine is generally considered safe, there is theoretic concern that long-term high-dose creatine treatment may be harmful to kidney function. No renal impairment has been observed in treated patients, however. Reported pharmacologic creatine dosage ranges from 350 to 2000 mg/kg/day [5,18–20]. A dose of 15–20 times the daily creatine requirement (corresponding to 350–400 mg/kg/day in children) does not induce side effects in healthy adult volunteers [18]. Renal toxicity has been reported occasionally in individuals taking creatine as a supplement to enhance athletic performance. A gradual nephrotoxicity, usually tubular, from excess crystal excretion might rarely occur. If oral fluid intake is not adequate, renal damage from crystals could occur. However direct glomerular toxicity from creatine is unproven. Lack of significant improvement in cerebral creatine content between 8 and 17 months of treatment on the 400 mg/kg/day creatine dose was concerning. After doubling the creatine dose to 800 mg/ kg/day, brain Cr/NAA by 23 months of treatment increased from 60% to 80%, and developmental scores increased from 80% (after 13 months of treatment) to 100% of that expected for chronologic age. Although the high dose of 800 mg/kg/day creatine appeared to be effective in improving brain creatine content and developmental outcome, it was reduced to 500 mg/kg/day and then gradually increased, because of presence of urinary creatinine crystals for a short period. Since 50 months of age the patient has been treated with a creatine dose of 700 mg/kg/day. Despite possible nephrotoxicity, the high creatine dose has been continued as the child has done very well developmentally. She has exhibited no side effects on this creatine dose, and creatinine crystals have not recurred (except on rare occasions). The brain MRS has not been repeated since 40 months of age for two reasons. First, the main goal of treatment is developmental outcome, which has generally been excellent. It is not clear that increasing cerebral creatine content above 80% would further improve developmental outcome. Secondly, there is a paucity of data on normal brain creatine values in age-matched controls. The direct effect of speech-language therapy on language development in creatine deficient patients has not been previously assessed. Given the patient's overall average performance on recent speech and language evaluations, and that review of the data suggests that the previous break (from age 54 to 63 months) in speech therapy was not associated with any significant deterioration in her progress, the decision has been made recently to discontinue speech therapy for 6 months and reassess her progress after this period. Table 3 Key features of all described AGAT patients: diagnosis, treatment and response. Features Family 1 Family 2 Family 3 Family 4 Reference Bianchi et al. (2000); Item et al. (2001); Present study. Edvardson et al. (2010). A Verma (2010). 2 c.1111dup ; p.(Met371AsnfsX6) ♂ Depleted 18 years ♀ Depleted 12 years 2 c.505C > T ; p.(R169X) ♀ N 18 years ♂ N 23 years Battini et al. (2002, 2006) General Number of patients Mutation Sex Brain creatine prior to treatment Age at diagnosis 4 c.446G > A ; p.(W149X) ♀ Depleted 4 years ♀ Depleted 6 years ♂ Depleted 3 weeks ♂ Depleted 2 years 1 c.484 + 1G > T; p.Ala97ValfsX11 ♀ Depleted 1.4 years Symptoms at diagnosis Cognitive disability or delay Seizures Expressive speech/Language delay Behavioral problems Muscle weakness + *+ + + − + − + + − NA − NA − − + − + + Mild + − + − Moderate + − + − + + − + − + + − + − + + − + − + Treatment (creatine suppl.) Start of treatment Dose (mg/kg/day) 4.3 years 400 6.4 years 400 4 months 100 2 years 400 1.4 years 400-800 18 years 100 12 years 100 18 years 400 1 20 years 5 g/day 2 Clinical response (Treatment Eff.) Duration (months) Brain creatine after treatment 16 >95% 16 >95% 8 60% 15 90% 102 ~ 80%3 11 18% 11 70% 6 65% ~ 36 66% 42↗68 57↗62% c 77 ↗ N N N a b c 60↗77% ↗ d 65↔65 N N a 105 NA NA Normal NA NA NA ↗ N N N normal 104 91 112 ↔ f 47↔49 f 53↔55 f 50↔50 ↗ g 60↗70 g 66↗71 g 59↗72 N N N ↗ N N N N N N ↗ N N N ↗ normal ↗ normal N normal ↗ N normal normal N ↗ N ↗ ↗ ↗ N ↗ Clinical response (Symptoms) Cognitive function Performance (Developmental) Eye-hand coordination Visual-perceptual abilities Expressive speech Full scale IQ scores Verbal IQ scores Performance IQ scores General Behavior or speech Muscle strength a a +: present −: absent *: single episode at 18 months NA: not applicable N: not determined/available 1: initial dose of 5g/day 2: not measured prior to treatment 3: 23 months post creatine supplementation b50↗63 100% a: Griffith Developmental Scales b: Bayley Infant Development Scale (at 40 months) c: Visual Motor Integration Test d: Leiter International Performance Scale e: Wechsler Preschool and Primary Scale of Intelligence f: Wechsler Adult Intelligence Scale g: Wechsler Intelligence Scale for Children >95%: almost complete ↗: improved ↔: unchanged %: with respect to normal 36 A LOVD - Leiden Open Variation Database L-arginine:glycine amidinotransferase, nuclear gene encoding mitochondrial (GATM) Curator: Gajja Salomons Home Variants V iew unique variants Submitters Submit Documentation Searc h unique variants V iew all c ontents Full databas e s earc h V ariant lis ting bas ed on patient origin D atabas e s tatis tic s Switc h gene LOVD - Variant listings Unhide all columns | Hide Specif ic Columns | Hide all columns Exon DNA change RNA change Protein change 03 c .4 4 6 G > A (Reported 2 times) r .( ? ) p .( T r p 1 4 9 X ) - Bianchi 2000 04 c .5 0 5 C >T (Reported 2 times) r .( ? ) p .( A r g 1 6 9 X ) - Verma 2010 08 c .1 1 1 1 dup (Reported 2 times) r .( ? ) p . ( Met371AsnfsX6) - Edvardson 2010 c .4 8 4 +1 G >T (Reported 2 times) r.289_484del196 p.A la9 7 V alfs X1 1 Ref erence T his variant is a proven pathogenic mutation s inc e erroneous s plic ing was demons trated 5’UTR 1 2 3 4 5 6 c. 11 11 du p; p. (M c. 44 c. 6G> 48 A c. 4+ ; p 50 1G .( T 5C > rp >T T; p 14 ; p .A 9X .(A la9 ) rg 7V 16 a 9X lfsX ) 11 B Salomons 2005 et 37 1A sn fs X6 ) 03i Variant remarks 7 8 9 3’ UTR 400 bp 100 bp Fig. 3. Screenshot of the newly developed LOVD/GATM database (A), and a schematic representation of the AGAT/GATM gene and its pathogenic variants (B). References for each mutation as well as key clinical descriptions for every patient as a result of the said mutation are summarized in Table 3. Thus far, 9 patients affected with AGAT deficiency from 4 unrelated families have been described. In the present paper clinical and treatment data on these patients are summarized (Table 3). The age at diagnosis varies between 3 weeks and 23 years. In a male sibling of the first AGAT deficient patients the disease onset was prevented by initiating creatine supplementation a few months after birth [7]. However, in all the other patients seen so far cognitive disability or delay and speech/language delay are the most common phenotypic manifestations of AGAT deficiency and as such can be used to monitor the disease (in case of a relapse) or treatment progress. Based on the dose of creatine used in all the other AGAT deficiency patients (Table 3), it is possible that developmental outcome in the present case would have been as successful on a lower dose of creatine, and that her cerebral creatine content would have gradually increased to the same level on the lower creatine dose. Recently, long-term follow up (7 to 10 years) has been reported in patients of the first family wherein an initial dose of 400 mg/kg/day and a gradual decrease to 100 mg/kg/day has been sufficient to enable clinical improvement in adaptive behavior and communicative skills [21]. The time course of 23 months required to achieve a Cr/NAA of 80% of normal in our case is similar to what has been observed in patients with GAMT deficiency, but longer than observed for the AGAT deficiency patients in the first reported family [5,6]. It is not clear whether the excellent outcome in the present case with respect to the other symptomatic patients (Table 3) is due to the high dose of creatine, the early implementation of treatment, the long duration of treatment, or a combination thereof. Moreover it is of note that all reported mutations are severe mutations that result in (or predict) truncated proteins (Fig. 3) therefore the more favorable response in our patient is unlikely to be genotype specific. More research will be required to further determine the optimum creatine dose required to treat AGAT deficiency. For now it seems an initial dose of 400 mg/kg/day is appropriate. Dose increase up to 700 mg/kg/day may be considered to optimize cerebral creatine content and developmental outcome, and appears to be well tolerated in the present case. Alternatively, dose decrease can also be considered. The creatine dose of 100 mg/kg/day has also been associated with good clinical outcome and cerebral creatine replenishment in one patient treated since early infancy [22]. The genetic data of all patients have been included in the newly developed LOVD database (http://www. LOVD.nl/GATM) to provide a flexible and freely available tool for collection and display of DNA variations (Fig. 3). 4. Conclusion We describe here outcome in a patient with AGAT deficiency treated for 8 years. The initial developmental outcome of our patient is better than the older sibling in the first family reported [3,5–7], in whom treatment did not begin until 5 years of age, even though the brain creatine recovery in this patient is better than that of our patient. Our initial experience in treating this patient with creatine deficiency secondary to AGAT deficiency adds important information to the experience from the previously reported cases. Initial treatment from 16 months of age confirms that early diagnosis and treatment may be associated with excellent neurodevelopmental outcome. The longterm follow-up of the patient described in this report adds further evidence to the importance of early diagnosis/treatment onset of patients with AGAT deficiency. Efficient cataloguing of all identified variants as well as long-term follow-ups of all patients will be very useful in unraveling the pathophysiology of the disease. The creatine dose of 700 mg/kg/day used in this patient over 5 years has been effective with no apparent side effects. Acknowledgements The authors would like to thank Drs. Lauren Plawner, Sheldon Orloff, Annette Finkel and Peter Kim for their excellent clinical care, Linda 37 Cooper MS for her compassionate skillful genetic counseling and assistance with the manuscript, and the parents for their extraordinary diligence and devotion in the raising of this talented and remarkable child. References [1] S. Stöckler-Ipsiroglu, G.S. Salomons, Inborn metabolic diseases: diagnosis and treatment, Mol. Cell. Biochem. 244 (2006) 211–217. [2] S. Stöckler, D. Isbrandt, F. Hanefeld, B. Schmidt, K. von Figura, Guanidinoacetate methyltransferase deficiency: the first inborn error of creatine metabolism in man, Am. J. Hum. Genet. 58 (1996) 914–922. [3] C.B. Item, S. Stöckler-Ipsiroglu, C. Stromberger, A. Mühl, M.G. Alessandrì, M.C. Bianchi, et al., Arginine:glycine amidinotransferase deficiency: the third inborn error of creatine metabolism in humans, Am. J. Hum. Genet. 69 (2001) 1127–1133. [4] G.S. Salomons, S.J. van Dooren, N.M. Verhoeven, K.M. Cecil, W.S. Ball, T.J. Degrauw, et al., X-linked creatine-transporter gene (SLC6A8) defect: a new creatinedeficiency syndrome, Am. J. Hum. Genet. 68 (2001) 1497–1500. [5] M.C. Bianchi, M. Tosetti, F. Fornai, M.G. Alessandri’, P. Cipriani, G. De Vito, et al., Reversible brain creatine deficiency in two sisters with normal blood creatine level, Ann. Neurol. 47 (2000) 511–513. [6] R. Battini, V. Leuzzi, C. Carducci, M. Tosetti, M.C. Bianchi, C.B. Item, et al., Creatine depletion in a new case with AGAT deficiency: clinical and genetic study in a large pedigree, Mol. Genet. Metab. 77 (2002) 326–331. [7] R. Battini, M.G. Alessandrì, V. Leuzzi, F. Moro, M. Tosetti, M.C. Bianchi, et al., Arginine:glycine amidinotransferase (AGAT) deficiency in a newborn: early treatment can prevent phenotypic expression of the disease, J. Pediatr. 148 (2006) 828–830. [8] K. Johnston , L. Plawner, L. Cooper, G.S. Salomons , N.M. Verhoeven, C. Jakobs, The second family with AGAT deficiency (creatine biosynthesis defect): diagnosis, treatment and the first prenatal diagnosis, ASHG, Annual Meeting P.58 (2005) abstract. [9] G.S. Salomons, K. Johnston, L. Plawner, L. Cooper, J. Barkovich, N.M. Verhoeven, C. Jakobs, The second family with AGAT deficiency (creatine biosynthesis defect): diagnosis treatment and the first prenatal diagnosis, J. Inherit. Metab. Dis. 28 (1) (2005) 445-P (SSIEM Annual Symposium, abstract). [10] S. Edvardson, S.H. Korman, A. Livne, A. Shaag, A. Saada, R. Nalbandian, et al., l-arginine: glycine amidinotransferase (AGAT) deficiency: clinical presentation and response to treatment in two patients with a novel mutation, Mol. Genet. Metab. 101 (2010) 228–232. [11] A. Verma, Arginine:glycine amidinotransferase deficiency: a treatable metabolic encephalomyopathy, Neurology 75 (2010) 186–188. [12] E.A. Struys, E.E. Jansen, H.J. ten Brink, N.M. Verhoeven, M.S. van der Knaap, C. Jakobs, An accurate stable isotope dilution gas chromatographic-mass spectrometric approach to the diagnosis of guanidinoacetate methyltransferase deficiency, J. Pharm. Biomed. Anal. 18 (1998) 659–665. [13] N.M. Verhoeven, D.S.M. Schor, B. Roos, R. Battini, S. Stöckler-Ipsiroglu, G.S. Salomons, et al., Diagnostic enzyme assay that uses stable-isotope-labeled substrates to detect L-arginine:glycine amidinotransferase deficiency, Clin. Chem. 49 (2003) 803–805. [14] R. Brownell, Expressive One-Word Picture Vocabulary Test, third ed. Academic Therapy Publications, Novato California, 2000. [15] E. Semel, E. Wiig, W. Secord, Clinical Evaluation of Language Fundamentals 4, The Psychological Corporation, San Antonio Texas, 2003. [16] M. Barret, R. Huisingh, L. Zachman, C. Blagden, J. Orman, The Listening Test, Linguisystems, Moline Illinois, 1992. [17] F. Nasrallah, M. Feki, N. Kaabachi, Creatine and creatine deficiency syndromes: biochemical and clinical aspects, Pediatr. Neurol. 42 (2010) 163–171. [18] P.L. Greenhaff, A. Casey, A.H. Short, R. Harris, K. Soderlund, E. Hultman, Influence of oral creatine supplementation of muscle torque during repeated bouts of maximal voluntary exercise in man, Clin. Sci. 84 (1993) 565–571. [19] M. Wyss, Health implications of creatine: can oral creatine supplementation protect against neurological and atherosclerotic disease? Neuroscience 112 (2002) 243–260. [20] A. Schulze, Creatine deficiency syndromes, Mol. Cell. Biochem. 244 (2003) 143–150. [21] C.G., R. Battini, C. Casalini, M. Casarano, M.G. Alessandri, V. Leuzzi, Clinical and neuropsyscological follow-up of AGAT-D patients after ten years from the diagnosis. J. Inherit. Metab. Dis. 34(3):P-143 SSIEM Annual Symposium (2011) abstract. [22] M.C. Bianchi, M. Tosetti, R. Battini, V. Leuzzi, M.G. Alessandri’, C. Carducci, et al., Treatment monitoring of brain creatine deficiency syndromes: a 1H- and 31P-MR spectroscopy study, Am. J. Neuroradiol. 28 (2007) 548–554. 38 39 Chapter 3 Thirteen new patients with guanidinoacetate methyltransferase deficiency and functional characterization of nineteen novel missense variants in the GAMT gene "99 percent of all statistics only tell 49 percent of the story" Ron DeLegge II 40 41 RESEARCH ARTICLE OFFICIAL JOURNAL Thirteen New Patients with Guanidinoacetate Methyltransferase Deficiency and Functional Characterization of Nineteen Novel Missense Variants in the GAMT Gene www.hgvs.org Saadet Mercimek-Mahmutoglu,1,2∗ † Joseph Ndika,2 † Warsha Kanhai,2 Thierry Billette de Villemeur,3 David Cheillan,4 Ernst Christensen,5 Nathalie Dorison,6 Vickie Hannig,7 Yvonne Hendriks,8 Floris C. Hofstede,9 Laurence Lion-Francois,10 Allan M. Lund,11 Helen Mundy,12 Gaele Pitelet,13 Miquel Raspall-Chaure,14 Jessica A. Scott-Schwoerer,15 Katalin Szakszon,16 Vassili Valayannopoulos,17 Monique Williams,18 and Gajja S. Salomons2∗ 1 Division of Clinical and Metabolic Genetics, Department of Pediatrics, The Hospital for Sick Children, University of Toronto, Toronto, Canada; Metabolic Laboratory, Department of Clinical Chemistry, VU University Medical Center, Amsterdam, The Netherlands; 3 AP-HP Service de ´ ´ ˆ ´ editaires ´ ´ Neuropediatrie, Pathologie du Developpement, Hopital Trousseau, Paris, France; 4 Service Maladies Her du Metabolisme, Groupement 5 Hospitalier Est, Hospices Civils de Lyon, France; Department of Clinical Genetics, Juliane Marie Center, Copenhagen, Denmark; 6 AP-HP Service ´ ´ ˆ de Neuropediatrie, Pathologie du Developpement, Hopital Trousseau, Paris, France; 7 Division of Medical Genetics and Genomic Medicine, Vanderbilt University Medical Center, Nashville, Tennessee; 8 Department of Clinical Genetics, Free University Medical Center, Amsterdam, The ´ Netherlands; 9 Wilhelmina Children’s Hospital, Utrecht, The Netherlands; 10 Service de Neuropediatrie, Groupement Hospitalier Est, Hospices Civils de Lyon, Bron, France; 11 Department of Clinical Genetics, Centre for Inherited Metabolic Diseases, Copenhagen, Denmark; 12 Evelina Centre for Inherited Metabolic Disease, Goys and St Thomas NHS Foundation Trust, Evelina Children’s Hospital, London, England; 13 Department of Pediatrics, Chulenval, Nice, France; 14 Department of Paediatric Neurology, Hospital Universitari Vall d’Hebron, Barcelona, Spain; 15 Department of Pediatrics, Division of Genetics and Metobolism, University of Wisconsin, Madison, Wisconsin; 16 Institute Pediatrics, Clinical Genetics Center, University of Debrecen, Hungary; 17 Reference Center for Inherited Metabolic Disease, Paris, France; 18 Department of Pediatrics, Sophia Childrens Hospital, Erasmus Medical Center, The Netherlands 2 ´ Sobrido Communicated by Mar´ıa-Jesus Received 16 September 2013; accepted revised manuscript 6 January 2014. Published online 10 January 2014 in Wiley Online Library (www.wiley.com/humanmutation). DOI: 10.1002/humu.22511 ABSTRACT: Guanidinoacetate methyltransferase deficiency (GAMT-D) is an autosomal recessively inherited disorder of creatine biosynthesis. Creatine deficiency on cranial proton magnetic resonance spectroscopy, and elevated guanidinoacetate levels in body fluids are the biomarkers of GAMT-D. In 74 patients, 50 different mutations in the GAMT gene have been identified with missense variants being the most common. Clinical and biochemical features of the patients with missense variants were obtained from their physicians using a questionnaire. In 20 patients, 17 missense variants, 25% had a severe, 55% a moderate, and 20% a mild phenotype. The effect of these variants on GAMT enzyme activity was overexpressed using primary GAMT-D fibroblasts: 17 variants retained no significant activity and are therefore considered pathogenic. Two additional variants, c.22C>A (p.Pro8Thr) and c.79T>C (p.Tyr27His) (the latter detected in control cohorts) are in fact not pathogenic as † ∗ These authors share first authorship. Correspondence to: Saadet Mercimek-Mahmutoglu, FCCMG, Division of Clinical and Metabolic Genetics, Department of Pediatrics, University of Toronto, The Hospital for Sick Children, Toronto, Canada. E-mail: [email protected]; Gajja S. Salomons, Metabolic Unit, Department of Clinical Chemistry, Neuroscience Campus Amsterdam, VU University Medical Center, Amsterdam, The Netherlands. E-mail: [email protected] these alleles restored GAMT enzyme activity, although both were predicted to be possibly damaging by in silico analysis. We report 13 new patients with GAMT-D, six novel mutations and functional analysis of 19 missense variants, all being included in our public LOVD database. Our functional assay is important for the confirmation of the pathogenicity of identified missense variants in the GAMT gene. C 2014 Wiley Periodicals, Inc. Hum Mutat 35:462–469, 2014. KEY WORDS: GAMT; GAMT-D; site-directed mutagenesis; missense variants Introduction Guanidinoacetate methyltransferase deficiency (GAMT-D; MIM #612736) is an autosomal recessively inherited disorder of creatine biosynthesis [Stockler et al., 1996]. Its estimated incidence is 1:114,072 in Utah [Viau et al., 2013] and its carrier frequency was 1/1475 in a small cohort of newborns [Mercimek-Mahmutoglu et al., 2012b]. Creatine has a buffering and transport function of highenergy phosphates in brain and muscle, and is essential for growth cone migration, dendritic and axonal elongation, neurotransmitter release, and cotransmission on GABA postsynaptic receptors in the central nervous system (CNS) [Wallimann et al., 1992; Wyss and Kaddurah-Daouk, 2000; Almeida et al., 2006a]. 42 Creatine deficiency in brain proton magnetic resonance spectroscopy (1 H-MRS), and elevated guanidinoacetate (GAA) levels in urine, blood, and cerebral spinal fluid) are the biochemical hallmarks of GAMT-D [Stockler et al., 1996; Wyss and KaddurahDaouk, 2000]. Clinical features are global developmental delay (GDD) and seizures in infants and intellectual disability, movement disorder, epilepsy, and behavioral problems in children. Hypotonia and gross motor delay together with choreiform movements have been recently reported in a 10-month-old patient with GAMT-D as early presenting symptoms [Viau et al., 2013]. Treatment consists of high-dose creatine and ornithine supplementation, arginine-restricted diet, and sodium benzoate therapy to replenish cerebral creatine deficiency and decreased neurotoxic GAA accumulation in CNS [Schulze et al., 1997; Schulze et al., 2003, MercimekMahmutoglu et al., 2009]. Normal neurodevelopmental outcome have been reported in three patients who were diagnosed and treated in the neonatal period [Schulze et al., 2006; El-Gharbawy et al., 2013; Viau et al., 2013]. Given the effectiveness of early intervention and severe neurodevelopmental outcome in untreated patients, GAMT deficiency is an excellent candidate for newborn screening. So far, 74 patients with GAMT-D have been reported [Cheillan et al., 2012, Dhar et al., 2009; Mercimek-Mahmutoglu et al., 2009, Mercimek-Mahmutoglu et al., 2012a; Nasrallah et al., 2012; Akiyama et al., 2014; Comeaux et al., 2013; El-Gharbawy et al., 2013; Viau et al., 2013]. In these patients, 50 different mutations have been identified in the GAMT gene (MIM #601240) and 64% of them are missense variants. Deletions, splice errors, frame shift, nonsense, and (other) truncating mutations are usually classified as pathogenic mutations. Missense variants pose problems for the interpretation of the pathogenicity. Currently used in silico analyses [e.g., using Sorting Intolerant From Tolerant (SIFT, http://sift.jcvi.org), Polymorphism Phenotyping (PolyPhen, http://coot.embl.de/PolyPhen)] are important for predicting damaging effects of missense mutations, but do not confirm the pathogenicity. Functional characterization of gene variants via targeted amino-acid substitutions and enzyme assays still remain vital in order to establish the effect (if any) of an existing variant on the catalytic activity of a protein. All patients with GAMT-D had novel homozygous or compound heterozygous variants or known disease-causing mutations in the GAMT gene and heterozygous carrier status were confirmed in parents. Here, we report 19 missense variants in the GAMT gene and their functional characterization. We also report 20 patients with 17 of these variants (either homozygous or compound heterozygous) for clinical and biochemical phenotype: 13 not previously published; two partially published; and five previously published patients. Materials and Methods This study was approved by the Institutional Research Ethics Board (REB#1000033694) at The Hospital for Sick Children. Clinical and Biochemical Data of the Patients Patients with GAMT-D with one of the missense variants not previously studied for functional characterization in our laboratory were included into this study. Physicians following these patients, who had not published, or partially published their cases, were invited to participate to this study. Physicians were provided a questionnaire including following questions: age of onset, clinical features (GDD, intellectual disability, seizure, movement disorder, behavioral problems), and biochemical features (urinary GAA levels, cerebral creatine by 1 H-MRS or 31 P-MRS, brain magnetic resonance imaging (MRI), GAMT enzyme activity in the cultured skin fibroblasts). The questionnaire was completed for previously reported patients (by authors) according to information acquired from the literature. We applied a clinical severity scoring system based on the information from the questionnaire for the clinical phenotype using previously reported scoring system [Mercimek-Mahmutoglu et al., 2006]. The details of the clinical severity scoring system are summarized under Table 1 legends. Sum of all clinical features according to clinical severity scoring were given as phenotype. Molecular Genetic Studies and Functional Characterization of Missense Variants Sequencing of the GAMT gene (NM 000156.5) was performed as ´ et al., previously described for mutation analysis [Caldeira Araujo 2005]. Nucleotide numbering of variants reflects cDNA numbering with +1 corresponding to the A of the ATG translation initiation codon in the reference sequence, according to journal guidelines (www.hgvs.org/mutnomen). The open reading frame of the GAMT gene (NP 000147.1) was cloned as a fusion protein with EGFP in a pEGFPN1 vector. Recombinant pGAMT-EGFPN1 plasmids for each missense mutation were generated by standard molecular biology techniques [see Almeida et al., 2006b for details]. A primary GAMT-deficient human fibroblast cell line (homozygous for a frameshift mutation), cultured according to standard procedures to 70% confluence, was used for transient expression of generated constructs. For the transfections, 45 μg of each plasmid was incubated at room temperature for 10 min with polyethyleneimine (Polysciences, Omnilabo, Eppelheim, Germany) in serum-free medium, and subsequently the complex was applied to the cells. Cells transfected with either the wild-type pGAMT-EGFPN1 construct or with the pEGFPN1 empty vector as well as untransfected cells were taken along as controls. All transfections were done in triplicate, and green fluorescence of the EGFP tag was used to estimate the transfection efficiency. Cells were harvested 48 h after transfection, flash-frozen, and stored at –80°C for Western blot analysis and GAMT enzyme activity measurement. Immunodetection of the GAMT–EGFP fusion protein was carried out as described previously [Almeida et al., 2006b] using an EGFP antibody (Abcam, Cambridge, UK). The GAMT enzyme assay was performed with the supernatants from lysed cells as described by Verhoeven et al. [2004]. Results Clinical and Biochemical Data of the Patients We received a completed questionnaire from 13 physicians. Two physicians diagnosed GAMT-D in a sibling and they were both included (P2 siblings of P1 and P8 siblings of P7) into this study. Clinical, biochemical, and molecular genetic results were summarized in Table 1. Thirteen patients were not reported previously (P1, P2, P3, P7, P8, P10, P11, P13, P14, P15, P16, P17, P19, P21); two patients were reported partially (P4, P9) and five patients were reported previously [P5 in Mercimek-Mahmutoglu et al., 2006 P9; P6 in Mercimek-Mahmutoglu et al., 2006 P12; P12 in Engelke et al., 2009 P4; P18 Verbruggen et al., 2007; P20 in Leuzzi et al., 2006] (Table 1). Median age of the patients was 12 ± 7.41 SD (range 5–35 years), median age of diagnosis was 6.5 ± 7.22 SD (range 10 months to 20 years) of 21 patients with GAMT-D. Two patients (P8, P12) were adults at the time of the diagnosis. According to available HUMAN MUTATION, Vol. 35, No. 4, 462–469, 2014 463 6–12 mo/6 yrs 2.5 yrs/10 yrs 3–6 yrs/10 yrs 2b /M/8 yrs 3/F/16 yrs 4/M/19 yrs [P5 in Lion-Francois et al., 2006] 5/M/13yrs [P9 in Mercimek-Mahmutoglu et al., 2006] 6/M/14 yrs [P12 in Mercimek-Mahmutoglu et al., 2006] 7b /M/8 yrs b 8 /F/26 yrs 9/M/11 yrs [Scott-Schwoerer et al., 2011] 10/F/5 yrs 11/F/11 yrs 12 mo/7 yrs N/A 15/M/10 yrs 16/M/16 yrs N/A 17/F/5 yrs 18/M/10 yrs [Verbruggen et al., 2007] 19/M/8 yrs 20/F/24 yrs [Leuzzi et al., 2006] 21/F/14 yrs c.476T>C (p.Leu159Pro)c c.497T>C (p.Leu166Pro) c.506G>A (p.Cys169Tyr) [Caldeiro et al., 2005] c.590T>C (p.Leu197Pro) c.623G>C (p.Arg208Pro)c 18–24 mo/6 yrs NA/12yrs 1–2 yrs/3 yrs 12–18 mo/4 yrs 12–18 mo/2 yrs 9 mo Severe ID, AED responsive seizures, hyperactivity Severe GDD, severe ID, (IQ < 30), intractable epilepsy, myoclonus bradikinesia, ADHD Severe GDD, occasional seizures, Ataxia, autism ADHD, aggressive behavior Mild ID Moderate GDD, mild ID, ADHD Severe GDD, movement disorder, AED responsive seizures, autistic Moderate GDD, ataxia, ADHD Severe ID, ataxia, autism, aggressive behavior Moderate GDD, intractable epilepsy, hypotonia Moderate-severe GDD, autistic like features Mild ID, AED responsive seizures, stereotypic movements Severe GDD, movement disorder, AED nonresponsive seizures, aggressive behavior Borderline ID, seizures nonresponsive to AED, ADHD, autistic-like features Severe GDD, seizures nonresponsive to AED, spasticity, aggressive behavior Moderate GDD, AED responsive seizures, ataxia, tremor, ADHD, autistic-like features N/A Severe ID, AED responsive seizures, aggressive behavior Mild GDD, AED responsive seizures, autistic Severe GDD, drug responsive seizures, aggressive behavior Severe GDD, occasional seizures, hyperactive, self injurious, aggressive behavior Moderate GDD, AED responsive seizures, ADD Clinical features Severe Moderate Mild Mild N/A GAMT enzyme activity deficient Severe Severe Severe Moderate Moderate Moderate Moderate Moderate Mild Moderate Severe Mild Moderate Moderate, Moderate Moderate Phenotypea Normal/partially absent/absent Bilateral dorsal pons increased signal/absent/absent NA/absent/present Mild cortical atrophy, white/gray matter signal changes/absent/absent Normal/absent/N/A N/A Bilateral globus pallidi increased signal/absent/present Normal/absent/present Normal/partially absent/absent Delayed myelination/absent/absent Normal/absent/absent NP Normal/NP Normal/absent/absent Bilateral thalami increased signal/absent/absent N/A Normal/partially absent/absent Normal/partially absent/absent Normal/partially absent/present Normal/partially absent/present Normal/absent/present MRI/creatine peak/GAA peak on 1 H-MRS c.623G>C/c.623G>C c.590T>C/c.590T>C c.497T>C/c.497T>C c.506G>A/c.506G>A c.439C>T; c.11 36dup26bp (p.Gly13ProfsX38) c.476T>C/c.476T>C c.407C>T/c.316C>T c.403G>A; c.327G>A c.328G>T; c.327G>A c.274A>G/c.274A>G c.202G>T/c.202G>T c.202G>T/c.202G>T c.220G>C/c.327G>A c.220G>C/c.220G>C c.224C>T/c.224C>T c.160G>C/c.160G>C c.152A>C/c.526dupG c.148A>C/c.148A>C c.133T>A/c.11 36dup26bp c.133T>A/c.327G>A c.133T>A/c.327G>A Genotype c b Clinical severity scoring system. Siblings. Novel mutations. Clinical severity scoring system: (A) intellectual disability/global developmental delay was scored: 0, normal; 1, mild; 2, moderate; 3, severe; (B) seizures were scored 0, none; 1, occasional seizures; 2, antiepileptic drug-responsive seizures; 3, antiepileptic drug-resistant seizures. (C) Movement disorder was scored 0, no movement disorder; 1, nonspecific movement abnormalities; 2, extrapyramidal movement disorder; 3, pyramidal and extrapyramidal movement disorder. Sum of all clinical features according to clinical severity scoring were given as phenotype. F, female; M, male; yrs, years; mo, months; GDD, global developmental delay; AED, antiepileptic drugs; ADD, attention deficit disorder; ID, intellectual disability; ADHD, attention deficit hyperactivity disorder; N/A, not available; MRI, magnetic resonance imaging; GAA, guanidinoacetate; 1 H-MRS, proton magnetic resonance spectroscopy; NP, not performed. a 9–12 mo/4 yrs 14/F/12 yrs c.403G>A (p.Asp135Asn) [O’Rourke et al., 2009] c.407C>T (p.Thr136Met) [Sempere et al., 2009] c.439C>T (p.His147Try)c 18–24 mo/7 yrs 13/F/10 yrs c.328G>T (p.Val110Phe)c 1–2 yrs/27 yrs 12/M/35 yrs [P4 in Engelke et al., 2009] 6–9 mo/10 mo 12–18 mo/20 yrs 6–12 mo/1 yr 6–12 mo/3 yrs 18–24 mo/7 yrs 1–2 yrs/2 yrs 6–12 mo/3 yrs 6–12 mo/11 years Age at onset/Age at diagnosis 1b /F/16 yrs Patient/sex/age (reference for previously published patients) c.274A>G (p.Asn92Asp) c.202G>T (p.Gly68Cys)c c.202G>T (p.Gly68Cys)c c.220G>C (p.Ala74Pro) c.220G>C (p.Ala74Pro) c.224C>T (p.Ala75Val)c c.160G>C (p.Ala54Pro) c.152A>C (p.His51Pro) c.133T>A (p.Trp45Arg) [Comeaux et al., 2013] c.133T>A (p.Trp45Arg) [Comeaux et al., 2013] c.133T>A (p.Trp45Arg) [Comeaux et al., 2013] c.148A>C (p.Met50Leu) Missense variant (reference for previously published mutations) Table 1. Clinical, Biochemical, and Molecular Genetic Results of the Patients with a Missense Variant and Confirmed GAMT-D 43 44 clinical information of the 20 patients, four patients (20%) had mild; 11 patients (55%) had moderate and five patients (25%) had severe phenotype (Table 1). Fifteen patients (P1–6, P9, P11–17, P20–21) had seizures (75%). Age of onset for the first seizure was between 9 months (P9) and 7 years (P11). Eight patients (P1, P6, P7, P8, P12, P15, P17, P21) (40%) had movement disorder. Ataxia was the most common movement disorder. Behavioral problems were present in 19 patients (95%) ranging from hyperactivity, attention deficit hyperactivity disorder (ADHD) to self-injurious aggressive behavior. The most common behavioral problems were autism or autistic-like features (35%) and aggressive behavior (35%). The age of the patients with aggressive behavior was from 5 to 35 years. Six patients (30%) presented with ADHD. Bilateral increased signal intensity in the globus pallidi in one patient (P14) and in bilateral thalami in one patient was present (P11). In both patients, these MRI changes were associated with movement disorder. Urine GAA levels were elevated in all patients and were between 1.1 and 12 times above the upper limit of reference range. Seventeen patients underwent 1 H-MRS. In none of these patients, neither creatine nor GAA were quantified. In 11 patients, creatine was totally absent (P1, P6, P7, P10, P11, P14, P15, P17, P18, P19, P20) and in six partially absent. GAA peak was present in six patients (P1, P2, P3, P14, P15, P18) (four with total absent and two with partial absent creatine peak) (Table 1). GAMT enzyme activity was measured in four patients (P2, P9, P12, P21) and was nondetectable or strongly decreased in all patients. We had no clinical information for P16 (compound heterozygous for c.439C>T (p.His147Try), but GAMT-D was confirmed biochemically by deficient GAMT enzyme activity in the cultured skin fibroblasts. One patient with unknown etiology was heterozygous for the c.22C>A (p.Pro8Thr) variant with no identifiable second variant in the GAMT gene who presented with severe GDD, hypotonia, intractable epilepsy and died at the age of 11 months. Urine GAA was elevated 2.5 times and plasma GAA was 1.8 times above the upper limit of reference range. On 1 H-MRS, creatine peak was about 90% of normal, marginally low, which was not suggestive of GAMT-D. Another patient with unknown etiology was homozygous for the c.79T>C (p.Tyr27His) variant in the GAMT gene identified by whole exome sequencing suggestive of GAMT-D. GAMT enzyme activity was within normal range in the cultured skin fibroblasts excluding GAMT deficiency in this patient. Molecular Genetic Studies and Functional Characterization of Missense Variants We detected six novel variants (Table 1). Twelve patients had homozygous and nine patients had compound heterozygous mutations. The panethnic c.327G>A mutation was found in five patients as second mutations. We introduced 19 missense variants identified in the GAMT gene via SDM of which 17 were detected in patients affected with GAMT deficiency. Two additional variants, including one polymorphism as described above were tested. Homogenates from cells transfected with either one of the other 17 variants retained no significant activity approximately 0%–4% of recombinant wild-type GAMT activity (Fig. 1). In all transfectants, a green fluorescent signal was detected indicating successful transfection (data not shown). On the Western blot (Fig. 1), no detectable expression could be seen for the following variants: c.152A>C (p.His51Pro), c.160G>C (p.Ala54Pro), c.202G>T (p.Gly68Cys), c.220G>C (p.Ala74Pro), c.506G>A (p.Cys169Tyr), Figure 1. A: GAMT (NM_000156.5) assay showing effect of variants on catalytic activity. GAMT−/− is the untransfected GAMT-deficient fibroblast cell line. Empty vector is a deficient cell line transfected with a basic pEGFPN1 vector and, wild-type a deficient cell line transfected with a p.GAMT-EGFPN1 vector. GAMT+/+ represents a cell line with wild-type endogenous GAMT activity. The error bars represent the standard error of the mean from triplicate transfections. B: Western blot using an anti-GAMT antibody to detect expression of GAMT– EGFP fusion proteins. A Western blot was carried out for all triplicate transfections and one representative blot of each sample is shown. No detectable expression of the fusion protein could be seen for variants; p.His51Pro, p.Ala54Pro, p.Gly68Cys, p.Ala74Pro, p.Val110Phe, p.His147Tyr, p.Cys169Tyr, and p.Leu197Pro. Twenty-four micrograms of protein was loaded in each lane. The dashed line separates samples that were run on the same gel. and c.590T>C (p.Leu197Pro) variants (Fig. 2). GAMT enzyme activity was undetectable in homogenates from cells overexpressing the c.133T>A (p.Trp45Arg) and c.220G>C (p.Ala74Pro) variants and was very low for the c.160G>C (p.Ala54Pro), c.274A>G (p.Asn92Asp), c.403G>A (p.Asp135Asn), c.407C>T (p.Thr136Met), c.497T>C (p.Leu166Pro), and c.590T>C (p.Leu197Pro). Two mutations, c.439C>T (p.His147Try) and c.623G>C (p.Arg208Pro), revealed highest residual GAMT enzyme activity (both 4% of the activity of GAMT wild-type transfectants). The c.623G>C (p.Arg208Pro) variant proved pathogenic in our functional analysis although it was conserved only across four species and SIFT and PolyPhen predicted it was not pathogenic. Homogenates from cells overexpressing GAMT variants c.22C>A (p.Pro8Thr) and c.79T>C (p.Tyr27His) were found to restore GAMT activity to similar levels as the wild-type GAMT transfectants. Surprisingly, the c.22C>A (p.Pro8Thr) and c.79T>C (p.Tyr27His) were conserved across nine species and SIFT predicted these variants to be nontolerated and PolyPhen predicted the c.22C>A (p.Pro8Thr) to be benign and the c.79T>C (p.Tyr27His) probably damaging, respectively. Conservation of the substituted amino acids in GAMT orthologs from 12 other species is depicted in Figure 2. Discussion We report 13 new patients with GAMT-D, six novel pathogenic mutations in the GAMT gene and functional characterization of 19 missense variants in this study. All 13 patients had biochemical features of GAMT deficiency including elevated GAA in urine, creatine deficiency on brain MRS, and/or deficient GAMT enzyme activity in the cultured skin fibroblasts or lymphoblasts. In two HUMAN MUTATION, Vol. 35, No. 4, 462–469, 2014 465 45 Figure 2. Scheme showing conservation of amino acid residues in GAMT orthologs across 13 different species (source: ENSEMBL). Depicted are the amino acids 8, 27, 45, and so on until Arg208. Functional analysis of GAMT activity in recombinant cells reveals the amino-acid substitutions at the conserved Pro8 and Tyr27 residues (p.Pro8Thr and p.Tyr27His, respectively) are NOT pathogenic, whereas substitution of the poorly conserved Arg208 residue by proline proves to be pathogenic. sibling pairs (P1 and P2 and P7 and P8), clinical phenotype was moderate, despite an age difference of 8 and 18 years, respectively. In the first sibling pair, behavioral problems were more severe in the younger sibling, self-injurious behavior compared with his 8 years older sister. Whereas in second sibling pair (P7 and P8), younger sibling had ADHD; 18 years older sibling had aggressive behavior. As an observation, behavior disorder might be progressive in GAMT-D. The prevalence of behavior disorder, aggressive behavior, and autism or autistic-like features being most common, was 95% in this study, which was reported as 78% in a previous study including 27 patients [Mercimek-Mahmutoglu et al., 2006]. In our study, 40% of the patients had movement disorder, ataxia being most common, which was similar to previous report (48%) [Mercimek-Mahmutoglu et al., 2006]. Seizures were one of the clinical features in 75% of the patients in our study, which was reported to be higher, (93%) in a previous study [Mercimek-Mahmutoglu et al., 2006]. 30% of the patients had intractable epilepsy in both, previous and this study. On qualitative 1 H-MRS, total absence of creatine peak was associated with severe phenotype in four patients, moderate phenotype in four patients, and mild phenotype in three patients. Total absence of creatine peak together with presence of GAA peak was associated with severe phenotype in two patients, moderate phenotype in one patient, and mild phenotype in one patient. Additionally, two patients with moderate phenotype had partial creatine deficiency and present GAA peak on qualitative 1 H-MRS. These results show us that abnormal metabolite profile on 1 H-MRS is also not helpful to predict severity of disease phenotype. All clinical data were based on single physician observations, either, clinical geneticist, pediatric neurologist, or pediatrician with specific training to recognize and categorize clinical features of GAMT-D. No neuropsychological assessments for degree of intellectual disability, and no standardized developmental assessments for degree of GDD, autism diagnostic tests were applied because of the retrospective nature of our study. However, in our clinical practice, even with well-designed prospective case control studies, standardized clinical follow-up assessments are difficult to apply due to various interfering factors such as limited availability of clinical resources, funding cuts and limitations of standardized tests. We still think that single physician observations are valuable information resources to assess clinical phenotype in very rare disorders like GAMT-D. Three patients (P1, P2, and P3) with c.133T>A (p.Trp135Arg) mutation had the moderate phenotype. Two nonrelated patients were heterozygous for c.220G>C (p.Ala74Pro) mutation one with moderate (P9) and one with mild phenotype (P10). The heterozygous c.403G>A (p.Asp135Asn) mutation detected in P14 with severe phenotype and bilateral globus pallidi involvement on brain MRI has been also reported previously in heterozygous state in another non-related patient with severe phenotype and bilateral globus pallidi involvement on brain MRI [O’Rourke et al., 2009]. Compound heterozygous c.407C>T (p.Thr136Met) and c.316C>T (p.Gln106) mutations were detected in P15, a Spanish patient with severe phenotype and both mutations had been previously reported in another Spanish patient with GAMT-D who had moderate phenotype and was diagnosed at the age of 45 years [Sempere et al., 2009]. Homozygous c.506G>A (p.Cys169Tyr) mutation was detected in patient P19 with a mild phenotype; however, same homozygous mutation was reported previously in a Portuguese patient with severe phenotype [P27 in Mercimek-Mahmutoglu et al., 2006]. Recombinant c.133T>A (p.Trp45Arg) cells did not have any GAMT enzyme activity with decreased amount of protein on the Western blot. Three heterozygous patients (P1, P2, P3) for this mutation had a moderate phenotype, albeit the presence of a second deleterious mutation. Recombinant c.220G>C (p.Ala74Pro) cells revealed no enzyme activity as well as no protein expression on the Western blot. Surprisingly P10, homozygous for this mutation, presented with a mild phenotype and P9 was compound heterozygous and had a moderate phenotype. Of all tested variants, recombinant c.439C>T (p.His147Try) (P16, no clinical information) and c.623G>C (p.Arg208Pro) (P21) cells revealed relatively higher residual enzyme activity (4% compared with wild-type GAMT transfectants). P21 was homozygous for the p.Arg208Pro mutation and had a severe phenotype. Because of the fact that the severity of the symptoms varies amongst patients harboring the same mutation(s) [Mercimek-Mahmutoglu et al., 2006] and that all the pathogenic variants are devoid of significant residual GAMT activity, no genotype/phenotype correlation can be drawn from this cohort. In other words, the level of (residual) GAMT activity does not explain the differences between patients presenting with a moderate, mild, or severe phenotype. It seems that GAMT activity aside; there are other yet unknown factors that influence the pathophysiology of GAMT deficiency. Analyzing the conservation of gene sequences (DNA, RNA, or amino acids) within a functional class or across species, amino-acid residues or domains relevant for gene function can often be extrapolated because the amino-acid sequence determines the protein’s 3D structure and hence function. However, the relation of sequence 46 Figure 3. Graphical representation of the UniProtKB, PDB – ATOM and PDB – SEQRES sequences of rat GAMT (PDB ID: 1XCJ; Komoto et al.). In this representation, an overview of the secondary structure (DSSP), author assigned annotations (Site Record), published amino-acid sequence (UniProtKB) plus the amino-acid annotation as provided by author of solved structure (PDB) are shown. Amino-acid residues depicted above the nascent GAMT sequence represent the amino-acid substitutions that were tested. Indicated by a yellow or purple circle (on the Site Record) are the amino-acid residues that are directly involved in binding to GAA or SAH, respectively. The W20 amino-acid residue (amongst others) is directly bound to SAH, and the importance of this residue is highlighted by the pathogenicity of the well-characterized W20S mutant (Almeida et al., 2006a,b). to structure is not a unique relationship, as different sequences, sometimes totally unrelated, may have similar 3D structures. Thus, the degree of conservation of the 3D structure is much higher than the degree of conservation of the amino-acid sequence. Functional characterization of gene variants via targeted amino-acid substitutions and enzyme assays still remains vital in order to establish the effect (if any) of an existing variant on the catalytic activity of a protein. The availability of solved 3D structures greatly facilitates the interpretation of such functional studies. Two missense variants, (c.22C>A (p.Pro8Thr) and c.79T>C (p.Tyr27His)) were not damaging to GAMT protein and activity. The heterozygous c.22C>A (p.Pro8Thr) variant was present in a patient with mildly elevated urine and plasma GAA, but almost normal creatine on 1 H-MRS, unfortunately the patient passed away before the completion of biochemical investigations to exclude diagnosis of GAMT-D. This variant was neither found in a cohort of 6002 individuals (http://evs.gs.washington.edu/EVS/) nor in our 220 control alleles. However, the c.79T>C (p.Tyr27His) variant is in fact a polymorphism which is reported in the exome database (http://evs.gs.washington.edu/EVS/) with a minor allele frequency of 0.2% and at a frequency of 1.5% in a Portuguese newborn population (data not published) which suggest that this polymorphism is not associated with GAMT-D, although software prediction mod- els suggest that the variant could be pathogenic. Additionally, in one individual this polymorphism was detected in homozygous state who had normal GAMT enzyme activity in the cultured primary fibroblasts excluding the diagnosis of GAMT-D. This is in line with the findings of normal GAMT enzyme activity in our GAMT overexpression assay and confirms that this variant is not associated with GAMT-D. Based on the solved 3D structure of the intact GAMT ternary complex (Fig. 3) [GAMT – (SAH + GAA); [Komoto et al., 2002, 2004], fusion protein expression, and GAMT activity measurements, we attempt to provide an explanation for the pathogenicity or lack thereof, of the missense variants tested [www.pdb.org – DSSP program; Kabsch and Sander, 1983]. Seven of the mutated amino-acid residues interact directly via H-bonds with SAH (Met50, Gly68, Ala74, Asn92, Glu135, and Thr136) or GAA (Cys169). The pathogenicity of the tested mutants at these positions is probably because of their inability to bind the substrate or a loss of active site conformation/integrity. The secondary structure of GAMT comprises alpha helices and beta strands as well as the rare 310 helix motifs [Pauling et al, 1951]. Expression of the fusion protein, but no GAMT activity, was detected in cell homogenates of the pathogenic variants; p.Met50Leu (located within an alpha helix), p.Trp45Arg (located within a 310 -helix) and p.Arg208Pro (located within a beta strand). Substitutions of the residues at these sites may have the effect of distorting the backbone conformation HUMAN MUTATION, Vol. 35, No. 4, 462–469, 2014 467 47 (orientation), interfering with hydrogen bonding (via steric hindrance) and eventually lead to a misfolded protein. Misfolding of the GAMT protein could also affect its EGFP fusion protein (by disrupting its anti-EGFP epitope) preventing its detection by an anti-EGFP antibody. On the Western blot, no detectable expression for the above-mentioned variants could be seen, all of which were located either within an alpha helix (His51, Ala54, Ala74, Ala75, His147, Leu159, and Leu197) or a beta strand (Gly68 and Val110). Residue Tyr27 is incorporated into a beta strand, however, the p.Tyr27His variant is not pathogenic (see above). A possible explanation could be that Tyr and His have side chains of similar bulk and polarity, thus there is no (significant) change in the torsion angle when His substitutes Tyr at this position. Pro8 is not involved in secondary structure formation—a possible reason why the p.Pro8Thr substitution is tolerated. Physicians, trying to establish a diagnosis, are always challenged with the finding of novel variants and their pathogenicity. Genetic prenatal diagnosis can be offered in families with two pathogenic GAMT alleles in the index case. To confirm that the mutations are inherited in trans, the presence of heterozygous mutations needs to be confirmed in parents. In a case with a heterozygous mutation and biochemically confirmed GAMT-D, the second disease allele may be identified by an informative polymorphism. In this case, prenatal diagnosis can be still offered. The diagnosis of GAMT-D can be based on metabolite measurements (i.e., increased levels of GAA) in body fluids and creatine deficiency on 1H-MRS. However, for the interpretation of the missense variants additional studies are needed. These are the reasons that functional studies are essential to prove pathogenicity of missense variants. The GAMT enzyme activity measurement in cultured primary skin fibroblasts is the gold standard for the confirmation of the diagnosis in GAMT-D, which is clinically available only in our laboratory worldwide. The sample collection from the patients is an invasive procedure and shipment of the cells as well as funding for the clinical testing is not available in many countries. With the new developments in molecular genetics technologies, such as, next generation genome and/or exome sequencing, we will find more and more missense variants with unclear pathogenicity and functional studies will be an essential part of clinical diagnostics. Concluding Remarks We report 13 new patients with GAMT-D, six novel mutations in the GAMT gene and functional analysis of 19 missense variants. We showed that using the described functional assay, two variants (p.Pro8Thr and p.Tyr27His) predicted to be pathogenic by software modeling did not interfere with GAMT function, and one (p.Arg208Pro) that was predicted not to be pathogenic is in fact pathogenic. This illustrates that introducing mutations by SDM in recombinant GAMT protein followed by a functional enzyme assay is essential for the confirmation of the pathogenicity of the missense variants in the GAMT gene. Furthermore, our novel GAMT mutation database http://www.LOVD.nl/GAMT for the information of pathogenic variants will help physicians to decide on the pathogenicity of the missense variants. As we know that standard treatment protocols are not widely used in patients with GAMT-D because of restricted availability of supplements (e.g., ornithine) and difficulties in maintaining an arginine-restricted diet. Additionally, a patient with GAMT-D had a limited effect on neurodevelopmental and biochemical outcome on strict arginine-restricted diet [Mercimek-Mahmutoglu et al., 2012]. Because of various unknowns and no available clinical treatment trials for GAMT-D for the last 20 years, we initiated an international database to help us for the evaluation of treatment outcome and development of new treatment recommendations for GAMT deficiency. We use an online questionnaire hosted by the Research Electronic Data Capture (REDCap) online software. All physicians who requested genetic testing for the confirmation of GAMT-D in Amsterdam are being contacted via e-mail and invited for this study. We are hoping to include all treated patients with GAMT-D into this study. Acknowledgment We would like to thank the families allowing their physicians to share their children’s clinical information. Disclosure statement: The authors declare no conflict of interest. References Akiyama T, Osaka H, Shimbo H, Nakajiri T, Kobayashi K, Oka M, Endoh F, Yoshinaga H. 2014. A Japanese adult case of guanidinoacetate methyltransferase deficiency. JIMD Rep 12:65–69. Almeida LS, Salomons GS, Hogenboom F, Jakobs C, Schoffelmeer AN. 2006a. Exocytotic release of creatine in rat brain. Synapse 60:118–123. Almeida LS, Rosenberg EH, Martinez-Mu˜noz C, Verhoeven NM, Vilarinho L, Jakobs C, Salomons GS. 2006b. Overexpression of GAMT restores GAMT activity in primary GAMT-deficient fibroblasts. Mol Genet Metab 89:392–394. ´ H, Smit W, Verhoeven NM, Salomons GS, Silva S, Vasconcelos R, Tom´as Caldeira Araujo H, Tavares de Almeida I, Jakobs C, Duran M. 2005. Guanidinoacetate methyltransferase deficiency identified in adults and a child with mental retardation. Am J Med Genet A 133A:122–127. Cheillan D, Joncquel-Chevalier Curt M, Briand G, Salomons GS, Mention-Mulliez K, Dobbelaere D, Cuisset JM, Lion-Franc¸ois L, Portes VD, Chabli A, Valayannopoulos V, Benoist JF, et al. 2012. Screening for primary creatine deficiencies in French patients with unexplained neurological symptoms. Orphanet J Rare Dis 7:96. Comeaux MS, Wang J, Wang G, Kleppe S, Zhang VW, Schmitt ES, Craigen WJ, Renaud D, Sun Q, Wong LJ. 2013. Biochemical, molecular, and clinical diagnoses of patients with cerebral creatine deficiency syndromes. Mol Genet Metab 109:260–268. Dhar SU, Scaglia F, Li FY, Smith L, Barshop BA, Eng CM, Haas RH, Hunter JV, Lotze T, Maranda B, Willis M, Abdenur JE, et al. 2009. Expanded clinical and molecular spectrum of guanidinoacetate methyltransferase (GAMT) deficiency. Mol Genet Metab 96:38–43. El-Gharbawy AH, Goldstein JL, Millington DS, Vaisnins AE, Schlune A, Barshop BA, Schulze A, Koeberl DD, Young SP. 2013. Elevation of guanidinoacetate in newborn dried blood spots and impact of early treatment in GAMT deficiency. Mol Genet Metab 109:215–217. Engelke UF, Tassini M, Hayek J, de Vries M, Bilos A, Vivi A, Valensin G, Buoni S, Zannolli R, Brussel W, Kremer B, Salomons GS, et al. 2009. Guanidinoacetate methyltransferase (GAMT) deficiency diagnosed by proton NMR spectroscopy of body fluids. NMR Biomed 22:538–544. Fujioka M, Konishi K, Takata Y. 1988. Recombinant rat liver guanidinoacetate methyltransferase: reactivity and function of sulfhydryl groups. Biochemistry 27:7658– 7664. Fujioka M, Takata Y, Gomi T. 1991. Recombinant rat guanidinoacetate methyltransferase: structure and function of the NH2-terminal region as deduced by limited proteolysis. Arch Biochem Biophys 285:181–186. Kabsch W, Sander C. 1983. Dictionary of protein secondary structure: pattern recognition of hydrogen-bonded and geometrical features. Biopolymers 22:2577–2637. Komoto J, Huang Y, Takata Y, Yamada T, Konishi K, Ogawa H, Gomi T, Fujioka M, Takusagawa F. 2002. Crystal structure of guanidinoacetate methyltransferase from rat liver: a model structure of protein arginine methyltransferase. J Mol Biol 320:223–35. Komoto J, Yamada T, Takata Y, Konishi K, Ogawa H, Gomi T, Fujioka M, Takusagawa F. 2004. Catalytic mechanism of guanidinoacetate methyltransferase: crystal structures of guanidinoacetate methyltransferase ternary complexes. Biochemistry 43:14385–14394. Leuzzi V, Carducci C, Carducci C, Matricardi M, Bianchi MC, Di Sabato ML, Artiola C, Antonozzi I. 2006. A mutation on exon 6 of guanidinoacetate methyltransferase (GAMT) gene supports a different function for isoform a and b of GAMT enzyme. Mol Genet Metab 87:88–90. Lion-Franc¸ois L, Cheillan D, Pitelet G, Acquaviva-Bourdain C, Bussy G, Cotton F, Guibaud L, G´erard D, Rivier C, Vianey-Saban C, Jakobs C, Salomons GS, et al. 2006. 48 High frequency of creatine deficiency syndromes in patients with unexplained mental retardation. Neurology 67:1713–1714. ´ HC, Mercimek-Mahmutoglu S, Stoeckler-Ipsiroglu S, Adami A, Appleton R, Araujo Duran M, Ensenauer R, Fernandez-Alvarez E, Garcia P, Grolik C, Item CB, Leuzzi V, et al. 2006. GAMT deficiency: features, treatment, and outcome in an inborn error of creatine synthesis. Neurology 67:480–484. Mercimek-Mahmutoglu S, St¨ockler-Ipsiroglu S, Salomons GS. 2009. In: Pagon RA, Adam MP, Bird TD, Dolan CR, Fong CT, Stephens K, editors. Creatine deficiency syndromes. GeneReviewsTM [Internet]. Seattle (WA): University of Washington, Seattle. p 1993–2013 [updated 2011 Aug 18]. Mercimek-Mahmutoglu S, Dunbar M, Friesen A, Garret S, Hartnett C, Huh L, Sinclair G, Stockler S, Wellington S, Pouwels PJ, Salomons GS, Jakobs C. 2012a. Evaluation of two year treatment outcome and limited impact of arginine restriction in a patient with GAMT deficiency. Mol Genet Metab 105:155–158. Mercimek-Mahmutoglu S, Sinclair G, van Dooren SJ, Kanhai W, Ashcraft P, Michel OJ, Nelson J, Betsalel OT, Sweetman L, Jakobs C, Salomons GS. 2012b. Guanidinoacetate methyltransferase deficiency: first steps to newborn screening for a treatable neurometabolic disease. Mol Genet Metab 107:433–437. Nasrallah F, Kraoua I, Joncquel-Chevalier Curt M, Bout MA, Taieb SH, Feki M, Khouja N, Briand G, Kaabachi N. 2012. Guanidinoacetate methyltransferase (GAMT) deficiency in two Tunisian siblings: clinical and biochemical features. Clin Lab 58:427–432. O’Rourke DJ, Ryan S, Salomons G, Jakobs C, Monavari A, King MD. 2009. Guanidinoacetate methyltransferase (GAMT) deficiency: late onset of movement disorder and preserved expressive language. Dev Med Child Neurol 51:404–407. Pauling L, Corey RB, Branson HR. 1951. The structure of proteins; two hydrogenbonded helical configurations of the polypeptide chain. Proc Natl Acad Sci USA 37:205–211. Schulze A, Hess T, Wevers R, Mayatepek E, Bachert P, Marescau B, Knopp MV, De Deyn PP, Bremer HJ, Rating D. 1997. Creatine deficiency syndrome caused by guanidinoacetate methyltransferase deficiency: diagnostic tools for a new inborn error of metabolism. J Pediatr 131:626–631. Schulze A, Bachert P, Schlemmer H, Harting I, Polster T, Salomons GS, Verhoeven NM, Jakobs C, Fowler B, Hoffmann GF, Mayatepek E. 2003. Lack of creatine in muscle and brain in an adult with GAMT deficiency. Ann Neurol 53:248–251. Schulze A, Hoffmann GF, Bachert P, Kirsch S, Salomons GS, Verhoeven NM, Mayatepek E. 2006. Presymptomatic treatment of neonatal guanidinoacetate methyltransferase deficiency. Neurology 67:719–721. Scot-Scwoerer JA, Obernolte L, Zabrowski A, Rice GM. 2011. Clinical improvement on treatment in a patient with guanidinoacetate methyltransferase (GAMT) deficiency. J Inherit Metab Dis 34(suppl 3):S126. Sempere A, Fons C, Arias A, Rodr´ıguez-Pombo P, Merinero B, Alcaide P, Capdevila A, Ribes A, Duque R, Eir´ıs J, Poo P, Fern´andez-Alvarez E, et al. 2009. Cerebral creatine deficiency: first Spanish patients harbouring mutations in GAMT gene. Med Clin (Barc) 133:745–749. St¨ockler S, Isbrandt D, Hanefeld F, Schmidt B, von Figura K. 1996. Guanidinoacetate methyltransferase deficiency: the first inborn error of creatine metabolism in man. Am J Hum Genet 58:914–922. Verbruggen KT, Sijens PE, Schulze A, Lunsing RJ, Jakobs C, Salomons GS, van Spronsen FJ. 2007. Successful treatment of a guanidinoacetate methyltransferase deficient patient: findings with relevance to treatment strategy and pathophysiology. Mol Genet Metab 91:294–296. Verhoeven NM, Roos B, Struys EA, Salomons GS, van der Knaap MS, Jakobs C. 2004. Enzyme assay for diagnosis of guanidinoacetate methyltransferase deficiency. Clin Chem 50:441–443. Viau KS, Ernst SL, Pasquali M, Botto LD, Hedlund G, Longo N. 2013. Evidence-based treatment of guanidinoacetate methyltransferase (GAMT) deficiency. Mol Genet Metab 110:255–262. Wallimann T, Wyss M, Brdiczka D, Nicolay K, Eppenberger HM. 1992. Intracellular compartmentation, structure and function of creatine kinase isoenzymes in tissues with high and fluctuating energy demands: the Fphosphocreatine circuit for cellular energy homeostasis. Biochem J 281:21–40. Wyss M, Kaddurah-Daouk R. 2000. Creatine and creatinine metabolism. Physiol Rev 80:1107–1213. 49 Chapter 4 Post-transcriptional Regulation of the Creatine Transporter Gene: Functional Relevance of Alternative Splicing "Real biologists who actually do the research will tell you that they almost never find a phenomenon, no matter how odd or irrelevant it looks when they first see it, that doesn't prove to serve a function. The outcome itself may be due to small accidents of evolution" E. O. Wilson 50 51 Biochimica et Biophysica Acta Post-transcriptional regulation of the creatine transporter gene: Functional relevance of alternative splicing Joseph D.T. Ndika a,b, Cristina Martinez-Munoz a, Nandaja Anand a, Silvy J.M. van Dooren a, Warsha Kanhai a, Desiree E.C. Smith a, Cornelis Jakobs a, Gajja S. Salomons a,b,c,⁎ a b c Department of Clinical Chemistry, Metabolic Unit, VU University Medical Center, Amsterdam, The Netherlands Neuroscience Campus, VU University Medical Center, Amsterdam, The Netherlands Department of Clinical Genetics, VU University Medical Center, Amsterdam, The Netherlands a r t i c l e i n f o Article history: Received 28 May 2013 Received in revised form 7 February 2014 Accepted 12 February 2014 Available online 20 February 2014 Keywords: Na+/Cl− cotransporter Creatine transporter Alternative splicing Creatine uptake upregulation Intellectual disability a b s t r a c t Background: Aberrations in about 10–15% of X-chromosome genes account for intellectual disability (ID); with a prevalence of 1–3% (Gécz et al., 2009 [1]). The SLC6A8 gene, mapped to Xq28, encodes the creatine transporter (CTR1). Mutations in SLC6A8, and the ensuing decrease in brain creatine, lead to co-occurrence of speech/ language delay, autism-like behaviors and epilepsy with ID. A splice variant of SLC6A8–SLC6A8C, containing intron 4 and exons 5–13, was identified. Herein, we report the identification of a novel variant — SLC6A8D, and functional relevance of these isoforms. Methods: Via (quantitative) RT-PCR, uptake assays, and confocal microscopy, we investigated their expression and function vis-à-vis creatine transport. Results: SLC6A8D is homologous to SLC6A8C except for a deletion of exon 9 (without occurrence of a frame shift). Both contain an open reading frame encoding a truncated protein but otherwise identical to CTR1. Like SLC6A8, both variants are predominantly expressed in tissues with high energy requirement. Our experiments reveal that these truncated isoforms do not transport creatine. However, in SLC6A8 (CTR1)-overexpressing cells, a subsequent infection (transduction) with viral constructs encoding either the SLC6A8C (CTR4) or SLC6A8D (CTR5) isoform resulted in a significant increase in creatine accumulation compared to CTR1 cells re-infected with viral constructs containing the empty vector. Moreover, transient transfection of CTR4 or CTR5 into HEK293 cells resulted in significantly higher creatine uptake. Conclusions: CTR4 and CTR5 are possible regulators of the creatine transporter since their overexpression results in upregulated CTR1 protein and creatine uptake. General significance: Provides added insight into the mechanism(s) of creatine transport regulation. © 2014 Elsevier B.V. All rights reserved. 1. Introduction Genetic deficiencies involving AGAT (OMIM ID: 602360), GAMT (OMIM ID: 601240) or SLC6A8 (OMIM ID: 300036), make up the creatine deficiency syndromes — a group of inborn errors of metabolism with symptoms such as intellectual disability, autism-like behavior and epilepsy [2–4]. Intellectual disability, with a prevalence of 1-3% [1], is also the main symptomatic of defective creatine synthesis or transport. Creatine supplementation is the main therapeutic approach, with success (notably improved cognitive function) in treating AGAT and GAMT deficiencies [5]. The poor permeability of the blood–brain barrier to creatine (reviewed in [6]) renders creatine supplementation ineffective for treating SLC6A8 deficiency. A recent comprehensive overview of creatine metabolism and transport in relation to CNS function is ⁎ Corresponding author at: Metabool Lab, PK 1X 009, De Boelelaan 1117, 1081HV Amsterdam, The Netherlands. Tel.: +31 204443053. E-mail address: [email protected] (G.S. Salomons). http://dx.doi.org/10.1016/j.bbagen.2014.02.012 0304-4165/© 2014 Elsevier B.V. All rights reserved. reviewed in Braissant et al. [45]. Congenital creatine deficiency aside, creatine has also been used to treat mitochondrial and muscular diseases, to alleviate brain and spinal cord injuries and to improve mental performance [7]. Creatine has also been employed as a neuroprotective agent in animal models of Parkinson's and Huntington's diseases [8]. In a more recent study [9], overexpression of the creatine transporter in mice resulted in protection against acute myocardial infarction. Consequently insight into the mechanisms of how the transporter is regulated is valuable. Alternative splicing is one of the most important mechanisms regulating gene expression. It enables diversification of one gene into different protein products and is thought to provide a molecular mechanism for fine-tuning the gene functions of a single locus [10,11]. Contrary to the expected minor role of alternative splicing in functional regulation, large scale sequencing- and bioinformatics-based studies have reported that it occurs in up to 94% of human genes [12,13]. The presence of a novel SLC6A8 splice variant (SLC6A8C), was revealed in primary fibroblasts of different individuals and in different human tissues [14]. The authors were however unable to detect SLC6A8B (GenBank: U17986) — the first identified splice variant 52 of SLC6A8. In the present study, we report the identification in human and mouse, of a new variant (SLC6A8D) of presumably the SLC6A8C mRNA, with an in-frame deletion of exon 9. In order to investigate the functional relevance of alternative splicing of SLC6A8 in terms of creatine uptake and/or regulation of the full-length creatine transporter, we generated recombinant mouse 3T3 Swiss cells overexpressing each splice variant, the full length transporter, as well as cells co-expressing the full length transporter with either one or the other splice isoform. conditions as for the human samples. For screening of the mouse cells, the primers were specifically designed to amplify mouse slc6a8derived sequences (Table 1, Nº. 6, Nº. 7, Nº. 8); consequently the PCR annealing temperature (Ta) was adjusted to 61 °C for slc6a8d. As control, amplification of Slc6a8c and Slc6a8 (Ta, 59 °C) was included. All PCR products were gel-purified and sequenced. 2. Materials and methods Investigation of differential splice variant expression was carried out on RNA isolated from 20 different tissues (FirstChoice™ Human Total RNA survey panel; Ambion). Gene-specific primers and probes used for amplification of each transcript are shown in Table 2. To investigate if upregulation of creatine uptake in 3T3 Swiss cells coexpressing CTR1 with a splice isoform compared to cells co-expressing CTR1 with an empty vector, was as a result of enhanced SLC6A8 transcription, standard Q-PCR was performed on an ABI7300 (Applied Biosystems) using a probe (5′-FAM 3′-TAMRA labeled probe: 5′-TGGGTGCTGGTCTACT TCTGTGTC-3′) and primers (5′-AAGTCTTGAGGCTGTCTGG-3′ and 5′-ACGATCTTTCCCGTGGAT-3′) specific for exon 4 of human SLC6A8. All reactions were performed in the presence of 1 M Betaine and ROX reference dye, and corrected for input by normalizing to GAPDH (human tissues) or Gapdh (mouse 3T3 Swiss cells) gene expression assay (PrimeTime™ Std qPCR Assay; IDT Technologies). Quantification (threshold cycle number, CT) of both target and reference genes was carried out in triplicate and in independent wells using the 2−ΔCt method. Analysis was done using the Q-Gene™ software package [15]. The mean normalized expression was obtained by averaging the CT values of target and reference genes, respectively and subsequent calculation of the standard error of the mean normalized expression [16]. 2.1. Identification of SLC6A8D transcript Total RNA was extracted (RNA isolation kit; Promega) from HEK-293 cells (since SLC6A8 expression is high in kidney) and from primary human fibroblasts obtained from both controls and a patient with a genomic deletion encompassing the entire SLC6A8 gene. cDNA synthesis (Fermentas) was performed (with and without reverse transcriptase, to check for gDNA contamination) using 1 μg of RNA. A forward primer complementary to intron 4 and a reverse primer complementary to the 3′UTR of the SLC6A8 locus were designed to amplify both SLC6A8C and SLC6A8D from HEK293 cDNA (Table 1, Nº. 1). Subsequently nested primers were used to detect presence of SLC6A8C and SLC6A8D transcripts in the amplified PCR products. SLC6A8D-specific primers were designed complementary to intron 4 and spanning exon 8/10 such that only messages lacking exon 9 will be amplified (Table 1, Nº. 2). For detection of specific SLC6A8C and SLC6A8 transcripts, previously designed primers [14] were used (Table 1, Nº. 3 and Nº. 4). RT-PCR of all transcripts was performed using KAPA HiFi™ Hotstart DNA polymerase with GC buffer (Kapa Biosystems). The general PCR conditions used were as specified by the manufacturer, except for the inclusion of 0.2 M Betaine in each reaction. Thermocycling was as follows: initial denaturation for 5 min at 95 °C; followed by 38 cycles of 20 s at 98 °C, followed by 15 s at 66 °C (SLC6A8, SLC6A8C, SLC6A8D) or 61 °C (GAPDH), and 2 min at 72 °C; with a final extension step of 10 min at 72 °C. Transcript identities were confirmed by sequencing (ABI 3130XL Genetic Analyser; Applied Biosystems). 2.2. Detection of SLC6A8D expression in monkey and mouse Slc6a8d expression in mouse was investigated in NIH-3T3 2.2 fibroblasts and primary mouse embryonic fibroblasts (MEFs) of FVB mice. Two monkey cell lines (CP132 and Vero) were also included. RT-PCR for the monkey cell lines was performed with same primers and PCR 2.3. Quantitative real-time PCR (Q-PCR) 2.4. Construction of pBABE-hygro-SLC6A8-EGFP, pBABE-puro-SLC6A8C-EGFP and pBABE-puro-SLC6A8D-EGFP expression vectors The open reading frame (ORF) of all isoforms was cloned in-frame to the N-terminal of EGFP (enhanced green fluorescent protein). In order to obtain a pBP-SLC6A8D-EGFP construct; RNA was isolated from HEK293 cells followed by cDNA synthesis. The ORF of SLC6A8D (exons 7–13) was amplified by RT-PCR using primers with HindIII and EcoRI restriction site overhangs (Table 1, Nº. 9), and then cloned into pEGFPN1 by standard cloning techniques. Via PCR (Table 1, Nº. 11) and site directed mutagenesis, an EcoRI-SLC6A8D-EGFP-SalI construct was then shuttled from its pEGFPN1 vector into a pBABE-puro (pBP) destination vector. The ORFs Table 1 PCR and cloning primers. No. Species Forward/reverse sequence mRNA sequence SLC6A8 location Amplicon size (bp) 1 Human SLC6A8C/SLC6A8D Human/monkey 3 Human/monkey 4 Human/monkey Intron 4 3′ UTR Intron 4 Exon 8/10 Intron 4 Exon 9 Exon 1 3′ UTR 1969/1831 2 5 Human 6 Mouse 7 Mouse 8 Mouse 9 Human 10 Human 11 Recombinant 5′-GAGGTACTGAAAGCCAAGCAATGC-3′ 5′-GCTGGTGATGTGAGCTGAGT-3′ 5′-CTCCCACACCTGCACTGCCC-3′ 5′-GACGTACATCCCGCCCTGGC-3′ 5′-CTCCCACACCTGCACTGCCC-3′ 5′-GGAGAGATCGATGACAAAGCAG-3′ 5′-ATGGCGAAGAAGAGCGCCGAG-3′ 5′-GCTGGTGATGTGAGCTGAGT-3′ 5′-ATGGCGAAGAAGAGCGCCGAG-3′ 5′-GCTGGTGATGTGAGCTGAGT-3′ 5′-CAAGAATGATCTGGAGTTTGGG-3′ 5′-GACGTACATTCCACCCTGGC-3′ 5′-CAAGAATGATCTGGAGTTTGGG-3′ 5′-GGAGAGATCGATGACAAAGCAG-3′ 5′-GGTATCTATAGCGTGTCTGG-3′ 5′-TTACATGACACTCTCCACCACG-3′ 5′-CCCAAGCTTCCACCATGGCTGCAGAGCAGGGCGTGC-3′ 5′-CGGAATTCGCATGACACTCTCCACCACG-3′ 5′-CGGGATCCACCATGGCGAAGAAGAGC-3′ 5′-CGGGATCCCATGACACTCTCCACCACG-3′ 5′-CGCGAATTCCACCATGGCTGCAGAGCAGGGCGTGC-3′ 5′-CGCGTCGACCTCTACAAATGTGGTATGGCTG-3′ SLC6A8D SLC6A8C SLC6A8 GAPDH Slc6a8d Slc6a8c Slc6a8 SLC6A8C/SLC6A8D SLC6A8 SLC6A8C-/SLC6A8D-(EGFP) 827 938 1930 819 Intron 4 Exon 8/10 Intron 4 Exon 9 Exon 2 Exon 13 Exon 7 Exon 13 Exon 1 Exon 13 Exon 7 944 1056 1884 809/671 1905 1650/1515 53 Table 2 Q-PCR primer pairs and probes. To quantify SLC6A8C transcripts, cDNA synthesis was carried out with a primer in exon 9 (to distinguish SLC6A8C from SLC6A8D) followed by PCR with SLC6A8C-specific primers. To quantify SLC6A8 and SLC6A8D transcripts, cDNA synthesis was done with an oligo(dT) primer followed by qPCR with gene-specific primers. Gene cDNA synthesis Forward primer (10 μM) Reverse primer (10 μM) Probe (5 μM) 5′Fam, 3′Tamra SLC6A8 SLC6A8C SLC6A8D Oligo(dT)20 5′-CAGCATCAATGTCTGGAACA-3′ 5′-GCCAGCACCATGATGTAGTA-3′ 5′-TCAAAGGCCTGGGCTACGCCT-3′ 5′-GGAGAGATCGATGACAAAGCAG-3′ 5′-GGGACCTCTGAACATACCT-3′ 5′-GCAGTGAAGTACACGATCTG-3′ 5′-ACAGCCTCCGCTGAGCAGCCT-3′ Oligo(dT)20 5′-GACAGCCAGGGCGGGAT-3′ 5′-ACCACGCACTCCCAAAAG-3′ 5′-ACTACTCGGCCAGCGGCACCA-3′ of SLC6A8 and SLC6A8C were cloned previously in-frame with EGFP in a pEGFPN1 plasmid [14,17]. A BamHI-EGFP-SalI restriction-enzymedigested fragment was isolated from pEGFPN1 and re-cloned into both pBABE-hygro (pBH) and pBP vectors. Via PCR (Table 1, Nº. 10) a BamHISLC6A8-BamHI fragment was obtained from pEGFPN1-SLC6A8 and recloned in-frame to EGFP in pBH to produce pBH-SLC6A8-EGFP. A pBPSLC6A8C-EGFP construct was generated by shuttling a PCR-generated EcoRI-SLC6A8C-EGFP-SalI fragment from SLC6A8C-pEGFPN1 into a pBP vector. Integrity of all clones was verified by sequencing. 2.5. Generation of recombinant viruses Viruses containing the empty vectors (pBP-EGFP or pBH-EGFP), the truncated isoforms (pBP-SLC6A8C-EGFP or pBP-SLC6A8D-EGFP) and the full-length transporter (pBH-SLC6A8-EGFP) constructs were generated. pBP and pBH vectors have the viral packaging signal sequence (Psi) while Phoenix cells (HEK293T) express viral GAG-POL and ENV genes. Transfection of these Phoenix producer cell lines with pBP/pBH-based vectors yields viral supernatants with an ecotropic host range. Phoenix cells were cultured under standard mammalian cell culture conditions to 70% confluence in DMEM cell culture medium (GIBCO, Scotland) supplemented with 1% pen/strep, 1% L-glutamine and 10% FBS. They were subsequently transfected (CaCl2/HBS method; Sigma) with 25 μg endotoxin-free plasmid DNA (Nucleobond™ 500 EF Kit; Bioke). Transfection efficiency was monitored via EGFP fluorescence. 48 and 72 h after transfection, 10 ml of medium containing recombinant viruses was tapped, filtered, flash-frozen in liquid nitrogen and stored at −80 °C. 2.6. Infection of 3T3 Swiss mouse fibroblast cells with construct-containing viruses In a first round of infections two “primary” cell lines were generated expressing either the empty vector (pBH-EGFP) or CTR1 (pBH-SLC6A8EGFP) with hygromycin resistance as a selectable marker. Next, these two cell lines were re-infected (in duplicate, here-in called Infection I and Infection II) with pBP-EGFP-, pBP-SLC6A8C-EGFP- or pBP-SLC6A8DEGFP-containing viruses with puromycin resistance as the co-selectable marker. Thus in total duplicates of 6 cell lines were generated coexpressing; the two empty vectors (1. pBH-EGFP/pBP-EGFP), one splice variant with an empty vector (2. pBH-EGFP/pBP-SLC6A8C-EGFP or 3. pBHEGFP/pBP-SLC6A8D-EGFP), SLC6A8 with an empty vector (4. pBH-SLC6A8EGFP/pBP-EGFP), SLC6A8 with a splice variant (5. pBH-SLC6A8-EGFP/pBPSLC6A8C or 6. pBH-SLC6A8-EGFP/pBP-SLC6A8D-EGFP). The infections were carried out as follows; 3T3 Swiss cells were cultured (same medium and conditions as above) to 50% confluence. Next, individual viral taps were thawed to 37 °C and mixed. Cell growth medium was refreshed with virus-containing supernatant (5 ml/10 cm dish, supplemented with 4 μg/ml polybrene). A non-infected control plate was taken along. 24 h post infection; successful transformants were selected by addition of 250 μg/ml hygromycin for 5 days (or 7 μg/ml puromycin + 125 μg/ml hygromycin for 3 days, 24 h after the second round of infections). After the hygromycin-based infection, stable transformed cells were maintained for 7 days in 125 μg/ml hygromycin until the puromycin-based infections. Following the second selection, cell populations were recovered in 3.5 μg/ml puromycin- and 125 μg/ml hygromycin-supplemented medium. 24 h prior to creatine uptake assays, recombinant 3T3 Swiss cells were seeded to 70% confluence in medium without antibiotics. 4 replicates per infected cell line were seeded — 3 for creatine uptake and 1 plate to make pellets for both Western blot and Q-PCR. Cell pellets were flash-frozen in liquid nitrogen, and stored at −80 °C until further use. 2.7. Creatine uptake assay Prior to incubation of the cells in creatine, intracellular amino acids were depleted, based on a previously described method [18]. Briefly; recombinant cells were incubated for 1 h at 37 °C in Earle's Balanced Salts (EBSS; Sigma-Aldrich) supplemented with 0.1% D-glucose and 0.25% BSA. Cell monolayers were washed with EBSS and incubated (5 min for 48 h; 95% air/5% CO2 at 37 °C) in DMEM (10% FBS, 1% Pen/Strep, 1% L-Glu) with the desired amount [5 μM (5 μmol/l)–2000 μM (2000 μmol/l)] of stable-isotope-labeled creatine-[methyl-13C] monohydrate. Uptake was stopped by rapidly washing cells with cold Hank's Balanced Salt Solution (HBSS). The cells were harvested (2 min at 37 °C in 0.05% Trypsin + EDTA, GIBCO; Scotland), resuspended in cold HBSS followed by centrifugation (5 min, 1400 rpm). Cell pellets were resuspended in Milli-Q grade water and disrupted by vortexing. After centrifugation (1 min, 12,000 rpm), the supernatant was cleaned further on an Amicon Ultra — 10 K membrane. Measurement of creatine-[methyl-13C] was performed on the protein-free eluate, using creatine-[2H3] (Sigma-Aldrich) as internal standard. In parallel, protein content was determined from a fraction of the disrupted cells using a bicinchoninic acid protein assay kit, according to the instructions of the manufacturer (Sigma-Aldrich). Creatine concentration is expressed as pmol creatine/μg total protein. Measurements were performed on an API 3000 triple quadruple tandem mass spectrometer (Applied Biosystems) with a Perkin-Elmer Series 200 HPLC pump and a PerkinElmer Series 200 auto sampler (operated at 4 °C). Using a Symmetry Shield RP18 analytical column (3.0 × 100 mm; 3.5 μm; Waters) 10 μl of the sample was separated using 5 mM nonapentanoic acid as an ionpair reagent. In 5 min the acetonitrile content was linearly increased from 5% to 15%, and subsequently in 5 min from 15% to 50%. The flow rate was 0.3 ml/min. The turbo ion electrospray was operated in positive ion mode, the cone temperature was set to 450 °C and the cone voltage was 5000 V. Nitrogen was used as the turbo ion gas at a flow rate of 8 l/min. Collision induced dissociation was initiated using nitrogen as the collision gas at a pressure of 0.06 kPa. Creatine was fragmented with a collision energy of 35 V. The following MS/MS transitions were measured (creatine; 132.0 → 90.0, creatine-[methyl-13C]; 133.0 → 91.0 and creatine-[2H3]; 135.0 →93.0). The LC–MS/MS data were acquired and processed using Analyst for Windows software (Applied Biosystems). The limit of quantification (S/N = 10) was estimated to be 20 pmol. 2.8. Western blot Cell pellets were lysed in urea lysis buffer (8 M urea/100 mM NaCl/10 mM Tris–HCL, pH 8.0). Protein concentrations for each sample were determined as described above and normalized to equal concentrations with additional lysis buffer and SDS sample buffer. 54 Cell lysates (40 μg) were size separated on a 12% Bis–Tris Gel (NuPAGE™, Invitrogen), and transferred to a PVDF membrane (iBlot ™, Invitrogen). Immunodetection was performed using antibodies directed against the EGFP tag and against endogenous Actin as a loading control (anti-EGFP, anti-Actin; Abcam). Immune complexes were detected by enhanced chemiluminescence (Lumi-LightPLUS; Roche Applied Science). For analysis of plasma membrane targeting of fusion protein isoforms, the cell membrane component was first extracted (membrane protein extraction kit; BioVision) and then immunoblotted as described above. Immunoblotting with antibodies to endogenous Guanidinoacetate Methyl Transferase (GAMT) was used to confirm the purity of the extracted membrane fractions. 2.9. Fluorescence microscopy Recombinant 3T3 Swiss cells seeded on glass slides (Menzel™ Superfrost) were fixed for 15 min at room temperature (RT) in 4% paraformaldehyde plus 1% Triton X-100 dissolved in phosphate buffered saline (PBS). Slides were washed and mounted for microscopy with Vectashield™ mounting medium (Vector Laboratories). Fluorescence was visualized at 63 × magnification (Objective Plan-Apochromat 63×/ 1.40 oil) with a confocal microscope (LSM 510 Meta, Zeiss). 2.10. Transient transfection of HEK 293 cells Kidney-derived HEK293 cells were cultured in 60 mm cell culture dishes under standard mammalian cell culture conditions to 40% confluence in DMEM cell culture medium (GIBCO, Scotland) supplemented with 1% pen/strep, 1% L-glutamine and 10% FBS. They were subsequently transfected (Fugene™ HD transfection reagent; Promega) with 10 μg of pEGFPN1-based SLC6A8C (CTR4), SLC6A8D (CTR5) or SLC19A3 (thiamine transporter) endotoxin-free plasmid DNA. All constructs were transfected in triplicate and the transfection efficiency based on EGFP fluorescence was estimated to be N90% in all plates (data not shown). 24 h after transfections, cell monolayers were washed, harvested with trypsin and seeded into 100 mm dishes to achieve a confluence of about 70% after 24 h in cell culture medium. 48 h after transfections, creatine uptake was performed as described in Section 2.7. 3. Results and discussion 3.1. Molecular identification and characterization of SLC6A8D While cloning the SLC6A8C variant [14] from a HeLa cell line, a novel variant, which we named SLC6A8D (GenBank: KC800563), was discovered. This variant was the product of an in-frame deletion of exon 9, resulting in a novel 138 bp shorter form of the SLC6A8C mRNA (GenBank: EU280316). The rest of the sequence is 100% homologous to the SLC6A8C mRNA and its coding region is identical to that of SLC6A8C and SLC6A8. Thus at the protein level SLC6A8D (CTR5) is 100% homologous to SLC6A8C (CTR4) with the exception of a 46 amino acid in-frame deletion of residues 54 through 99. The deletion comprises the first cytosolic loop and the second transmembrane domain of the CTR4 protein (based on the LeuT model [19], Fig. 1). A pseudogene of SLC6A8–SLC6A10P, has been mapped to chr16 [20,21]. No SLC6A8 PCR product was observed following a PCR on cDNA of a patient with a genomic deletion of the entire SLC6A8 locus, using a forward primer complementary to both SLC6A8 and SLC6A10P and a reverse primer specific to the 3′ UTR of SLC6A8. Furthermore, nested fragments of both SLC6A8C and SLC6A8D were amplified from PCR products of a forward primer in intron 4 and the SLC6A8–specific reverse primer. Taken together, these results confirm that SLC6A8D is a chrX transcript, and possesses identical 5′ and 3′ UTRs to those of SLC6A8C (Fig. 2). 3.2. Biological relevance of the SLC6A8D splice variant In mouse we confirmed the expression of an exon 9-deficient variant (Slc6a8d) of Slc6a8c. Slc6a8d (GenBank: KC994641) expression was detected in transformed mouse embryonic fibroblasts (NIH-3T3 2.2) and, albeit at lower levels, in a mouse mammary gland cell line (NMuMG). For the first time we also show that SLC6A8C is expressed in monkey (Fig. 3). 3.3. Tissue-specific expression of SLC6A8, SLC6A8C and SLC6A8D The expression levels of SLC6A8 and its splice variants are highest in tissues with high energy requirement like the kidney, colon and small intestine (Fig. 4). Suggesting that like SLC6A8, the splice variants could Fig. 1. Schematic representations of SLC6A8, SLC6A8C and SLC6A8D and their putative transmembrane domains. Because the exons, open reading frame and hence amino acids from SLC6A8 are conserved with splicing, the last five (SLC6A8C) and last four (SLC6A8D) transmembrane domains are identical to those of the full length creatine transporter (CTR1). To be consistent with previous nomenclature, we refer to the SLC6A8D protein as CTR5. 55 Fig. 2. Molecular characterization of SLC6A8D. (A) Shows specificity of reverse primer (Table 1, Nº. 4) to the SLC6A8 transcript. No amplicon could be detected in fibroblasts from an individual with a genomic deletion encompassing the entire SLC6A8 and its flanking genes (lanes 3 and 4) as opposed to control fibroblasts (lanes 1 and 2). This reverse primer in combination with an intron 4 forward primer was used to amplify both SLC6A8C and SLC6A8D messages (B) from HEK 293 cDNA (lane 6, primers; Table 1, Nº. 1). A nested PCR on the resulting amplicons with the same intron 4 forward primer and a reverse primer specific for either SLC6A8C (lane 7, primers; Table 1, Nº. 3) or SLC6A8D (lane 8, primers; Table 1, Nº. 2) confirms that the 5′UTR of SLC6A8D is at least as big as that of SLC6A8C. The mRNA sequence of SLC6A8D, as confirmed by sequencing of cloned PCR products from lane 6, is shown in (C). The underlined sequence depicts intron 4 of SLC6A8, while the bold printed nucleotides represent the cloned open reading frame of the SLC6A8D (CTR5) splice isoform. In all cell lines, absence of gDNA contamination was confirmed by PCR on cDNA synthesized without reverse transcriptase (data not shown). also be involved in regulating creatine uptake. Across all 20 tissues tested, SLC6A8C is the most abundant splice variant of the two, with expression levels noticeably higher than that of SLC6A8 in prostrate and thymus. Fig. 3. Biological relevance of SLC6A8D. Expression of SLC6A8D was analyzed in several mouse cell lines (NIH-3T3 2.2, Mefs, S49, L1210) and tissues (stomach, liver) as well as in two monkey cell lines (Vero, CP132). Amplification of SLC6A8/Slc6a8 and SLC6A8C/Slc6a8c as included controls. The reverse transcriptase (RTO) containing reactions are depicted by a+ and the RTO negative reactions by a− character. Experiments were repeated at least three times and similar results were obtained: representative pictures are shown. Slc6a8d expression is only observed for the transformed fibroblasts (NIH-3T3 2.2) and the mammary epithelial cells (NMuMG). 56 Fig. 4. Expression levels of SLC6A8, SLC6A8C and SLC6A8D across 20 human tissues. All target gene expression values were normalized using GAPDH as reference gene. Amplification efficiency of each primer pair (all between 98.22% and 99.91%) was determined by the standard curve method using serial dilutions of cDNA. The mean normalized expression is a function of the average CT values of the target and reference genes respectively. Bars are mean ± SEM. Fig. 5. Time course (A) and saturation kinetics (B) of creatine transport in recombinant 3T3 Swiss overexpressing SLC6A8-EGFP. Creatine uptake (on cells supplemented with 5, 25, 50, 100, 250, 500, 1000 and 2000 μM creatine) was performed as described in Section 2.7, in triplicate. Each bar represents the mean ± SEM. In the duplicate infections (I and II) uptake is linear within the first 4 h (A). Evaluation with a Michaelis–Menten model revealed a Vmax of 138 ± 3.8 and 113.3 ± 4.4 pmol/4 h/μg protein and a Km of 41.2 ± 5.5 and 34 ± 6.7 μM for Infections I and II respectively (B). Following overnight incubations, cells overexpressing the splice isoforms {SLC6A8C (CTR4) or SLC6A8D (CTR5)} accumulate similar levels of isotopelabeled creatine as those cells expressing only the empty vector or uninfected cells. On the other hand overexpression of SLC6A8 (CTR1) results in a significantly higher creatine uptake capacity at both non-saturating (25 μM) and saturating (500 μM) creatine concentrations (C). Panel (D) shows the expression of EGFP fusion constructs in 40 μg of cell lysate. All cells were infected with two constructs using puromycin and hygromycin as co-selectable markers. “Empty vector” represents a combination of the pBPuro-EGFP/pBHygro-EGFP plasmids, “SLC6A8C” — the pBHygroEGFP/pBPuro-SLC6A8C-EGFP plasmids, “SLC6A8” — the pBHygroEGFP/pBPuro-SLC6A8-EGFP plasmids and “SLC6A8D” — the pBHygroEGFP/pBPuro-SLC6A8CEGFP plasmids. To ensure that all lanes were loaded with equal amounts of protein, the blot was stripped and re-probed with an anti-actin antibody. 57 3.4. Splice variants SLC6A8C (CTR4) and SLC6A8D (CTR5) do not transport creatine In recombinant SLC6A8 cells (overexpressing CTR1) the time course for creatine uptake was linear for up to 4 h in both sets of infections (Fig. 5A). The saturation kinetics of creatine transport was determined following incubation in 5 μM–2 mM of creatine-[methyl-13C]-supplemented medium for 4 h (Fig. 5B). Creatine transport followed Michaelis–Menten kinetics with Vmax values of 113.3 ± 4.4 and 138 ± 3.8 pmol/4 h/μg protein for infections I and II respectively, as well as Km values of 34 ± 6.7 μM (Infection I) and 41.2 ± 5.5 μM (Infection II). Following overnight incubations, cells overexpressing the splice isoforms accumulate similar levels of creatine-[methyl-13C] compared to both cells expressing only the empty vector and uninfected cells. On the other hand overexpressing SLC6A8 (CTR1) results in a 10 fold and a 13 fold increase in creatine uptake capacity at physiological (25 μM) and saturating (500 μM) creatine-[methyl-13C] concentrations respectively (Fig. 5C). Expression of splice isoforms and the full length creatine transporter as a fusion to EGFP is confirmed on Western blot (Fig. 5D). Thus, the splice variants by themselves are not bonafide creatine transporters. 3.5. Re-infecting CTR1-expressing cells with either CTR4 (SLC6A8C) or CTR5 (SLC6A8D) upregulates creatine uptake at physiological concentrations, while increasing Vmax at saturating creatine concentrations To explore whether the splice isoforms regulate SLC6A8, the transporter was expressed with or without additional expression of the splice variants, followed by analysis of creatine transport (Section 2.7). To rule out the possibility of passive creatine transport, a first set of incubations was carried out in medium supplemented only with creatine-[methyl-13C] and in parallel a second set of incubations was carried out in a medium supplemented with equimolar amounts of creatine-[methyl-13C] and guanidinopropionic acid (25, 500 and 1000 μM each). Guanidinopropionic acid (GPA) is a known competitive inhibitor of the creatine transporter [22]. Measurement of cellular creatine levels in the absence and presence of GPA shows that co-expression of the transporter with its splice variant enhances creatine uptake (p b 0.05) at both physiological (25 μM) and saturating (500 μM and 1000 μM) creatine concentrations. Decreased intracellular accumulation of creatine in the presence of GPA confirms that this enhanced uptake is not due to passive diffusion of creatine into the cells (Fig. 6 and 6B). We observe an increase in the maximum rate of creatine transport Fig. 6. Upregulated creatine transport due to increased SLC6A8 protein (CTR1) levels in 3T3 Swiss-SLC6A8 cells re-infected with SLC6A8C or SLC6A8D. Infection I (A, upper panel) and Infection II (B, lower panel) represent independent secondary infections of each construct (empty vector, SLC6A8C or SLC6A8D) on cells already overexpressing SLC6A8-EGFP. Incubations were carried out in triplicate and the measured intracellular creatine was normalized to the total protein content. Cells were incubated with only creatine (Cr) or with equimolar amounts of creatine and guanidino propionic acid (Cr + GPA). Each bar represents the mean ± SEM, and * a p value b 0.05 (one-way ANOVA followed by Dunnett's post-test, comparing SLC6A8/ empty vector to either SLC6A8/SLC6A8C or SLC6A8/SLC6A8D using the GraphPad Prism software). At non-saturating creatine concentrations (25 μM), creatine transport is significantly upregulated 2–3 fold in SLC6A8/SLC6A8C and SLC6A8/SLC6A8D cells when compared to cells expressing only SLC6A8 and the empty vector (SLC6A8/empty vector). At saturating creatine concentrations (500 and 1000 μM), the same holds true for the SLC6A8/SLC6A8C cell lines (up to 4 fold increase); however the upregulation (10–60% increase) is lower in the SLC6A8/SLC6A8D cells when compared to the SLC6A8/empty vector cell lines. To determine if this enhanced creatine accumulating capacity following addition of a splice variant was due to increased SLC6A8 transcription/translation and hence the amount of transporter available at the plasma membrane, quantitative real time PCR was carried out on cell pellets from Infection I (C, upper panel). The normalized expression is a function of the average CT values of SLC6A8-EGFP and mouse Gapdh respectively. Bars are mean ± SEM. There is no significant difference in recombinant SLC6A8-EGFP mRNA expression between 3T3 Swiss-SLC6A8 cells co-expressing a splice variant and those co-expressing the empty vector. However on a Western blot (C, lower panel) SLC6A8 protein levels (CTR1) are higher when either the SLC6A8C (CTR4) or SLC6A8D (CTR5) isoform was co-expressed in place of the empty vector. CTR4 protein levels are higher than those of CTR45 (possibly resulting from higher transfection efficiencies and as such a higher viral titer) with a corresponding higher expression of CTR1. Re-probing the same blot with an anti-actin antibody was carried out as a loading control. 58 (thiamine transporter) construct. Their effect on endogenous creatine uptake was determined as described in Section 2. At both 25 μM and 500 μM creatine concentrations HEK293 cells overexpressing CTR4 and CTR5 had a significant increase (p value b 0.005) in creatine transport compared to cells over-expressing SLC19A3. Though moderate (around 25% increase), the increase of creatine uptake following overexpression of CTR4 and CTR5 in HEK293 cells is in line with what is observed for the heterologous mouse 3T3 Swiss expression system (Fig. 7). This confirms that overexpression of the splice variants has a positive effect on the function of the endogenously expressed creatine transporter. Fig. 7. Physiological relevance of splice variants on endogenous CTR1 in HEK293 cells. Creatine transport is significantly increased by 26–28% in HEK293 cells overexpressing the CTR4 or CTR5 splice isoform compared to cells overexpression the thiamine transporter (SLC19A3). * indicates p value b 0.001 (one-way ANOVA followed by Dunnett's posttest — GraphPad Prism software) between effect on endogenous creatine transport due to CTR4/CTR5 compared to SLC19A3. The uptake of creatine in cells overexpressing SLC19A3 (THTR2) was 8% reduced compared to the pEGFPN1 (empty vector) transfectants (data not shown), which is most likely explained by the fact that the cells have more difficulties in expressing a membrane protein than EGFP only. following addition of SLC6A8C or SLC6A8D as opposed to addition of the empty vector, in recombinant SLC6A8-expressing cells. At nonsaturating creatine concentrations (25 μM) the extent to which SLC6A8D enhances creatine transport is comparable to that by SLC6A8C (2–3 fold). On the other hand at saturating substrate concentrations (500/1000 μM) the maximum SLC6A8D-mediated increase in creatine uptake was only about 1.5 fold as opposed to a 4 fold increase in the case of SLC6A8C. This is most likely due to the higher expression of CTR4 (SLC6A8C-EGFP) compared to CTR5 (SLC6A8D-EGFP) (Fig. 6C, lower panel), resulting in higher CTR1 (SLC6A8-EGFP) protein levels and a concomitant increase in creatine uptake capacity. 3.6. Physiological relevance ofCTR4 and CTR5 To confirm that the splice variants increase the creatine uptake mediated by the endogenous creatine transporter we transiently transfected the kidney-derived HEK293 cells with a pEGFPN1 based SLC6A8C (CTR4) or SLC6A8D (CTR5) plasmid. As a control to exclude that overexpression of an unrelated transporter would give a similar effect we also transiently transfected a pEGFPN1 based SLC19A3 3.7. Splice-variant-dependent upregulation of creatine transport by CTR1 occurs at post transcription After depletion of intracellular creatine followed by incubation in 25, 500 and1000 μM creatine-[methyl-13C]-supplemented medium for 4 h, SLC6A8-EGFP mRNA levels were evaluated in recombinant SLC6A8 cells additionally expressing the empty vector or a splice isoform. At both physiological and saturating creatine concentrations there is no significant difference in SLC6A8 (SLC6A8-EGFP) transcription in the SLC6A8/ empty vector cell line compared to the SLC6A8/SLC6A8C or SLC6A8/ SLC6A8D cell lines (Fig. 6C, upper panel). A Western blot (Fig. 6C, lower panel) shows bands at 100 kDa and 90 kDa corresponding to the glycosylated and unglycosylated SLC6A8-EGFP fusion proteins. There are also bands at 50 kDa (SLC6A8C-EGFP), 40 kDa (SLC6A8DEGFP) and 25 kDa (EGFP). Western blotting reveals that expression of CTR1 (SLC6A8-EGFP) compared to Actin levels is lower in the absence of a co-expressed splice isoform. Interestingly, expression of CTR4 (SLC6A8C-EGFP) is higher than CTR5 (SLC6A8D-EGFP) with a corresponding higher co-expression of CTR1. Thus, additional expression of either CTR4 or CTR5 to CTR1-expressing cells results in an increase in total CTR1 levels. This splice-variant-associated increase in CTR1 protein levels was not accompanied by an increase in mRNA levels, suggesting (post)translational rather than transcriptional regulation. This positive regulation of a parent transporter by its otherwise non-functional variant is of great interest as previous reports investigating the functional relevance of splicing among neurotransmitter transporters revealed a dominant negative effect of the splice isoforms on the function of the transporter. Co-expression of a non-functional rat norepinephrine transporter splice isoform (rNETb) with a functional rNETa isoform in COS cells, decreased the expression and hence activity of the rNETa Fig. 8. Localization of EGFP fusion constructs. To investigate if fusion proteins are targeted to the plasma membrane, 3T3 Swiss-SLC6A8, -SLC6A8/empty vector, -SLC6A8/SLC6A8C and -SLC6A8/ SLC6A8D cells were incubated in 25 μM creatine overnight. A whole cell fraction (lanes 1–4) and a plasma membrane fraction (lanes 5–7) of each recombinant cell type were analyzed on a Western blot. Whole cell fractions were loaded as follows: lane 1; SLC6A8, lane 2; SLC6A8/SLC6A8D, lane 3; SLC6A8/SLC6A8C, lane 4; SLC6A8/Empty vector. Lanes 5, 6 and 7 are plasma membrane fractions of the samples in lanes 2, 3 and 4 respectively. An antibody directed against cytosolic guanidinoacetate N-methyl transferase (GAMT) was used to confirm the purity of the plasma membrane fraction. The Western blots show that, of all fusion proteins, only SLC6A8-EGFP (CTR1) is targeted to the plasma membrane. Absence of the GAMT protein and the unglycosylated SLC6A8-EGFP (glycosylation of the creatine transporter occurs at the Golgi before it is targeted to the plasma membrane, thus these unglycosylated moieties are most likely its ER–Golgi intermediates [44]) confirms the purity of the plasma membrane fractions. 59 Fig. 9. Co-localization of CTR1 with CTR4 and CTR5. Confocal image acquisition (Objective Plan-Apochromat 63×/ 1.40 oil; LSM 510 Meta, Zeiss) of cells co-expressing SLC6A8-EGFP (CTR1) and SLC6A8C-mCherry (CTR4) or SLC6A8D-mCherry (CTR5) indicates that the full length transporter co-localizes with its truncated splice isoforms. isoform [23]. A similar scenario has been described for the glutamatetransporting EAAT1 transporter and its EAAT1exon9skip splice variant [24]. This is very interesting as it raises the possibility that although the regulatory mechanisms in this family of transporters seem to be conserved, the effect on protein function may be different. 3.8. Splice isoforms may facilitate endoplasmic reticulum exit and/or trafficking of full-length transporter Purification of the plasma membrane (PM) fraction of recombinant 3T3 Swiss cells shows that the splice variants are not localized to the plasma membrane like CTR1 (Fig. 8). Thus the splice isoforms do not internalize together with the full-length transporter at the PM to facilitate or enhance its affinity for creatine. However, by replacing the EGFP tag on CTR4 and CTR5 with mCherry (SLC6A8C-mCherry and SLC6A8DmCherry respectively), we show that both CTR4 and CTR5 co-localize with CTR1 (Fig. 9). It is plausible that the splice variants do oligomerize to CTR1 at the level of the ER to facilitate its trafficking to the Golgi, where it will undergo further modification(s) before being targeted to the plasma membrane. This is consistent with previous studies involving regulation of Na+/Cl− cotransporters and further emphasizes the notion that oligomerization-dependent regulation seems to be common among members of this transporter family [25,26]. 4. Concluding remarks In this study we identified a novel variant of SLC6A8–SLC6A8D; identical to SLC6A8C, but lacking exon 9. Differential expression between tissues and conservation across species suggested a functional relevance of these variants. Functional creatine transport analyses reveal that although these splice isoforms do not transport creatine, their coexpression with the full-length transporter results in an enhanced capacity for creatine uptake, reflected by an increase in protein expression of the creatine transporter. Varying the cell surface levels of the transporter via altered trafficking is a fairly common avenue for regulation of neurotransmitter transporters. This results in the maximum rate of transporter activity (Vmax) being altered with little to no change in substrate affinity (Km), reviewed in [27,28]. Studies investigating changes in creatine transporter levels in response to extracellular creatine have shown that creatine saturation or depletion was associated with a reduced or increased Vmax respectively, of creatine transport. In these studies, changes in plasma membrane rather than total CTR1 levels resulted in the altered Vmax [29–33]. The increase in total CTR1 levels in our case, following addition of a splice isoform is an indication that besides being involved in CTR1 trafficking, these splice isoforms may also be involved in extending the half-life of the mature transporter. A possible avenue could be via the ubiquitin-protein ligase — Nedd4-2 (neuronal precursor cell expressed developmentally down-regulated protein), which targets a number of membrane proteins including receptors and ion channels for degradation by the proteasome. A Nedd-4-2-mediated decrease in plasma membrane levels has been shown for the dopamine [34], glucose [35], glutamate [36,37] and thiazide-sensitive [38] Na+/Cl− cotransporters, suggesting that this mechanism could be relevant for regulating the Na+/Cl− creatine transporter as well. In fact there is evidence that the serum/glucocorticoid-regulated kinases (SGK1 and SGK3), which are inhibitors of Nedd4-2 [38–42] increase the maximal transport rate of CTR1 [43]. For the moment we can only speculate that by virtue of their homology to the full-length transporter, SLC6A8C (CTR4) and SLC6A8D (CTR5) can act as alternative targets and thus insulate the transporter from ubiquitin ligases. The extent and nature of this regulation of SLC6A8 by SLC6A8C and SLC6A8D is subject to future investigations. Their effect of enhancing creatine accumulation by SLC6A8 provides new avenues to explore the regulation of the creatine transporter, which may also be relevant for other members of this transporter family. Acknowledgements The authors are grateful to Herman ten Brink for synthesis of the creatine-[methyl-13C]. The anti-GAMT antibodies were a kind gift from Theo Walliman's lab. The mCherry plasmid was obtained by courtesy of Roger Tsien's lab. References [1] J. Gécz, C. Shoubridge, M. Corbett, The genetic landscape of intellectual disability arising from chromosome X, Trends Genet. 25 (2009) 308–316. [2] G.S. Salomons, S.J. van Dooren, N.M. Verhoeven, K.M. Cecil, W.S. Ball, T.J. Degrauw, et al., X-linked creatine-transporter gene (SLC6A8) defect: a new creatinedeficiency syndrome, Am. J. Hum. Genet. 68 (2001) 1497–1500. [3] C.B. Item, S. Stöckler-Ipsiroglu, C. Stromberger, A. Mühl, M.G. Alessandrì, M.C. Bianchi, et al., Arginine:glycine amidinotransferase deficiency: the third inborn error of creatine metabolism in humans, Am. J. Hum. Genet. 69 (2001) 1127–1133. [4] S. Stöckler, D. Isbrandt, F. Hanefeld, B. Schmidt, K. von Figura, Guanidinoacetate methyltransferase deficiency: the first inborn error of creatine metabolism in man, Am. J. Hum. Genet. 58 (1996) 914–922. [5] S. Stöckler-ipsiroglu, G.S. Salomons, Inborn metabolic diseases: diagnosis and treatment, Mol. Cell. Biochem. 244 (2006) 211–217. [6] M. Wyss, R. Kaddurah-Daouk, Creatine and creatinine metabolism, Physiol. Rev. 80 (2000) 1107–1213. [7] A. Evangeliou, K. Vasilaki, P. Karagianni, N. Nikolaidis, Clinical applications of creatine supplementation on paediatrics, Curr. Pharm. Biotechnol. 10 (2009) 683–690. [8] A.M. Klein, R.J. Ferrante, The neuroprotective role of creatine, Subcell. Biochem. 46 (2008) 205–243. 60 [9] J. Wallis, C.A. Lygate, A. Fischer, M. ten Hove, J.E. Schneider, L. Sebag-Montefiore, et al., Supranormal myocardial creatine and phosphocreatine concentrations lead to cardiac hypertrophy and heart failure: insights from creatine transporteroverexpressing transgenic mice, Circulation 112 (2005) 3131–3139. [10] A.J. Lopez, Alternative splicing of pre-mRNA: developmental consequences and mechanisms of regulation, Annu. Rev. Genet. 32 (1998) 279–305. [11] D.L. Black, Protein diversity from alternative splicing: a challenge for bioinformatics and post-genome biology, Cell 103 (2000) 367–370. [12] B. Modrek, C. Lee, A genomic view of alternative splicing, Nat. Genet. 30 (2002) 13–19. [13] E.T. Wang, R. Sandberg, S. Luo, I. Khrebtukova, L. Zhang, C. Mayr, et al., Alternative isoform regulation in human tissue transcriptomes, Nature 456 (2008) 470–476. [14] C. Martínez-Muñoz, E.H. Rosenberg, C. Jakobs, G.S. Salomons, Identification, characterization and cloning of SLC6A8C, a novel splice variant of the creatine transporter gene, Gene 418 (2008) 53–59. [15] P. Simon, Q-Gene: processing quantitative real-time RT-PCR data, Bioinformatics 19 (2003) 1439–1440. [16] P.Y. Muller, A.R. Miserez, Z. Dobbie, Processing of gene expression data generated by quantitative real-time RT-PCR, BioTechniques 32 (2002) 1–6. [17] E.H. Rosenberg, C. Martínez Muñoz, O.T. Betsalel, S.J. van Dooren, M. Fernandez, C. Jakobs, et al., Functional characterization of missense variants in the creatine transporter gene (SLC6A8): improved diagnostic application, Hum. Mutat. 28 (2007) 890–896. [18] C. Amat di San Filippo, N. Longo, Tyrosine residues affecting sodium stimulation of carnitine transport in the OCTN2 carnitine/organic cation transporter, J. Biol. Chem. 279 (2004) 7247–7253. [19] A. Yamashita, S.K. Singh, T. Kawate, Y. Jin, E. Gouaux, Crystal structure of a bacterial homologue of Na+/Cl− dependent neurotransmitter transporters, Nature 437 (2005) 215–223. [20] G.S. Iyer, R. Krahe, L.A. Goodwin, N.A. Doggett, M.J. Siciliano, V.L. Funanage, et al., Identification of a testis-expressed creatine transporter gene at 16p11.2 and confirmation of the X-linked locus to Xq28, Genomics 34 (1996) 143–146. [21] E.E. Eichler, F. Lu, Y. Shen, R. Antonacci, V. Jurecic, N.A. Doggett, et al., Duplication of a gene-rich cluster between 16p11.1 and Xq28: a novel pericentromeric-directed mechanism for paralogous genome evolution, Hum. Mol. Genet. 5 (1996) 899–912. [22] A. Möller, B. Hamprecht, Creatine transport in cultured cells of rat and mouse brain, J. Neurochem. 52 (1989) 544–550. [23] S. Kitayama, Dominant negative isoform of rat norepinephrine transporter produced by alternative RNA splicing, J. Biol. Chem. 274 (1999) 10731–10736. [24] A. Vallejo-Illarramendi, M. Domercq, C. Matute, A novel alternative splicing form of excitatory amino acid transporter 1 is a negative regulator of glutamate uptake, J. Neurochem. 95 (2005) 341–348. [25] H. Sitte, Oligomer formation by Na+–Cl−-coupled neurotransmitter transporters, Eur. J. Pharmacol. 479 (2003) 229–236. [26] H.H. Sitte, H. Farhan, J.A. Javitch, Sodium-dependent neurotransmitter transporters: oligomerization as a determinant of transporter function and trafficking, Mol. Interv. 4 (2004) 38–47. [27] G.E. Torres, S.G. Amara, Glutamate and monoamine transporters: new visions of form and function, Curr. Opin. Neurobiol. 17 (2007) 304–312. [28] A.S. Kristensen, J. Andersen, T.N. Jørgensen, L. Sørensen, J. Eriksen, C.J. Loland, et al., SLC6 neurotransmitter transporters: structure, function, and regulation, Pharmacol. Rev. 63 (2011) 585–640. [29] E. Boehm, S. Chan, M. Monfared, T. Wallimann, K. Clarke, S. Neubauer, Creatine transporter activity and content in the rat heart supplemented by and depleted of creatine, Am. J. Physiol. Endocrinol. Metab. 284 (2003) E399–E406. [30] J.J. Brault, K.A. Abraham, R.L. Terjung, Muscle creatine uptake and creatine transporter expression in response to creatine supplementation and depletion, J. Appl. Physiol. 94 (2003) 2173–2180. [31] M.D. Darrabie, A.J.L. Arciniegas, R. Mishra, D.E. Bowles, D.O. Jacobs, L. Santacruz, AMPK and substrate availability regulate creatine transport in cultured cardiomyocytes, Am. J. Physiol. Endocrinol. Metab. 300 (2011) E870–E876. [32] J.D. Loike, D.L. Zalutsky, E. Kaback, A.F. Miranda, S.C. Silverstein, Extracellular creatine regulates creatine transport in rat and human muscle cells, Proc. Natl. Acad. Sci. U. S. A. 85 (1988) 807–811. [33] M. Tarnopolsky, G. Parise, M.-H. Fu, A. Brose, A. Parshad, O. Speer, et al., Acute and moderate-term creatine monohydrate supplementation does not affect creatine transporter mRNA or protein content in either young or elderly humans, Mol. Cell. Biochem. 244 (2003) 159–166. [34] T. Sorkina, M. Miranda, K.R. Dionne, B.R. Hoover, N.R. Zahniser, A. Sorkin, RNA interference screen reveals an essential role of Nedd4-2 in dopamine transporter ubiquitination and endocytosis, J. Neurosci. 26 (2006) 8195–8205. [35] M. Dieter, M. Palmada, Regulation of glucose transporter SGLT1 by ubiquitin ligase Nedd4‐2 and kinases SGK1, SGK3, and PKB, Obes. Res. 5 (2004) 862–870. [36] C. Boehmer, G. Henke, Regulation of the glutamate transporter EAAT1 by the ubiquitin ligase Nedd4‐2 and the serum and glucocorticoid‐inducible kinase isoforms SGK1/3 and protein kinase B, J. Neurochem. 86 (2003) 1181–1188. [37] C. Boehmer, Post‐translational regulation of EAAT2 function by co‐expressed ubiquitin ligase Nedd4‐2 is impacted by SGK kinases, J. Neurochem. 97 (2006) 911–921. [38] J. Arroyo, D. Lagnaz, Nedd4-2 modulates renal Na+–Cl− cotransporter via the aldosterone–SGK1–Nedd4-2 pathway, J. Am. Soc. Nephrol. 22 (2011) 1707–1719. [39] P. Snyder, D. Olson, B. Thomas, Serum and glucocorticoid-regulated kinase modulates Nedd4-2-mediated inhibition of the epithelial Na+ channel, J. Biol. Chem. 4 (2002) 5–8. [40] P. Snyder, D. Olson, R. Kabra, cAMP and serum and glucocorticoid-inducible kinase (SGK) regulate the epithelial Na+ channel through convergent phosphorylation of Nedd4-2, J. Biol. Chem. 29 (2004) 45753–45758. [41] B. Friedrich, Y. Feng, P. Cohen, T. Risler, The serine/threonine kinases SGK2 and SGK3 are potent stimulators of the epithelial Na+ channel α, β, γ-ENaC, Pflugers Arch.-Eur. J. Physiol. 445 (2003) 693–696. [42] V. Bhalla, D. Daidié, H. Li, Serum- and glucocorticoid-regulated kinase 1 regulates ubiquitin ligase neural precursor cell-expressed, developmentally down-regulated protein 4-2 by inducing interaction with 14-3-3, Mol. Endocrinol. 19 (2005) 3073–3084. [43] M. Shojaiefard, D.L. Christie, F. Lang, Stimulation of the creatine transporter SLC6A8 by the protein kinases SGK1 and SGK3, Biochem. Biophys. Res. Commun. 334 (2005) 742–746. [44] N. Straumann, A. Wind, T. Leuenberger, T. Wallimann, Effects of N-linked glycosylation on the creatine transporter, Biochem. J. 393 (2006) 459–469. [45] O. Braissant, H. Henry, E. Béard, J. Uldry, Creatine deficiency syndromes and the importance of creatine synthesis in the brain, Amino Acids 40 (5) (2011) 1315–1324. 61 Chapter 5 Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes "It appears unlikely that the role of the genes in development is to be understood so long as the genes are considered as dictatorial elements in the cellular economy. It is not enough to know what a gene does when it manifests itself. One must also know the mechanisms determining which of the many gene-controlled potentialities will be realized" David Ledbetter Nanney 62 63 Gene Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes Joseph D.T. Ndika a,b, Vera Lusink a, Claudine Beaubrun a, Warsha Kanhai a, Cristina Martinez-Munoz a, Cornelis Jakobs a, Gajja S. Salomons a,b,c,⁎ a b c Department of Clinical Chemistry, Metabolic Unit, VU University Medical Center, Amsterdam, The Netherlands Neuroscience Campus, VU University Medical Center, Amsterdam, The Netherlands Department of Clinical Genetics, VU University Medical Center, Amsterdam, The Netherlands a r t i c l e i n f o Article history: Accepted 2 October 2013 Available online 18 October 2013 Keywords: Creatine transport Transcriptional regulation Promoter Pseudogene a b s t r a c t Interconversion between phosphocreatine and creatine, catalyzed by creatine kinase is crucial in the supply of ATP to tissues with high energy demand. Creatine's importance has been established by its use as an ergogenic aid in sport, as well as the development of intellectual disability in patients with congenital creatine deficiency. Creatine biosynthesis is complemented by dietary creatine uptake. Intracellular transport of creatine is carried out by a creatine transporter protein (CT1/CRT/CRTR) encoded by the SLC6A8 gene. Most tissues express this gene, with highest levels detected in skeletal muscle and kidney. There are lower levels of the gene detected in colon, brain, heart, testis and prostate. The mechanism(s) by which this regulation occurs is still poorly understood. A duplicated unprocessed pseudogene of SLC6A8–SLC6A10P has been mapped to chromosome 16p11.2 (contains the entire SLC6A8 gene, plus 2293 bp of 5′flanking sequence and its entire 3′UTR). Expression of SLC6A10P has so far only been shown in human testis and brain. It is still unclear as to what is the function of SLC6A10P. In a patient with autism, a chromosomal breakpoint that intersects the 5′flanking region of SLC6A10P was identified; suggesting that SLC6A10P is a non-coding RNA involved in autism. Our aim was to investigate the presence of cis-acting factor(s) that regulate expression of the creatine transporter, as well as to determine if these factors are functionally conserved upstream of the creatine transporter pseudogene. Via gene-specific PCR, cloning and functional luciferase assays we identified a 1104 bp sequence proximal to the mRNA start site of the SLC6A8 gene with promoter activity in five cell types. The corresponding 5′flanking sequence (1050 bp) on the pseudogene also had promoter activity in all 5 cell lines. Surprisingly the pseudogene promoter was stronger than that of its parent gene in 4 of the cell lines tested. To the best of our knowledge, this is the first experimental evidence of a pseudogene with stronger promoter activity than its parental gene. © 2013 Elsevier B.V. All rights reserved. 1. Introduction 1.1. Creatine pathway Creatine is a nitrogenous organic acid whose intracellular pool is maintained by both endogenous synthesis and nutritional uptake. The Abbreviations: ATP, adenosine triphosphate; bp, base pair; kb, kilo base pair; cDNA, DNA complementary to RNA; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase; gDNA, genomic DNA; EGFP, enhanced green fluorescent protein; SV40, Simian virus 40; chr, chromosome; MEFs, mouse embryo fibroblasts; HEK293, human embryonic kidney cell line; 3T3 Swiss, mouse fibroblast cell line; SK-N-SH, human neuroblastoma cell line; mRNA, messenger RNA; miRNA, microRNA; ORF, open reading frame; PCR, polymerase chain reaction; RTPCR, reverse transcriptase-polymerase chain reaction; SLC6A8, solute carrier family 6, member 8; SLC6A10P, solute carrier family 6, member 10 pseudogene; UTR, untranslated region. ⁎ Corresponding author at: Department of Clinical Chemistry, Metabolic Unit, VU University Medical Center, Amsterdam, The Netherlands. Tel.: + 31 204442880; fax: + 31 204440305. E-mail address: [email protected] (G.S. Salomons). 0378-1119/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.gene.2013.10.008 creatine transporter gene, also known as SLC6A8 (GeneID 6535) or CT1, is located on the human chromosome Xq28 and consists of 13 exons (Gregor et al., 1995; Sandoval et al., 1995). Mutations in the SLC6A8 gene lead to congenital creatine deficiency (Salomons et al., 2001). The importance of creatine transport is highlighted by in vitro studies in cerebellar granule cells which show that creatine transport seems to be more efficient in building up total intracellular creatine than de novo synthesis (Carducci et al., 2012). The two enzymes responsible for endogenous creatine synthesis are AGAT (from arginine and glycine) and GAMT (via methylation of guanidinoacetate produced by AGAT). Genetic deficiency of either creatine synthesis enzymes results in depletion of brain creatine, similar to SLC6A8 deficiency (OMIM: 300036). Key clinical features of creatine deficiency are intellectual disability, autism like behavior, movement disorders and epilepsy (Mercimek-Mahmutoglu et al., 2009). Creatine supplementation therapies, especially when initiated in the newborns, have been successful in preventing disease onset and in treating several cases of creatine biosynthesis deficiency (Bianchi et al., 2000, 2007; 64 Mercimek-Mahmutoglu et al., 2006; Ndika et al., 2012; Schulze and Battini, 2007). No treatment options yet exist for creatine transporter deficient patients. Thus unraveling aspects of creatine transporter regulation remain crucial; both in terms of understanding the pathophysiology of creatine biosynthesis deficiencies — to improve existing treatment regimens, and also to explore possible avenues for therapy vis-a-vis SLC6A8 deficiency. 1.2. Intellectual disability Intellectual disability (now the preferred term for mental retardation) is the most common developmental disorder with a worldwide prevalence of 1.37% (Maulik and Mascarenhas, 2011). For the majority of cases of inherited intellectual disability, the genetic cause has not yet been elucidated. X-linked intellectual disability is estimated to account for 5%–12% of all cases of intellectual disability (Herbst and Miller, 1980). The frequency of SLC6A8 mutations in an XLMR population of 288 patients was as high as 2.1% (Rosenberg et al., 2004). In another study, a 1% prevalence of mutations in SLC6A8 was found in boys with intellectual disability of unknown etiology (Clark et al., 2006). So far patients are being diagnosed either via metabolic workup (i.e. creatine and guanidinoacetic acid measurements in urine and plasma) via cranial MRS or genetic testing. In the latter, so far only the coding exons and the neighboring splice sites of the SLC6A8 gene are being analyzed. The unknown promoter region has not yet been included in these analyses. The functional relevance of such (promoter) regions is highlighted by Dunham et al., based on their observation that disease-relevant single nucleotide polymorphisms (SNPs) are enriched within noncoding functional elements — a majority of which reside within or in the vicinity of regions that are outside of protein-coding genes (Dunham et al, 2012). 1.3. Duplicated paralogues of SLC6A8 on chromosome 16 There is a poor understanding of why some genes (paralogous genes) are amplified in our genome during evolution and whether they have a function. Until recently it was believed that paralogous genes were “faults” of nature and had no function. However, nowadays several paralogue genes are known to be expressed and even functional (Pei et al., 2012). A duplicated paralogue of SLC6A8–SLC6A10 (alias CT2) with a transversion of the T in its initial termination codon to a G, extending its open reading frame by 50 amino acids, was mapped to chromosome 16p11.2 (Iyer et al., 1996; Xu et al., 1997). However in chromosome 16 the predicted amino acid sequence was found to harbor a nonsense mutation in “exon 4” (compared to CT1), indicating that a creatine transporter protein cannot be translated from the SLC6A10 mRNA and is most likely a pseudogene (Eichler et al., 1996; Iyer et al., 1996). This established the basis for a change in nomenclature from SLC6A10 to SLC6A10P (Gene ID: 386757). Further clarification on the nature of the SLC6A8 duplication on chromosome 16 was provided by Höglund and colleagues (Höglund et al., 2005). By searching the May 2004 assembly of the human genome on the UCSC genome browser, they found out that there are two adjacent pseudogenes of SLC6A8 on chromosome 16: one at 32797531–32799840 on the reverse strand and the other at 33690486–33692794 on the forward strand. Both loci share a 95.8% sequence similarity with SLC6A8. All published instances of SLC6A10P referred to the pseudogene on the reverse strand, now denoted as SLC6A10pA (Gene ID: 386757), while that on forward strand, SLC6A10pB is listed in Entrez Gene as a predicted gene (Gene ID: 653562). However, with a sequence similarity of 99.6%, it is very likely that some of the cDNA identified as SLC6A10pA also included transcripts from SLC6A10pB. SLC6A10P transcripts (most likely SLC6A10pA and SLC6A10pB messages) have been reported in testis (Iyer et al., 1996) and brain (Bayou et al., 2008). Moreover, according to data from the Gene Expression Atlas — a database of publicly available gene expression data obtained from functional genomics experiments by the European Bioinformatics Institute (EMBL-EBI), differential expression of SLC6A10P (SLC6A10pA and SLC6A10pB) has been seen for some tissues (kidney, skeletal muscle, spinal cord, etc) and cell lines (HT1080, Hela, A498, etc) (http://www.ebi. ac.uk/gxa/gene/ENSG00000214617). This differential and tissuespecific expression pattern suggests that there is/are functional role(s) associated with the SLC6A10P pseudogenes. Supportive of this hypothesis, a translocation breakpoint on chromosome 16p11.2 was mapped to disrupt the 5′flanking sequence of SLC6A10pA in a patient presenting with autism (Bayou et al., 2008). Approximately 2.3 kb of the 5′flanking sequence of SLC6A10pA and SLC6A10pB shares 95% homology to the same region on their parent gene, and 99.9% homology with one another. Other than their differential expression across tissues and experimental conditions, nothing else is known of the regulation and even function of the SLC6A10P pseudogenes. As a first step towards understanding the physiological relevance of these pseudogenes we investigated the presence of a functional promoter and its activation across different cell types. Sequence analysis of the cloned promoter reveals it to be the 5′flanking sequence of the pseudogene on the reverse strand (SLC6A10pA). For simplicity we will refer to both SLC6A10pA and SLC6A10pB as SLC6A10P, except otherwise indicated. 2. Methodology 2.1. Sequence alignment and analysis Using the genome browser feature on UCSC Genome Browser (February 2009 version), we obtained a sequence of approximately 3 kb (2868 bp) upstream of the start of the 5′UTR of SLC6A8. Next we performed a BLAT alignment (Kent et al., 2002) of this region (including the entire 5′UTR [279 bp] and 33 bp into the SLC6A8 open reading frame [ORF]). Restriction site analysis of the selected potential upstream regulatory region (URR) — 3180 bp in total, was done in Vector NTI™ (Invitrogen, Carlsbad, CA, USA). 2.2. Isolation of 5′flanking sequences DNA isolation was carried out using a genomic DNA (gDNA) isolation kit (Promega). Via PCR on isolated gDNA, 5′flanking sequences of SLC6A8 were amplified from whole blood of a healthy donor (male) while 5′flanking sequences of SLC6A10 were amplified from the fibroblast cells of an anonymized individual (male) with a complete deletion of the SLC6A8 locus. Primers were designed to amplify and clone 5′flanking sequences of − 3146/+ 34 base pairs (bp) relative to the first methionine of SLC6A8 and −1016/+34 bp relative to the same methionine on SLC6A10pA/SLC6A10pB. The primers used to obtain the 5′flanking sequence of SLC6A8 were gene-specific while those used to obtain 5′flanking sequences of the pseudogenes could also amplify SLC6A8; however this is avoided by carrying out the PCR on gDNA of the individual with a deletion of the SLC6A8 locus. PCR primers were designed using Vector NTI™ and synthesized by IDTdna (Leuven, Belgium). All PCRs were carried out using a high fidelity polymerase (KAPA HiFi™ HotStart — KapaBiosystems, MA, USA) as specified by the manufacturer. A gradient of different annealing temperatures (Ta) was used to determine the most optimum Ta for each primer pair. In order to enable cloning of PCR products into the reporter vector, forward and reverse primers were designed to contain restriction site sequences at their 5′ends. Potential 5′flanking regulatory regions as well as PCR primers are depicted in Table 1. Truncated 5′flanking sequences of 2345 bp (−2311/+34) and 1104 bp (−1070/+34) were derived by making use of native XhoI and SacI restriction sites within the −3146/+34 — SLC6A8 fragment and a created HindIII restriction site at its 3′end. 66 32896789 − chr16: 5′-GGAGAgagctcAAGGAAGGAGGGAGC-3′ 5′-GGaagcttTATAGATGCCGTTCTCGGCGCTCTTCTTCG-3′ 32897838 66 152952960 + chrX: Digestion 152954063 N/A 152952965 + chrX: 152951749 68 152954063 152951751 + chrX: 5′‐CGCaagcttCTCGAGCCTCTGCTTTCTCTCC‐3′ 5′‐GGctcgagTATAGATGCCGTTCTCGGCGCTCTTCTTCG‐3′ Digestion pGL4.20[luc2/puro]. A DNA sequence of 1.2 kb from the 5′‐most end of the −2279/+34 bp insert was obtained via XhoI/SacI digestion, linearized with Klenow Pol and religated into a linearized and blunted pGL4.20 vector. 2 1 gDNA from SLC6A8 — patient (male) pGL4.20—2.3 kb (SLC6A8) plasmid pGL4.20—2.3 kb (SLC6A8) plasmid pGL4.20—3.2 kb (SLC6A8) plasmid −3146/+34 (SLC6A8) pGL4.20—3.2 kb (SLC6A8) plasmid + chrX: 152951751 152954063 68 NheI HindIII XhoI HindIII HindIII XhoI XhoI SacI SacI HindIII SacI HindIII 70 152954063 152950884 + 5′-gctagcAAACTCCAGCCTTACCAGCCTGAACTTCATGC-3′ 5′-GGaagcttTATAGATGCCGTTCTCGGCGCTCTTCTTCG-3 Digestion −3146/+34 (SLC6A8) 5′ → 3′ −2279/+34 (SLC6A8) 5′ → 3′ +34/−2279 (SLC6A8) 3′ → 5′ −2279/−1064 (SLC6A8)2 5′ → 3′ −1070/+34 (SLC6A8) 5′ → 3′ −1016/+34 (SLC6A10P) 5′ → 3′ chrX: Primer pair/cloning strategy Chro 2.3. Vectors, transfections and promoter assay 5′Flanking region (bp) cloned in pGL4.201 Table 1 Primer sequences and cloning strategy of potential upstream regulatory regions. Locus Strand Start End Annealing temp. (°C) Restriction sites Template gDNA from healthy subject (male) 65 The characterization of 5′flanking sequences from SLC6A8 and SLC6A10P was based on a pGL4.20-Basic promoterless plasmid containing the firefly luciferase gene (pGL4.20[luc2/puro]; Promega). Varying lengths and orientation of the 5′flanking sequences of both SLC6A8 (−3146/+34, −2311/+34, −1070/+34, −2311/−1070, +34/−2311) and SLC6A10P (−1016/+34) were introduced into the MCS of pGL4.20 by standard molecular biology techniques. Sequence integrity of cloned inserts was confirmed by sequencing (Big Dye Termination kit v3.1 — Applied Biosystems). A second plasmid — pGL3-Promoter (pGL3-SV40; Promega), containing a luciferase gene under the control of an SV40 promoter was used as a control for stable expression of luciferase in the different cell types (HeLa, HEK293, SK-N-SH, CEPH, human fibroblast and mouse 3T3 Swiss). Prior to transfections, all cells had been cultured for at least a week in suitable media (HeLa and CEPH — RPMI; HEK293, SK-N-SH, 3T3 Swiss and human fibroblast — DMEM), supplemented with 1% pen/strep, 1% L-glutamine and 10% FBS under standard mammalian cell culture conditions (humidified atmosphere of 95% air/5% CO2 at 37 °C). HeLa, HEK293, SK-N-SH and 3T3 Swiss cells were transfected with FugeneHD™ transfection reagent (Roche Applied Science), using a Fugene to DNA ratio of 6.25 μl:1.25 μg (HeLa, HEK293, 3T3 Swiss — for 24 h), and 16 μl:2 μg (SK-N-SH — for 72 h) in 12 well plates. Transfection of CEPH and human fibroblasts was carried out using the 4D-Nucleofector™ System; Lonza (600 ng DNA/well). To circumvent the problem of crosstalk between promoters (Farr and Roman, 1992) we did not use a second plasmid harboring a functional promoter to normalize for transfection efficiencies. In order to confound variations as a result of varying transfection efficiencies, all plasmid transfections were done on the same day (same cell line passage), in triplicate. Furthermore transfection efficiencies were estimated based on EGFP fluorescence from co-transfections (in adjacent wells) of a pGL3-SV40 plasmid with a plasmid expressing enhanced green fluorescent protein (pEGFP-N1; Clonetech) in a 50:1 ratio (1.225 μg pGL3-SV40 + 0.025 μg pEGFP-N1 for the Fugene transfections and 1.960 μg pGL3-SV40 + 0.04 μg pEGFP-N1 for the Nucleofector transfections). Cells transfected with the pGL4.20-Basic plasmid are used as a negative control. Analysis of promoter activity was carried out by measuring luminescence signal intensity (Victor Wallac™ luminometer — PerkinElmer) generated from cell lysates of transfected cells to which luciferase assay reagent had been added (Luciferase Assay Kit; Promega). Luciferase activity (and consequently promoter activity) is expressed as luminescence units (LU)/μg of total protein. 3. Results 3.1. Selection of potential upstream regulatory region − 3146 bp to + 34 bp relative to the first methionine (+ 1ATG) of SLC6A8 (RefSeq Gene: NM_00569) contains a region − 2311/+ 34 that is 95% homologous to the two paralogous loci on chromosome 16. Native XhoI and SacI restriction sites located at −2279 and −1070 respectively, were used to generate truncated fragments from the 5′end of the −3146/+34 fragment. Sequence homology of all three fragments: −3146/+34 [3180 bp], −2279/+34 [2313 bp] and −1070/+34 [1104 bp], to the paralogous chromosome 16 loci is shown in Fig. 1. The entire Xq28 locus that has been duplicated on chr16 is shown in Fig. 2. 3.2. Functional identification of 5′flanking regulatory sequence of SLC6A8 Since SLC6A10P conserves a 5′flanking sequence of 2311 bp as its parent gene, we hypothesized that promoter features will be localized in this upstream sequence. However, unlike SLC6A8, SLC6A10P expression has so far only been reported for testes and fetal brain. A possible explanation for this could be that the sequence variants which 66 Fig. 1. Human BLAT search results (UCSC Genome Browser, version February 2009) depicting cloned 5′flanking sequences. a: −3146/+34 b: −2279/+34 and c: −1070/+34 base pairs relative to the first methionine (+1ATG) of the SLC6A8 open reading frame. d: −1016/+34 base pairs relative to the first methionine (+1ATG) of creatine transporter gene paralogous at chromosome 16p11.2. The 5′regulatory regions of the two pseudogenes share 99.9% sequence similarity. Sequence ID can be obtained via genomic coordinates (from the left; columns 6, 7, 8 and 9). have accumulated upstream of SLC6A10P (RefSeq Gene: NR_003083) decreased transcription factor binding affinity and/or created new transcription factor binding sites. Alternatively, upstream of the 2311 bp region on SLC6A8 there could be enhancer-like elements facilitating transcription of the creatine transporter gene — a region which is not conserved upstream of SLC6A10P. Thus to identify the proximal promoter and potential enhancer(s), we cloned the − 3146/+ 34 and − 2279/+ 34 fragments from the SLC6A8 gene into the pGl4.20 vector. Subsequent transfections and luciferase assays in 3 different cell types confirmed the presence of promoter activity. However there was no significant difference in promoter strength between the − 3146/+ 34 and − 2279/+ 34 5′flanking regulatory sequences (Fig. 3). 3.3. Characterization of truncated promoter fragments To further characterize the promoter region, we truncated the −2279/+34 fragment into two: −2279/−1064 and −1070/+34. The − 1070/+ 34 fragment gives the same degree of transcriptional activation as the − 3146/+ 34 and − 2279/+ 34. Fragment − 2279/− 1064 was unable to drive transcription of the luciferase gene. Cloning of fragment − 2279/+ 34 in reverse orientation to the luciferase gene (+ 34/− 2279) led to a repression of promoter activity (Fig. 4). Fig. 2. A schematic of chromosome 16 showing two paralogous copies of a duplicated locus from chromosome Xq28. Comparative sequence analysis between Xq28 and 16p11.2 using the most recent assembly of the human genome (Feb 2009, GRCh37/hg19) at the UCSC genome browser, reaffirms the duplication of a 26,542 bp segment of Xq28 (chrX:152,951,719-152,978,261) to two separate regions on chromosome 16p11.2 which are approximately 877 kb from each other {one on the + strand [chr16: 33,776,247 to 33,802,719] and the other on the — strand [chr16: 32,899,081 to 32,872,610]}. Both paralogous segments include 2311 bp of 5′sequence flanking the first methionine of SLC6A8, the entire SLC6A8 gene as well as its entire 3′UTR and part of the flanking BCAP31 gene. Fig. 3. Identification of upstream regulatory region on SLC6A8. In all 3 cell lines, − 3146/+ 34 bp and − 2279/+ 34 bp of 5′flanking sequences significantly induce transcription of the luciferase gene compared to the empty vector. 67 Fig. 4. Characterization of promoter sequences in Hela cells. Arrow direction indicates the orientation of the cloned sequence. pGL4.20 refers to cells transfected with the empty vector. Progressive truncation of the SLC6A8 5′flanking sequence of 3180 bp (−3146/+34) to 2313 bp (−2279/+34) and 1104 bp (−1070/+34) results in no significant change in promoter activity (p-value: a = 0.11 and d = 0.15 respectively), thus the core promoter sequence is conserved within the 1104 bp sequence. This is furthermore confirmed by the absence of promoter activity in fragment −2279/−1064 consisting of 1241 bp of 5′sequence from the 2313 bp fragment (p-value: c = 0.0001). Analysis of a paralogous region on chromosome 16 (−1016/+34 of 5′sequence flanking of SLC6A10pB) corresponding to the −1070/+34 fragment indicates that the pseudogene indeed has a functional and potentially stronger promoter compared to its parent gene (p-value: e = 0.00035). Reversing the orientation of the −2279/+34 fragment represses promoter activity (p-value: b = 0.0001). Statistical significance was determined using an unpaired t-test. 3.4. 5′flanking sequence on pseudogene conserves core promoter activity Because the upstream regulatory region homologous between SLC6A8 and SLC6A10P (Fig. 3) has promoter activity, we wondered if promoter function was conserved for the paralogue gene as well. A 5′flanking sequence (−1016/+34) that was 93% homologous to the −1070/+34 fragment, containing the core promoter of SLC6A8 was isolated from SLC6A10P (Fig. 1c and Table 1). Sequence analysis confirmed this paralogous fragment to be from the reverse strand, which is 99.9% homologous to the second duplicated locus on the forward strand (Fig. 1d) of Chr 16. Interestingly the −1016/+34 fragment flanking the pseudogene harbors a stronger promoter compared to the same region flanking SLC6A8. The characterized promoter activity of 5′flanking sequences of both SLC6A8 and its paralogue from chr16 is shown in Fig. 4. binding sites within, and/or absence of enhancer elements further upstream of this 2.3 kb region resulted in a lower and varying expression of SLC6A10P. Functional analyses of 5′flanking sequences from SLC6A8 provide evidence of a promoter restricted within 1104 bp, spanning the entire 5′UTR and 34 bp into its ORF. This 1104 bp also entirely spans previously predicted transcription factor binding sites (Sandoval et al., 1995). The observed promoter activity 3.5. Relative strength of the parent and pseudogene promoters Promoter strength across five different cell lines was determined relative to that of a constitutive SV40 promoter located within the pGL3-Promoter plasmid (Section 2.3). The paralogous promoter is significantly stronger than its parent promoter in four of the five cell lines tested (Fig. 5). 4. Discussion and conclusion Transcriptional gene regulation is mediated by the presence of cisacting (promoters and/or enhancers), or trans-acting (DNA-binding proteins) elements. DNA-binding proteins are targeted to their respective binding sites on the promoter, and via their concerted action, RNA polymerase is able to bind and synthesize mRNA from the DNA strand. Sequence analysis of a 2313 bp sequence flanking the SLC6A8 open reading frame (ORF) reveals that it is 94% homologous to the same region flanking the two paralogous copies of the SLC6A8 gene on Chr 16. Because of the altered expression profile of SLC6A10P relative to SLC6A8 we hypothesized that loss of integrity of transcription factor Fig. 5. Transcriptional potential of SLC6A8 (−1070/+34) and SLC6A10pB (−1016/+34) core promoter across different cell lines. Promoter strength (transcriptional potential) is described in terms of relative normalized luminescence units — luminescence signal as a result of the 5′flanking promoter sequence normalized to the mean luminescence signal generated by transfecting the cell line in question with a promoterless pGL4.20 vector. The promoter of SLC6A10pB is a stronger activator of transcription (2- to 7-fold greater) than the promoter of SLC6A8 in 4 of the 5 cell lines tested (HEK293, CEPH, Fibroblast and SK-N-SH). Statistical significance was determined using an unpaired t-test. The p-values for the difference in promoter activity between SLC6A8 and SLC6A10pB for each cell line are HEK293—0.0300 (a), CEPH—0.0080 (b), Fibroblast—0.6300 (c), Hela—0.0007 (d) and SK-N-SH—0.0060 (e). 68 in the mouse 3T3 Swiss cell suggests that transcription factor binding sites have been conserved across species (Fig. 3). Transcription factor activation of the SLC6A8 promoter is cell-type dependent (Fig. 5) and differential expression of SLC6A8 has been seen across various cells and tissue types (http://www.ebi.ac.uk/gxa/gene/ENSG00000130821). Thus altered promoter activation, via differential transcription factor expression, could very well be one of the key mechanisms by which SLC6A8 mRNA levels are regulated. SLC6A8 deficiency, an X-linked intellectual disability syndrome is caused by mutations including large genomic deletions in the SLC6A8 gene. It could also be that mutations in the promoter region cause this disorder. By having the knowledge on the promoter of SLC6A8 we now can include this region in the diagnostic workup of patients suspected to have a creatine transporter defect. Thus this gene region can be tested for the presence of variants, as is currently being done for the coding region and the splice sites by DNA sequence analysis. The proximal promoter region of SLC6A8 (1070 bp from the first methionine) can now be included during DNA sequence analysis in patients presenting with clinical and biochemical features of SLC6A8 deficiency or intellectual disability of unknown etiology. Contrary to expectations, the 5′flanking sequence of the paralogous SLC6A10pA gene harbors a stronger promoter than that of its parent gene. This SLC6A10pA promoter sequence has a 99.9% homology to the 5′flanking sequence of SLC6A10pB; as such the promoter upstream of SLC6A10pB is most likely functional. Albeit the presence of a very strong promoter, sequence analyses of the SLC6A10P pseudogenes indicate the presence of a premature termination codon in exon 4 (with respect to SLC6A8). Prior to the resolution of the structure of a bacterial homologue of the creatine transporter (bacterial LeuT [Yamashita et al., 2005]), SLC6A10P was predicted to be a creatine transporter. However transmembrane domains 1 and 6 (exons 1 and 6) are involved in substrate binding, thus it is very unlikely that the SLC6A10pA or SLC6A10pB transcripts will encode a protein capable of transporting creatine. Taken together all these findings suggest that, creatine transport aside, the creatine transporter pseudogene may be functional. This raises two (amongst others) possibilities; on the one hand transcribed SLC6A10P could serve as a buffer of miRNAs that will otherwise target and downregulate expression of the parent SLC6A8 gene. The 3′UTR of SLC6A8 mRNA shares about 97% sequence homology with its paralogous loci on Chr 16, supporting the notion that transcribed SLC6A10P might act as a decoy for miRNA families that will otherwise target SLC6A8. Such a miRNA-based regulation of a gene by its pseudogene(s) has been demonstrated for OCT4 (Suo et al., 2005), KRAS (Poliseno et al., 2010) and PTEN (Alimonti et al., 2010; Carracedo et al., 2011) transcripts. On the other hand alternative splicing and alternative promoter usage are known to contribute to mRNA heterogeneity and thus the proteomic complexity of a single locus. It is therefore conceivable that the identified proximal promoter could represent the promoter of an alternative SLC6A10P variant (conserved open reading frame) or a different gene (different open reading frame) at the same locus. According to the autism chromosome rearrangement database (http://projects.tcag.ca/autism/) about 53% of autism-related copy number variants identified so far on chromosome 16 are at the 16p11.2 locus, and may account for approximately 1% of all autism spectrum disorder cases (Kumar et al., 2008; Weiss et al., 2008). Bearing in mind that a patient presenting with autism was identified with a chromosomal deletion of a region immediately upstream of SLC6A10pA (Bayou et al., 2008), the experimental evidence provided herein of a potent promoter flanking the SLC6A10pA locus (and probably SLC6A10pB, by virtue of the 99.9% sequence homology of its potential promoter to that of SLC6A10pA) should pave the way for subsequent functional studies aimed at unraveling the functional relevance of the SLC6A10P pseudogenes. Be it as possible regulators of SLC6A8 or some other unanticipated role. In summary, we have provided functional evidence of cell-type dependent transcriptional activation of both the SLC6A8 and SLC6A10P promoters. Further analysis will be required to evaluate the identities of important transcription factor-binding sites and to identify elements involved in tissue-specific expression of these genes. Conflict of interest The authors declare no conflict of interest. References Alimonti, A., et al., 2010. Subtle variations in Pten dose determine cancer susceptibility. Nat. Genet. 42 (5), 454–458. Bayou, N., et al., 2008. The creatine transporter gene paralogous at 16p11. 2 is expressed in human brain. Comp. Funct. Genomics 609684, 1–5. Bianchi, M.C., et al., 2000. Reversible brain creatine deficiency in two sisters with normal blood creatine level. Ann. Neurol. 47 (4), 511–513. Bianchi, M.C., et al., 2007. Treatment monitoring of brain creatine deficiency syndromes: a 1H- and 31P-MR spectroscopy study. AJNR Am. J. Neuroradiol. 28 (3), 548–554. Carducci, C., et al., 2012. In vitro study of uptake and synthesis of creatine and its precursors by cerebellar granule cells and astrocytes suggests some hypotheses on the physiopathology of the inherited disorders of creatine metabolism. BMC Neurosci. 13 (1), 41. Carracedo, A., Alimonti, A., Pandolfi, P.P., 2011. PTEN level in tumor suppression: how much is too little? Cancer Res. 71 (3), 629–633. Clark, A.J., et al., 2006. X-linked creatine transporter (SLC6A8) mutations in about 1% of males with mental retardation of unknown etiology. Hum. Genet. 119 (6), 604–610. http://dx.doi.org/10.1007/s00439-006-0162-9. Dunham, I., et al., 2012. An integrated encyclopedia of DNA elements in the human genome. Nature 489 (7414), 57–74. Eichler, E.E., et al., 1996. Duplication of a gene-rich cluster between 16p11.1 and Xq28: a novel pericentromeric-directed mechanism for paralogous genome evolution. Hum. Mol. Genet. 5 (7), 899–912. Farr, a, Roman, a, 1992. A pitfall of using a second plasmid to determine transfection efficiency. Nucleic Acids Res. 20 (4), 920. Gregor, P., Nash, S., Caron, M., 1995. Assignment of the creatine transporter gene (SLC6A8) to human chromosome Xq28 telomeric to G6PD. Genomics 25, 332–333. Herbst, D.S., Miller, J.R., 1980. Nonspecific X-linked mental retardation II: the frequency in British Columbia. Am. J. Med. Genet. 7 (4), 461–469. Höglund, P., Adzic, D., Scicluna, S., 2005. The repertoire of solute carriers of family 6: identification of new human and rodent genes. Biochem. Biophys. Res. Commun. 336, 175–189. Iyer, G.S., et al., 1996. Identification of a testis-expressed creatine transporter gene at 16p11.2 and confirmation of the X-linked locus to Xq28. Genomics 34 (1), 143–146. Kent, W.J., et al., 2002. The human genome browser at UCSC. Genome Res. 12 (6), 996–1006. Kumar, R. a, et al., 2008. Recurrent 16p11.2 microdeletions in autism. Hum. Mol. Genet. 17 (4), 628–638. Maulik, P., Mascarenhas, M., 2011. Prevalence of intellectual disability: a meta-analysis of population-based studies. Res. Dev. Disabil. 32, 419–436. Mercimek-Mahmutoglu, S., et al., 2006. GAMT deficiency: features, treatment, and outcome in an inborn error of creatine synthesis. Neurology 67 (3), 480–484. Mercimek-Mahmutoglu, S., Stöckler-Ipsiroglu, S., Salomons, G.S., 2009 Jan 15. Creatine Deficiency Syndromes. [Updated 2011 Aug 18] In: Pagon, R.A., Bird, T.D., Dolan, C.R., et al. (Eds.), GeneReviews™ [Internet]. University of Washington, Seattle, Seattle (WA). 1993. Available from: http://www.ncbi.nlm.nih.gov/books/NBK3794/. Ndika, J.D.T., et al., 2012. Developmental progress and creatine restoration upon longterm creatine supplementation of a patient with arginine:glycine amidinotransferase deficiency. Mol. Genet. Metab. 106 (1), 48–54. Pei, B., et al., 2012. The GENCODE pseudogene resource. Genome Biol. 13 (9), R51. Poliseno, L., Salmena, L., Zhang, J., Carver, B., Haveman, W.J., Pandolfi, P.P., 2010. A codingindependent function of gene and pseudogene mRNAs regulates tumour biology. Nature 465 (7301), 1033–1038. Rosenberg, E.H., et al., 2004. High prevalence of SLC6A8 deficiency in X-linked mental retardation. Am. J. Hum. Genet. 75 (1), 97–105. Salomons, G.S., et al., 2001. X-linked creatine-transporter gene (SLC6A8) defect: a new creatine-deficiency syndrome. Am. J. Hum. Genet. 68 (6), 1497–1500. Sandoval, N., et al., 1995. The genomic organization of a human creatine transporter (CRTR) gene located in Xq28. Genomics 30 (3), 383–385. Schulze, A., Battini, R., 2007. Pre-symptomatic treatment of creatine biosynthesis defects. Subcell. Biochem. 46, 167–181. Suo, G., Han, J., Wang, X., Zhang, J., Zhao, Y., 2005. Oct4 pseudogenes are transcribed in cancers. Biochem. Biophys. Res. Commun. 337, 1047–1051. Weiss, L.A., et al., 2008. Association between microdeletion and microduplication at 16p11.2 and autism. N. Engl. J. Med. 358, 667–675. Xu, W., Liu, L., Gorman, P., Sheer, D., Emson, P., 1997. Assignment of the human creatine transporter type 2 (SLC6A10) to chromosome band 16p 11.2 by in situ hybridization. Cytogenet. Cell Genet. 76 (1-2), 19. Yamashita, A., Singh, S.K., Kawate, T., Jin, Y., Gouaux, E., 2005. Crystal structure of a bacterial homologue of Na+/Cl-dependent neurotransmitter transporters. Nature 437 (7056), 215–223. 69 Chapter 6 RNA sequencing of creatine transporter (SLC6A8) deficient fibroblasts reveals impairment of the extracellular matrix. "If Louis Pasteur were to come out of his grave because he heard that the cure for cancer still had not been found, NIH would tell him, “Of course we'll give you assistance. Now write up exactly what you will be doing during the three years of your grant.” Pasteur would say, “Thank you very much,” and would go back to his grave. Why? Because research means going into the unknown. If you know what you are going to do in science, then you are stupid! This is like telling Michelangelo or Renoir that he must tell you in advance how many reds and how many blues he will buy, and exactly how he will put those colors together" Albert Szent-Gyorgyi 70 71 RNA sequencing of creatine transporter (SLC6A8) deficient fibroblasts reveals impairment of the extracellular matrix. Benjamin Nota PhD1, Joseph D. T. Ndika MSc1, Jiddeke M. van de Kamp MD2, Warsha A. Kanhai MSc1, Silvy J. M. van Dooren MSc1, Mark A. van de Wiel PhD3, Gerard Pals PhD 2, and Gajja S. Salomons PhD1,* 1Metabolic unit, Department of Clinical Chemistry, VU University Medical Center, Amsterdam, The Netherlands of Clinical Genetics, VU University Medical Center, Amsterdam, The Netherlands 3Department of Epidemiology and Biostatistics, VU University Medical Center, Amsterdam, The Netherlands 2Department * Corresponding author, email: [email protected], telephone: +31204443053 Postal Address: Metabool Lab, PK 1X 009. De Boelelaan 1117. 1081HV. Amsterdam, The Netherlands. 72 Abstract OBJECTIVE: Creatine transporter (SLC6A8) deficiency is the most common cause of cerebral creatine deficiency syndromes, and is characterized by depletion of creatine in the brain. Manifestations of this X-linked disorder include intellectual disability, speech/language impairment, behavior abnormalities, and seizures. At the moment no effective treatment is available. The objective of this study was to investigate the molecular pathophysiology of SLC6A8 deficiency. METHODS: In order to investigate the molecular pathophysiology of this disorder we performed RNA sequencing on fibroblasts derived from patients. The transcriptomes of fibroblast cells from eight unrelated individuals with SLC6A8 deficiency and three wild type controls were sequenced. SLC6A8 mutations with different effects on the protein product resulted in different gene expression profiles. RESULTS: Differential gene expression analysis followed by gene ontology term enrichment analysis revealed that especially the expression of genes encoding components of the extracellular matrix and cytoskeleton are changed in SLC6A8 deficiency, such as collagens, keratins, integrins, and cadherins. INTERPRETATION: Our findings suggests an important novel role for creatine in the structural development and maintenance of cells. It is likely that the (extracellular) structure of brain cells is also impaired in SLC6A8 deficient patients, but further studies are necessary to confirm this and to reveal the true functions of creatine in the brain. 73 Introduction Inborn errors of creatine metabolism lead to cerebral creatine deficiency syndromes and are characterized by low levels of creatine in the brain. Manifestations of these syndromes are intellectual disability, speech and language impairment, behavior abnormalities, and often seizures 1,2. These disorders are either autosomal recessive caused by defects in the genes encoding the creatine biosynthesis enzymes guanidinoacetate methyltransferase (GAMT) 3 or arginine:glycine amidinotransferase (AGAT) 4, or they are X-linked caused by defects in the creatine transporter SLC6A8 5. Oral creatine supplementation is beneficial, especially when initiated at early age, for individuals with GAMT or AGAT deficiency 4,6, however not effective for individuals with SLC6A8 deficiency 7. Currently there is no appropriate treatment for SLC6A8 deficiency but the results of recent studies with cyclocreatine treatment in creatine transporter deficient mice 8, or lipophilic creatine derivatives in SLC6A8 deficient human fibroblasts 9, look promising. Although the ensuing symptoms due to SLC6A8 deficiency in particular and creatine deficiency as a whole, are similar across all patients, the severity of these symptoms does in fact differ between groups of patients. Especially concerning the extent of intellectual disability as well as the presence/absence and frequency of epileptic seizures. No concrete genotype-phenotype correlation has yet been established, but there might be a correlation between residual transporter activity (and consequently residual brain creatine) and severity of the symptoms10. In order to develop successful treatment regimens for SLC6A8 deficiency it is crucial, in our opinion, to unravel the pathophysiology (deregulated pathways) of SLC6A8 deficiency. The advent of novel technologies, such as next-generation sequencing, now make it possible to elucidate the molecular mechanisms behind the pathophysiology of disorders 11. To gain insight into the pathophysiology of SLC6A8 deficiency, we performed RNA sequencing (RNA-seq) analysis on different fibroblast cultures derived from patients or controls. RNA-seq is a very powerful tool for determining differences in transcriptomes 12. The principle behind RNA-seq is to sequence the mRNA molecules derived from a certain sample. This allows the determination of which transcripts and how many copies are present at a certain time or condition. RNA-seq studies have been performed already to understand numerous neurological disorders, such as autism 13, and schizophrenia 14. It can reveal for example which cellular processes, molecular pathways, or transcriptional networks are disrupted or impaired in disorders. We used fibroblasts as a model for this disorder, because it is easily accessible patient material. Furthermore fibroblasts express SLC6A8, and are used to confirm/exclude the diagnosis SLC6A8 deficiency by so called creatine uptake assay 15. In addition, primary SLC6A8 deficient fibroblast are being used to study the effect of novel missense variants in this gene by overexpression studies 15. We investigated the transcriptomes of fibroblasts containing different mutations in SLC6A8 that had different effects on the protein product. The first mutation: c.1631C>T; p.(Pro544Leu), a missense mutation commonly found in different families, was associated with a 40% residual creatine uptake activity compared to wild type (WT) 15. The second mutation: c.1222_1224delTTC; p.(Phe408del), a common in frame deletion of three nucleotides resulting in the deletion of one amino acid, causes 0% residual activity of the transporter compared to WT 15. To enable sound statistical analysis we took 74 biological variation into account; we assessed the transcriptomes of fibroblasts of three unrelated individuals for each of these mutations, and compared it to three different WT fibroblasts. We also included fibroblasts from two other individuals; one with a nonsense mutation and the other with a mutation consisting of a large genomic deletion in which the entire SLC6A8 gene has been deleted as well as a portion of the neighboring genes, which we herein refer to as SLC6A8 del1-13. Material and Methods Subjects, cell culturing, and RNA isolation Eight anonymous male subjects diagnosed with SLC6A8 deficiency were included in this study. A short summary of the most common clinical manifestations in mild (Pro544Leu) and severe (Phe408del) SLC6A8 deficiency can be found in Supplemental Table S1. Fibroblasts taken from skin were cultured in Gibco DMEM medium (Life technologies), supplemented with 10% FBS and 1% Pen/Strep, under standard mammalian cell culture conditions. As control three (male) fibroblast cell lines with WT SLC6A8 were used. Cultures with 70% confluence were harvested by centrifugation (340 g ~ 1520 rpm), and cell pellets were stored at –80°C. The study was approved by the ethics committee of the VUMC, Amsterdam, The Netherlands. RNA was isolated from the cell pellets with the SV Total RNA Isolation kit (Promega), according to manufacturer’s guideline with a slight modification: the pellets were pre-treated with RNA BEE (Amsbio) and chloroform, in order to remove genomic DNA. RNA quality was assessed with an Agilent Eukaryote Total RNA Nano assay in a 2100 Bioanalyzer (Agilent). RNA integrity number (RIN) values between 9.50 and 10 were derived, which indicated intact RNA in the samples. Quantification and purity assessment of the RNA samples were done on a NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific), and produced 260/280 nm ratios between 2.09–2.13 which indicated “pure” RNA. Library preparation and next-generation sequencing Low-throughput protocol of the TruSeq RNA Sample Preparation Kit (Illumina) was followed to generate libraries suitable for sequencing, using 2 µg total RNA input per sample. Libraries were quantified with an Agilent DNA 1000 assay in a 2100 Bioanalyzer. Twelve different libraries (including the eleven of this study) were divided over two equimolar pools which contained six libraries each. Each pool was loaded into four channels of a flow cell for cluster generation with a cBot system (illumina), and subsequent sequencing by synthesis was performed with a paired-end 100 bp protocol on a HiSeq 2000 (Illumina). Data analysis The paired-end reads were aligned to the human reference genome (UCSC Genome Browser hg19) using TopHat v2.0.6 16, which made use of Bowtie v0.12.7.0 17, SAMtools v0.1.18.0 18, and was run under default settings (with phred33 quality scale). For each sample a BAM file was loaded into R (2.15.2) using Rsamtools (1.10.2), the aligned reads were counted per known transcript (annotation from UCSC Genome Browser hg19) using IRanges (1.16.4) and GenomicRanges (1.10.6). In total the aligned reads were counted for 39,680 transcripts of 23,398 genes. The raw read counts per transcript, per sample (n 75 = 11), were used in edgeR v3.0.8 19 for differential expression assessment. In edgeR the read counts were not adjusted for gene or transcript length since this is not recommended by the developers, however for library size a correction factor was taken into account by the model. Only the transcripts with at least > 1 reads in ≥ 3 samples were kept for analysis. Common dispersion was estimated with the general linear models method in edgeR, and differential expression of transcripts were determined for the following comparisons (contrasts): “Pro544Leu” vs. “WT”, “Phe408del” vs. “WT”, “Phe408del” vs. “Pro544Leu”, “nonsense” vs. “WT”, and “SLC6A8 del1–13” vs. “WT”. False discovery rate (FDR) control was used to correct for multiple testing 20, and FDR adjusted p-values < 0.05 were considered significant. Genes, of which transcripts were found significantly differentially expressed in the edgeR analysis, were further used for GO enrichment analysis using GOseq 21. Enrichment of GO terms was assessed in each list of differential genes per contrast separately, taking length bias into account. The derived p-values were corrected for multiple testing using FDR control, and adjusted p-values < 0.05 were considered significant. Quantitative reverse transcription PCR For five genes (and one reference gene) qPCR assays were designed with ProbeFinder version 2.50 for Human (Roche). In Supplemental Table S2 the primer sequences and the universal probe numbers are given for each assay. The same RNA samples from the three patients with the Phe408del mutation and from the three WT samples were used, cDNA was made from approximately 1 µg RNA (OmniscriptTM RT kit - Qiagen). Each sample was assayed for each gene in triplicate on a light cycler type LC480 (Roche), according to the manufacturer’s guidelines. A mean normalized expression (MNE) value was calculated from the obtained Ct values with the Q-Gene module 22, as described previously 23. GAPDH was used as a reference gene for normalization of input cDNA. For each target gene a mean Phe408del/WT ratio was calculated which was log2 transformed. A Pearson product-moment correlation coefficient was calculated in R v2.15.1, and a p-value < 0.05 was considered significant. Results RNA derived from different fibroblast cultures from individuals with SLC6A8 deficiency and controls was assessed using RNA-seq analysis. A whole Illumina HiSeq2000 flow cell was run with 12 different RNAseq libraries, including all 11 libraries generated from the 11 samples of this study. Therefore 2/3 lane was available per library. All together the run produced 2.5 × 10 9 100 bp long paired-end reads that could be assigned to the 11 samples. On average 59% could be mapped to the human genome (hg19), using TopHat with default settings. Further details about the reads are available in Supplementary Table S3. The mapped reads for each known (hg19 USCS annotated) transcript were counted using Rsamtools, to allow subsequent statistical analysis. In total these “raw counts” were determined for 39,680 transcripts, from 23,398 genes. We used edgeR 19 to test which transcript levels were significantly different between groups (false discovery rate; FDR < 0.05), and the number of differentially expressed transcripts for each group comparison (contrast) are summarized in Table 1. The largest number of transcripts that showed differential expression was found between mutation Phe408del and WT (n = 120), and the smallest number was between Pro544Leu and WT (n = 29). Ten transcripts (from five genes) were significantly 76 differentially expressed in both Pro544Leu vs. WT and Phe408del vs. WT comparisons (Supplementary Fig. 1). For each group comparison; all differentially expressed transcripts and their fold changes and pvalues are shown in Supplementary Table S4–8. In general, more significantly up- than downregulated transcripts were identified in SLC6A8 deficient cells compared to WT. In total the expression of 132 genes was significantly altered in one or more comparisons. Twenty-six (19.6%) of these genes are associated with brain and/or neurons (see Supplementary Table S4–8). In our analysis, we identified significantly differentially expressed transcripts from almost all chromosomes (except chromosome 22 and Y). From some regions, however, three or more genes were differentially co-expressed suggesting a common regulatory mechanism within the locus. In the Phe408del vs. WT comparison, we identified three of such loci, notably; 17q21.2 (KRT33A, KRT33B, and KRT34), 17q25.3 (FSCN2, NPTX1, and TSPAN10), and 19p13.11–12 (C19orf44, CALR3, CHERP, EPS15L1, CIB3, and HSH2D). In the nonsense mutation vs. WT comparison, the six aforementioned genes at 19p13.11–12 were also upregulated, and from the SLC6A8 del1–13 vs. WT contrast six genes at 15q25.2 (AGSK1, GOLGA6L9, LOC440297, LOC727849, UBE2Q2P2, and UBE2Q2P3) were upregulated. When compared to WT, there was no locus with three or more differentially co-expressed genes in the cells with 40% residual creatine transport (Pro544Leu), suggesting that the common regulatory mechanism(s) at the identified loci could be linked to creatine transport. This is supported by the fact that in the Phe408del vs. Pro544Leu contrast, four such regions were identified: 19p13.11-12, at which the same six genes in the Phe408del vs. WT and the nonsense mutation vs. WT contrasts were upregulated, 17p13.1 (MYH1, MYH2, and MYH4 upregulated), 17q21.2 (KRT31, KRT33A, KRT33B, and KRT34 downregulated; also identified in the Phe408del vs. WT comparison), and Xq28 (LOC100507404, F8, and BRCC3 upregulated). To gain insight into the mechanisms involved in SLC6A8 deficiency, we performed gene ontology (GO) enrichment analysis using GOseq 21. Assigning GO terms to gene products is an initiative of the GO Consortium with the goal to develop a structured and unified way of gene annotation 24. These GO terms were used in GOseq to identify terms significantly enriched in our lists of differentially expressed genes. To distinguish the Pro544Leu missense mutation with residual activity from the Phe408del (a one amino acid deletion) mutation with no activity we performed GOseq analysis for each of the Phe408del vs. WT, Pro544Leu vs. WT, and Phe408del vs. Pro544Leu differentially expressed genes separately. After Benjamini-Hochberg’s method to correct for multiple testing 20, we identified 18 GO terms significantly enriched (FDR < 0.05) for the differentially expressed genes from the Phe408del vs. WT contrast (Figure 1A, Table 2), and two GO terms for the genes from the Phe408del vs. Pro544Leu contrast (Figure 1B, Table 3). The genes differentially expressed due to the Pro544Leu vs. WT contrast, do not contain any enriched GO terms. The differentially expressed genes from the nonsense mutation vs. WT and the SLC6A8 del1–13 vs. WT contrasts did neither contain any enriched GO terms. Intellectual disability (ID) is present in all SLC6A8 deficient patients diagnosed so far. Although more than 450 genes have been implicated in ID, it has become clear over the years that these genes converge onto common networks involving neurogenesis, neuronal differentiation/migration and a much larger group involved in defects in synapse formation, maturation and plasticity 25,26. By searching through SynaptomeDB 27, a database of synapse proteins with the differentially expressed transcripts from our dataset, we identified one gene from the Pro544Leu vs. WT, four genes from the Phe408del vs. Pro544Leu and eleven genes from the Phe408del vs. WT contrasts, that encode components of the 77 synaptome (Table 4). The SLC6A8 nonsense and del1–13 mutated transcriptomes contained respectively two (EPB41L3 and NGEF) and one (AQP1), differentially expressed synapse genes compared to WT fibroblasts. We chose to validate the expression of five genes (ADAMST7, CDH10, COL4A5, COL5A3, and COL15A1) that were found differentially expressed in the Phe408del vs. WT contrast, with quantitative reverse transcription PCR (qPCR). Our aim was to assess whether we could get similar fold changes with this alternative technique, and used Roche’s Universal ProbeLibrary System Technology. The same RNA samples from all three patients with the Phe408del mutation and all three WT were used, and were assayed in triplicate for each of the five genes. In Figure 2 the average (log2 transformed) fold changes are given for both methods, and showed that they were in accordance with each other. Also a significant Pearson correlation coefficient of 0.97 (p-value = 0.0063) was found between the two methods (Figure 2). Discussion In this study we have shown the effects on the transcriptome of SLC6A8 deficiency in fibroblast cell lines derived from patients. To our knowledge this is the first transcriptomic study on human cerebral creatine deficiency syndromes. We used RNA-seq analysis in our study, which has several advantages above alternative methods, such as the large dynamic range, low or no background signals, and high levels of reproducibility 12. Furthermore, we chose to investigate different types of SLC6A8 mutations because they have different effects on the gene product and function. We investigated a mutation with a milder effect on the protein (Pro544Leu; 40% residual transporter activity), with a more severe effect (Phe408del; 0% residual activity), a nonsense mutation, and a large genomic deletion (del1–13) both resulting in the absence of SLC6A8 accumulation. Although the expression of some genes is affected by almost all SLC6A8 mutations (such as FTCD and ITIH5), it becomes clear that each mutation affects the transcriptome in a unique way. To account for biological variability, we used three biological replicates for both the Pro544Leu and Phe408del mutations, as well as for the WT control. We did this by using fibroblasts from three unrelated individuals for each mutation or control group. The results therefore derived from the contrasts with these groups elucidate reliably what general effect each mutation has, on a transcriptional level. We also included mutations of which no biological replication was available (i.e., the SLC6A8 nonsense and the del1–13 mutations). Many published RNA-seq studies do not contain any biological replication in their experiments, which is not ideal, however can still be informative. Furthermore we validated the expression of some genes with an alternative method; qPCR. Our study showed a high and significant correlation between both methods. The GO enrichment analysis revealed cellular processes and components which are possibly impaired in SLC6A8 deficiency. The extracellular matrix was the most affected cellular component, as well as cellular processes such as cell structure, junction assembly, and cell adhesion. Transcripts encoding components of collagen (COL4A5, COL5A3, COL15A1), a fundamental part of the extracellular matrix 28, are all upregulated compared to WT. Furthermore, transcripts encoding keratin (KRT8, KRT31, KRT33A, KRT33B, KRT34) and cadherins (CDH2, CDH10, CDH13, CDH18, PCDH7, DCHS1) are differentially expressed. Keratin is an important constituent of the cytoskeleton and is involved in the binding of cells 78 to the extracellular matrix 29, whereas cadherins also play a role in cell-matrix and cell-cell adhesion 30. Many more transcripts associated with the extracellular matrix or cell structure are differentially expressed such as integrins (ITGA4, ITGA8), myosins (MYH1, MYH2, MYH4), and many more (see Table 1–2). Moreover, the expression of transcripts associated with growth factors is affected by SLC6A8 deficiency, such as EPS15L1, GDF6, IGFBP2, and IGFBP7. This suggests again involvement of the extracellular matrix, since the matrix is responsible for growth factor binding, activation, distribution, and presentation to cells 31. The extracellular matrix is of high importance in proper development and functioning of neurons 32–34, and many components originally discovered in non-neuronal tissue are also present in neurons 32. Especially structural support of neurons, elongation, migration, and conduction of communication signals are critical properties provided by the extracellular matrix. Dysfunctional extracellular matrix molecules have been linked to different neurodegenerative disorders 35, learning 36, and epilepsy 37. Our results, from skin fibroblasts, showed many genes associated with the brain or with neurons (almost 20% of all the significantly differentially expressed genes). It is therefore likely that the extracellular matrix would also be altered in SLC6A8 deficient neurons, however further research is needed to confirm this. This could be established, for instance, with SLC6A8 deficient neuron cell cultures for example derived from induced pluripotent stem cells 38,39, in creatine transporter deficient mouse models 40, or with post mortem patient material. Restoration of the extracellular matrix could become a novel therapeutic target for cerebral creatine deficiency syndromes. In conclusion we present genome-wide expression data of SLC6A8 deficiency in human fibroblasts. We identified significantly differentially expressed genes due to this disorder, of which many are involved in cell structure and the extracellular matrix. Our results suggest an important role of creatine in extracellular matrix maintenance. This lays a fundament for understanding the biological role of creatine in cells, on which further neurological research for can be build. Acknowledgment We would like to thank Cees Oudejans, Marie van Dijk, Hari Thulluru, and Omar Michel (Clinical Chemistry, VUmc Amsterdam) for the help with the RNA sequencing experiment. Furthermore we thank Wessel van Wieringen (Epidemiology and Biostatistics, VUmc Amsterdam) for advice on the statistical analyses. Potential Conflicts of Interest Nothing to report. 79 References 1. Stöckler-Ipsiroglu, S, Mercimek-Mahmutoglu, S, Salomons, GS. Creatine Deficiency Syndromes. In: Fernandes, J, Saudubray, JM, van den Berghe G, editors. Inborn Metabolic Diseases. Diagnosis and Treatment. Springer; 2012 p. 239–247. 2. Stöckler S, Schutz P, Salomons G. Cerebral Creatine Deficiency Syndromes: Clinical Aspects, Treatment and Pathophysiology [Internet]. In: Salomons GS, Wyss M, editors. Creatine and Creatine Kinase in Health and Disease. Springer Netherlands; 2008 p. 149–166.Available from: http://dx.doi.org/10.1007/978-1-4020-6486-9_8 3. Stöckler, S, Isbrandt, D, Hanefeld, F, et al. Guanidinoacetate methyltransferase deficiency: the first inborn error of creatine metabolism in man. Am. J. Hum. Genet. 1996;58(5):914–922. 4. Item CB, Stöckler-Ipsiroglu S, Stromberger C, et al. Arginine:Glycine Amidinotransferase Deficiency: The Third Inborn Error of Creatine Metabolism in Humans. Am. J. Hum. Genet. 2001;69(5):1127– 1133. 5. Salomons GS, van Dooren SJM, Verhoeven NM, et al. X-Linked Creatine-Transporter Gene (SLC6A8) Defect: A New Creatine-Deficiency Syndrome. Am. J. Hum. Genet. 2001;68(6):1497–1500. 6. Stöckler S, Hanefeld F, Frahm J. Creatine replacement therapy in guanidineoacetate methyltransferase deficiency, a novel inborn error of metabolism. The Lancet 1996;348(9030):789–790. 7. deGrauw TJ, Salomons GS, Cecil KM, et al. Congenital Creatine Transporter Deficiency. Neuropediatrics 2002;33(05):232–238. 8. Kurosawa Y, DeGrauw TJ, Lindquist DM, et al. Cyclocreatine treatment improves cognition in mice with creatine transporter deficiency. J. Clin. Invest. 2012;122(8):2837–2846. 9. Trotier-Faurion A, Dézard S, Taran F, et al. Synthesis and Biological Evaluation of New Creatine Fatty Esters Revealed Dodecyl Creatine Ester as a Promising Drug Candidate for the Treatment of the Creatine Transporter Deficiency. J. Med. Chem. 2013;56(12):5173–5181. 10. Van de Kamp JM, Betsalel OT, Mercimek-Mahmutoglu S, et al. Phenotype and genotype in 101 males with X-linked creatine transporter deficiency. J. Med. Genet. 2013;50(7):463–472. 11. Morozova O, Marra MA. Applications of next-generation sequencing technologies in functional genomics. Genomics 2008;92(5):255–264. 12. Wang Z, Gerstein M, Snyder M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet 2009;10(1):57–63. 80 13. Voineagu I, Wang X, Johnston P, et al. Transcriptomic analysis of autistic brain reveals convergent molecular pathology. Nature 2011;474(7351):380–384. 14. Xu J, Sun J, Chen J, et al. RNA-Seq analysis implicates dysregulation of the immune system in schizophrenia. BMC Genomics 2012;13(Suppl 8):S2. 15. Betsalel OT, Pop A, Rosenberg EH, et al. Detection of variants in SLC6A8 and functional analysis of unclassified missense variants. Mol. Genet. Metab. 2012;105(4):596–601. 16. Trapnell C, Pachter L, Salzberg SL. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics 2009;25(9):1105–1111. 17. Langmead B, Trapnell C, Pop M, Salzberg S. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009;10(3):R25. 18. Li H, Handsaker B, Wysoker A, et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009;25(16):2078–2079. 19. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010;26(1):139–140. 20. Benjamini Y, Hochberg Y. Controlling the False Discovery Rate - a Practical and Powerful Approach to Multiple Testing. J Roy Stat Soc B Met J Roy Stat Soc B Met 1995;57(1):289–300. 21. Young M, Wakefield M, Smyth G, Oshlack A. Gene ontology analysis for RNA-seq: accounting for selection bias. Genome Biol. 2010;11(2):R14. 22. Muller PY, Janovjak H, Miserez AR, Dobbie Z. Processing of gene expression data generated by quantitative real-time RT-PCR. Biotech. Biotech. 2002;32(6):1372–1379. 23. Nota B, van Straalen NM, Ylstra B, Roelofs D. Gene expression microarray analysis of heat stress in the soil invertebrate Folsomia candida. Insect Mol Biol 2010;19(3):315–322. 24. Ashburner M, Ball CA, Blake JA, et al. Gene Ontology: tool for the unification of biology. Nat Genet 2000;25(1):25–29. 25. Vaillend C, Poirier R, Laroche S. Genes, plasticity and mental retardation. Biobehav. Plast. 2008;192(1):88–105. 26. Van Bokhoven H. Genetic and Epigenetic Networks in Intellectual Disabilities. Annu. Rev. Genet. 2011;45(1):81–104.[cited 2014 Jan 23 ] 27. Pirooznia M, Wang T, Avramopoulos D, et al. SynaptomeDB: an ontology-based knowledgebase for synaptic genes. Bioinformatics 2012;28(6):897–899. 81 28. Gelse K, Pöschl E, Aigner T. Collagens—structure, function, and biosynthesis. Collagen Drug Deliv. Tissue Eng. 2003;55(12):1531–1546. 29. Pan X, Hobbs RP, Coulombe PA. The expanding significance of keratin intermediate filaments in normal and diseased epithelia. Cell Archit. 2013;25(1):47–56. 30. Angst BD, Marcozzi C, Magee AI. The cadherin superfamily: diversity in form and function. J. Cell Sci. 2001;114(4):629–641. 31. Hynes RO. The Extracellular Matrix: Not Just Pretty Fibrils. Science 2009;326(5957):1216–1219. 32. Letourneau P, Condic M, Snow D. Interactions of developing neurons with the extracellular matrix. J. Neurosci. 1994;14(3):915–928. 33. Franco SJ, Müller U. Extracellular matrix functions during neuronal migration and lamination in the mammalian central nervous system. Dev. Neurobiol. 2011;71(11):889–900. 25. Barros CS, Franco SJ, Müller U. Extracellular Matrix: Functions in the Nervous System. Cold Spring Harb. Perspect. Biol. 2011;3(1) 35. Bonneh-Barkay D, Wiley CA. Brain Extracellular Matrix in Neurodegeneration. Brain Pathol. 2009;19(4):573–585. 36. Dityatev A, Schachner M, Sonderegger P. The dual role of the extracellular matrix in synaptic plasticity and homeostasis. Nat Rev Neurosci 2010;11(11):735–746. 37. Dityatev A, Fellin T. Extracellular matrix in plasticity and epileptogenesis. Neuron Glia Biol. 2008;4(Special Issue 03):235–247. 38. Takahashi K, Tanabe K, Ohnuki M, et al. Induction of Pluripotent Stem Cells from Adult Human Fibroblasts by Defined Factors. Cell 2007;131(5):861–872. 39. Yu J, Vodyanik MA, Smuga-Otto K, et al. Induced Pluripotent Stem Cell Lines Derived from Human Somatic Cells. Science 2007;318(5858):1917–1920. 40. Skelton MR, Schaefer TL, Graham DL, et al. Creatine Transporter (CrT; Slc6a8) Knockout Mice as a Model of Human CrT Deficiency. PLoS ONE 2011;6(1):e16187. 82 Tables Table 1. Number of differentially expressed transcripts with FDR < 0.05 in edgeR analysis. Total number of transcripts in analysis is 39,680 (and after filtering in edgeR 24,158). Contrasta Transcripts with FDR < Upregulated transcripts c Downregulated 0.05b transcriptsc Pro544Leu (n = 3) vs. WT (n = 3) 29 (20) 23 (16) 6 (4) Phe408del (n = 3) vs. WT (n = 3) 120 (69) 69 (44) 51 (25) Phe408del (n = 3) vs. Pro544Leu (n = 3) 60 (42) 36 (25) 24 (17) Nonsense (n = 1) vs. WT (n = 3) 44 (27) 25 (16) 19 (11) SLC6A8 del1-13 (n = 1) vs. WT (n = 3) 34 (20) 22 (14) 12 (6) aComparison between two groups. bNumber of differentially expressed transcripts, transcribed from number of genes given between parentheses. cUp- or downregulated in first group of contrast compared to second group. Table 2. Significantly enriched GO terms (Benjamini-Hochberg adjusted p-value < 0.05) in Phe408del vs. WT. Total genes in analysis: 23,347. Total genes significant with edgeR: 69. GO ID P-value Adjusted P Description Total1 Sig2 Gene symbol GO:0005576 1.35 × 10-7 0.002232 extracellular region 2046 21 GO:0030246 4.89 × 10-7 0.002731 carbohydrate binding 402 10 GO:0005201 4.97 × 10-7 0.002731 78 6 GO:0005198 1.40 × 10-6 0.005778 599 11 GO:0007155 3.65 × 10-6 0.010252 extracellular matrix structural constituent structural molecule activity cell adhesion 925 14 GO:0022610 3.73 × 10-6 0.010252 biological adhesion 927 14 GO:0016337 7.70 × 10-6 0.018132 cell-cell adhesion 378 9 GO:0031012 1.05 × 10-5 0.022699 extracellular matrix 416 9 GO:0034332 1.37 × 10-5 0.022699 40 4 GO:0044421 1.38 × 10-5 0.022699 adherens junction organization extracellular region part ABI3BP; ADA; ADAMTS7; CDH13; CHI3L1; COL15A1; COL4A5; COL5A3; EMCN; F2R; IGFBP2; ITIH5; LOXL3; LYNX1; MGP; NPTX2; OLFM2; OLFML2B; RSPO4; SERPINB2; SFRP1 ABI3BP; CALR3; CHI3L1; COL5A3; GALNT5; GFPT2; LPHN2; NPTX2; RSPO4; SFRP1 CD4; CHI3L1; COL15A1; COL4A5; COL5A3; MGP CD4; CHI3L1; COL15A1; COL4A5; COL5A3; KRT33A; KRT33B; KRT34; KRT8; MGP; RPL9 ABI3BP; ADA; CD4; CDH10; CDH13; CDH18; CDH2; COL15A1; COL5A3; ITGA8; MGP; PCDH7; SFRP1; SOX9 ABI3BP; ADA; CD4; CDH10; CDH13; CDH18; CDH2; COL15A1; COL5A3; ITGA8; MGP; PCDH7; SFRP1; SOX9 ADA; CDH10; CDH13; CDH18; CDH2; ITGA8; MGP; PCDH7; SOX9 ABI3BP; ADAMTS7; CHI3L1; COL15A1; COL4A5; COL5A3; MGP; OLFML2B; SFRP1 CDH10; CDH13; CDH18; CDH2 1066 13 GO:0009888 1.84 × 10-5 0.027616 tissue development 1152 14 GO:0045987 2.35 × 10-5 0.032313 18 3 GO:0005578 3.04 × 10-5 0.036559 352 8 GO:0034329 3.10 × 10-5 0.036559 positive regulation of smooth muscle contraction proteinaceous extracellular matrix cell junction assembly 166 6 ABI3BP; ADAMTS7; CHI3L1; COL15A1; COL4A5; COL5A3; MGP; SFRP1 CDH10; CDH13; CDH18; CDH2; GJC1; SFRP1 GO:0032501 10-5 0.036559 multicellular 5277 33 ADA; ATF5; BDKRB2; CALR3; CAMK2A; CD4; 3.14 × ABI3BP; ADA; ADAMTS7; CDH13; CHI3L1; COL15A1; COL4A5; COL5A3; IGFBP2; LOXL3; MGP; SERPINB2; SFRP1 CHI3L1; COL5A3; F2R; GJC1; HAND2; ITGA8; KRT34; LOXL3; MAMSTR; MEOX2; MGP; NR4A3; SFRP1; SOX9 ADA; F2R; PTGS1 83 organismal process GO:0003008 3.99 × 10-5 0.041131 system process 1587 16 GO:0009653 5.00 × 10-5 0.048503 anatomical structure morphogenesis 1901 18 GO:0050850 5.30 × 10-5 0.04852 CDH13; CDH2; CHERP; CHI3L1; COL15A1; COL4A5; COL5A3; F2R; FSCN2; FXYD1; GJC1; HAND2; ITGA8; KRT34; LOXL3; MAMSTR; MEOX2; MGP; NFATC2; NPTX1; NPTX2; NR4A3; PTGS1; SERPINB2; SFRP1; SGK1; SOX9 ADA; BDKRB2; CAMK2A; CDH2; F2R; FSCN2; FXYD1; GJC1; ITGA8; MEOX2; NPTX1; NPTX2; NR4A3; PTGS1; SGK1; SOX9 ADA; CDH13; CDH2; CHI3L1; COL15A1; COL4A5; F2R; FSCN2; GJC1; HAND2; ITGA8; LOXL3; MEOX2; MGP; NPTX1; NR4A3; SFRP1; SOX9 ADA; CD4; CDH13 positive regulation of 24 3 calcium-mediated signaling 1In total 17,414 genes of 23,347 could be assigned to one or more GO term. 267 of the 69 significant genes could be assigned to one or more GO terms. Table 3. Significantly enriched GO terms (Benjamini-Hochberg adjusted p-value < 0.05) in Phe408del vs. Pro544Leu. Total genes in analysis: 23,347. Total genes significant with edgeR: 42. GO ID GO:0005198 P-value 9.59 × 10-7 Adjusted P Description Total1 Sig2 Gene symbol 0.015817 structural molecule 599 9 CD4; COL4A5; KRT31; KRT33A; KRT33B; activity KRT34; MYH2; MYH4; RPL9 GO:0005859 5.90 × 10-6 0.048637 muscle myosin 18 3 MYH1; MYH2; MYH4 complex 1In total 17,414 genes of 23,347 could be assigned to one or more GO term. 239 of the 42 significant genes could be assigned to one or more GO terms. Table 4. Differentially expressed synapse-associated genes Contrast Pro544Leu vs. WT Differentially expressed SynaptomeDB1 ATP2A1 Phe408del vs. WT CAMK2A transcript found in Description ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 calcium/calmodulin-dependent protein kinase II alpha cadherin 2, type 1, N-cadherin (neuronal) CDH2 collagen, type V, alpha 3 COL5A3 PLEKHA6 pleckstrin homology domain containing, family A member 6 ribosomal protein L9 RPL9 cadherin 10, type 2 (T2-cadherin) CDH10 Ly6/neurotoxin 1 LYNX1 cadherin 13, H-cadherin (heart) CDH13 neuronal pentraxin I 84 NPTX1 Neuronal Olfactomedin Related ER Localized Protein 2 OLFM2 epidermal growth factor receptor pathway substrate 15like 1 Phe408del Pro544Leu vs. EPS15L1 RPL9 ribosomal protein L9 HAPLN1 hyaluronan and proteoglycan link protein 1 tuberous sclerosis 1 TSC1 cadherin 2, type 1, N-cadherin (neuronal) CDH2 1An integrated database to retrieve, compile, and annotate genes comprising the synaptome. These genes encode components of the synapse including neurotransmitters and their receptors, adhesion/cytoskeletal proteins, scaffold proteins, transporters, and others 27. 85 Figures Figure 1. Significantly enriched GO terms in SLC6A8 deficiency. With GOseq analysis (A) 18 GO terms were identified as significantly enriched (Benjamini-Hochberg adjusted p-value < 0.05) for Phe408del vs. WT, and (B) 2 GO terms for Phe408del vs. Pro544Leu. The GO term description is given with the –log10(adjusted P-value). Between parentheses; first the number of genes assigned to the GO term that were significantly differentially expressed in the Phe408del vs. WT or Phe408del vs. Pro544Leu contrast is given, and then the total number of genes assigned to the GO term. Note –log10(0.05) = 1.30. 86 Figure 2. Comparison between gene expression values derived from RNA-seq and qPCR. (A)The expression of five genes was assessed with qPCR and the log2 transformed fold changes (ratio Phe408del/WT) are given next the RNA-seq derived values. (B) A significant Pearson correlation coefficient of 0.97 (p-value = 0.0063) was found between the log2 fold change values derived with both methods. 87 Supplementary Table S1. Summary of clinical features of Pro544Leu and Phe408del mutations as a cause of SLC6A8 deficiency. Number of Phe408del Pro544Leu 7 5 Intellectual disabilityb (1) Degree unspecified (1) Mild (4) Severe (1) Degree unspecified (1) Mild (3) Moderate Speech delayb (3) No speech (at 4-9.5 years) (3) Single words (at 1-3.8 years) (1) Sentences (at 20 years) (1) No speech (at 2.4 years) (1) Single words (at 5 years) (3) Sentences (at 12.7-15.9 years) Behavior abnormalities All All Seizuresb (4) No (3) Yes (4) No (1) Severe aNumber patientsa of patients known from literature. bNumber of patients between parentheses. Supplementary Table S2. Primers and probes of the quantitative reverse transcription PCR assays. Gene COL15A1 (NM_001855) ADAMTS7 (NM_014272) COL5A3 (NM_015719) CDH10 (NM_006727) COL4A5 (NM_000495) GAPDH (NM_002046) Forward ttccagcaacccacatca Reverse gttcagagcagccaaatgc Probe #16 Amplicon length 91 nt tcctctatgatgtaagccaccag caccagagtgtgtggcaga #8 94 nt gcagaatatccatctcggactc tcaaaacctcttgaccgtga agagcccacggtcaagact agccacatcgctcagacac ggctctccttttgctccttt cgtgttgtctctttgggattg catgaaaggcatggtactaaagc gcccaatacgaccaaatcc #67 #59 #8 #60 71 nt 86 nt 69 nt 66 nt Supplementary Table S3. Number of RNA-seq derived (and mapped) reads. Sample WT rep. 1 WT rep. 2 WT rep. 3 Pro544Leu rep. 1 Pro544Leu rep. 2 Pro544Leu rep. 3 Phe408del rep. 1 Phe408del rep. 2 Phe408del rep. 3 Nonsense rep. 1 Del1–13 rep. 1 Total Total # reads 215,415,784 272,175,472 165,117,286 197,528,518 260,597,912 232,520,430 271,099,194 265,099,500 219,378,006 234,958,444 170,502,478 2,504,393,024 Left reads (Phred33) 107,706,399 136,082,833 82,557,586 98,762,776 130,294,166 116,258,703 135,544,827 132,545,331 109,685,167 117,477,243 85,247,953 1,252,162,984 Right reads (Phred33) 107,686,785 134,912,461 82,543,375 98,746,029 129,154,810 116,237,905 134,338,838 131,318,806 108,720,810 117,456,623 84,539,002 1,245,655,444 Mapped reads left Mapped reads right 64,583,251 (59.96%) 81,578,128 (59.95%) 49,690,717 (60.19%) 57,716,577 (58.44%) 80,296,557 (61.63%) 69,313,165 (59.62%) 81,830,640 (60.37%) 76,919,746 (58.03%) 64,508,081 (58.81%) 71,606,626 (60.95%) 52,071,558 (61.08%) 750,115,046 (59.91%) 62,857,190 (58.37%) 77,234,037 (57.25%) 49,132,468 (59.52%) 57,159,720 (57.89%) 75,916,620 (58.78%) 68,219,732 (58.69%) 77,380,364 (57.60%) 72,382,448 (55.12%) 59,815,904 (55.02%) 70,631,271 (60.13%) 49,082,396 (58.06%) 719,812,150 (57.79%) 88 Supplementary Table S4. Differentially expressed transcripts with FDR < 0.05 in edgeR analysis for Pro544Leu vs. WT contrast. A total of 29 transcripts derived from 20 genes were significantly differential. Gene / transcript name Location Description logFC PValue FDR COL15A1 NM_001855 9q22.33 collagen, type XV, alpha 1 3.725255 4.18E-13 1.01E-08 SLC26A3 NM_000111 7q31.1 solute carrier family 26, member 3 -10.1468 9.06E-12 1.09E-07 ERAP2 NM_001130140 5q15 -4.08825 3.21E-08 0.000214 ERAP2 NM_022350 5q15 -4.08278 3.54E-08 0.000214 FTCD NM_006657 21q22.3 7.491242 1.35E-07 0.000651 FTCD NM_206965 21q22.3 7.413364 2.22E-07 0.000895 F8 NM_000132 Xq28 -2.84042 8.87E-07 0.003063 GOLGA8B NR_027410 15q14 endoplasmic reticulum aminopeptidase 2 endoplasmic reticulum aminopeptidase 2 formiminotransferase cyclodeaminase formiminotransferase cyclodeaminase coagulation factor VIII, procoagulant component golgin A8 family, member B 2.198931 1.05E-06 0.003158 GOLGA8A NR_027409 15q14 golgin A8 family, member A 2.041493 1.85E-06 0.004972 GOLGA8B NM_001023567 15q14 golgin A8 family, member B 2.176148 2.15E-06 0.005197 SLC6A7a 5q32 9.840472 2.79E-06 0.005926 NM_014228 GOLGA8A NM_181077 15q14 solute carrier family 6 (neurotransmitter transporter, Lproline), member 7 golgin A8 family, member A 1.978223 3.04E-06 0.005926 LOC653075 NR_033933 15q13.2 golgin A8 family, member T 2.165785 3.24E-06 0.005926 ITIH5 NM_030569 10p14 2.739546 3.44E-06 0.005926 ITIH5 NM_032817 10p14 2.748934 3.68E-06 0.005926 SAMD14 NM_174920 17q21.33 2.840417 4.83E-06 0.007286 ITIH5 NM_001001851 10p14 2.706861 6.37E-06 0.008845 DCHS1 NM_003737 11p15.4 inter-alpha-trypsin inhibitor heavy chain family, member 5 inter-alpha-trypsin inhibitor heavy chain family, member 5 sterile alpha motif domain containing 14 inter-alpha-trypsin inhibitor heavy chain family, member 5 dachsous 1 (Drosophila) 2.302375 6.59E-06 0.008845 MALAT1 NR_002819 11q13.1 2.730747 1.32E-05 0.016778 SNORD36C NR_000016 9q34.2 metastasis associated lung adenocarcinoma transcript 1 (nonprotein coding) small nucleolar RNA, C/D box 36C 3.496889 1.91E-05 0.023082 LOC100507404 NR_039991 Xq28 TMLHE antisense RNA 1 -3.40604 2.06E-05 0.023726 SLC26A4 NM_000441 7q22.3 solute carrier family 26, member 4 -3.84293 2.21E-05 0.024216 LOXL4 NM_032211 10q24.2 lysyl oxidase-like 4 2.32251 2.83E-05 0.029697 HLA-DPA1 NM_033554_7 6p21.32 3.212388 4.26E-05 0.042927 2.947903 4.64E-05 0.044798 2.040369 5.50E-05 0.047526 2.932111 5.51E-05 0.047526 2.039148 5.51E-05 0.047526 2.091354 5.98E-05 0.049799 major histocompatibility complex, class II, DP alpha 1 HLA-DPA1 NM_001242524_1 6p21.32 major histocompatibility complex, class II, DP alpha 1 ATP2A1 NM_004320 16p11.2 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 HLA-DPA1 NM_001242525_3 6p21.32 major histocompatibility complex, class II, DP alpha 1 ATP2A1 NM_173201 16p11.2 ATPase, Ca++ transporting, cardiac muscle, fast twitch 1 CHRFAM7A a NM_139320 15q13.2 CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion aGene is associated with brain and/or neurons according to Entrez Gene or UniProtKB/Swiss-Prot. 89 Supplementary Table S5. Differentially expressed transcripts with FDR < 0.05 in edgeR analysis for Phe408del vs. WT contrast. A total of 120 transcripts derived from 69 genes were significantly differential. Gene / transcript name Location Description logFC PValue FDR HSH2D NM_032855 19p13.12 8.026207 7.43E-15 1.79E-10 CALR3 NM_145046 19p13.11 hematopoietic SH2 domain containing calreticulin 3 10.19589 1.91E-13 2.31E-09 CIB3 NM_054113 19p13.12 11.21249 1.54E-10 1.24E-06 FSCN2 NM_001077182 17q25.3 6.59186 3.30E-10 1.63E-06 FSCN2 NM_012418 17q25.3 6.602358 3.38E-10 1.63E-06 COL15A1 NM_001855 9q22.33 3.056435 8.79E-10 3.54E-06 VAT1La 16q23.1 -6.92099 1.12E-09 3.86E-06 -5.61606 2.07E-09 6.25E-06 NM_020927 calcium and integrin binding family member 3 fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus) fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus) collagen, type XV, alpha 1 EMCN NM_016242 4q24 vesicle amine transport protein 1 homolog (T. californica)-like endomucin EMCN NM_001159694 4q24 endomucin -5.54346 3.91E-09 1.05E-05 C19orf44 NM_032207 19p13.11 3.117484 1.58E-08 3.81E-05 NPTX1a NM_002522 17q25.3 chromosome 19 open reading frame 44 neuronal pentraxin I 5.052242 1.03E-07 0.000227 EPS15L1 NM_021235 19p13.11 2.423863 1.17E-07 0.000235 ITIH5 NM_030569 10p14 3.168574 1.35E-07 0.00025 ITIH5 NM_032817 10p14 3.172126 1.56E-07 0.000269 FTCD NM_006657 21q22.3 7.378567 1.81E-07 0.000291 FTCD NM_206965 21q22.3 7.300812 2.96E-07 0.000427 ITIH5 NM_001001851 10p14 3.12753 3.01E-07 0.000427 GFPT2 NM_005110 5q35.3 -2.20405 4.71E-07 0.000629 SLC6A7a NM_014228 5q32 10.95675 4.95E-07 0.000629 PLEKHA6 NM_014935 1q32.1 -5.4659 6.12E-07 0.000739 CHERP NM_006387 19p13.11 2.107395 9.72E-07 0.001118 LYNX1a NM_177477 8q24.3 epidermal growth factor receptor pathway substrate 15-like 1 inter-alpha-trypsin inhibitor heavy chain family, member 5 inter-alpha-trypsin inhibitor heavy chain family, member 5 formiminotransferase cyclodeaminase formiminotransferase cyclodeaminase inter-alpha-trypsin inhibitor heavy chain family, member 5 glutamine-fructose-6-phosphate transaminase 2 solute carrier family 6 (neurotransmitter transporter, Lproline), member 7 pleckstrin homology domain containing, family A member 6 calcium homeostasis endoplasmic reticulum protein Ly6/neurotoxin 1 1.833915 1.42E-06 0.001525 LYNX1a NM_177476 8q24.3 Ly6/neurotoxin 1 1.833122 1.45E-06 0.001525 LYNX1a NM_177457 8q24.3 Ly6/neurotoxin 1 1.827548 1.65E-06 0.001663 CAMK2A a NM_015981 5q32 5.493911 1.88E-06 0.001814 CAMK2A a NM_171825 5q32 5.44658 2.21E-06 0.002056 MAMSTR NM_001130915 19q13.33 4.163036 2.61E-06 0.002335 GPR133 NM_198827 12q24.33 calcium/calmodulin-dependent protein kinase II alpha calcium/calmodulin-dependent protein kinase II alpha MEF2 activating motif and SAP domain containing transcriptional regulator G protein-coupled receptor 133 -3.04486 2.96E-06 0.002488 ITGA8a NM_003638 10p13 integrin, alpha 8 3.139641 2.99E-06 0.002488 NR4A3a NM_173200 9q22.33 -2.59196 5.37E-06 0.004325 NR4A3a NM_006981 9q22.33 nuclear receptor subfamily 4, group A, member 3 nuclear receptor subfamily 4, group A, member 3 -2.60029 6.01E-06 0.004685 90 PTGS1 NM_000962 9q33.2 2.668366 6.46E-06 0.004751 2.66779 6.49E-06 0.004751 3.828101 7.26E-06 0.005156 1q32.2 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) MEF2 activating motif and SAP domain containing transcriptional regulator synaptotagmin XIV PTGS1 NM_080591 9q33.2 MAMSTR NM_182574 19q13.33 SYT14a NM_001256006 -4.6129 8.40E-06 0.005796 RSPO4 NM_001029871 20p13 R-spondin 4 5.80926 9.46E-06 0.006098 OLFM2a NM_058164 19p13.2 olfactomedin 2 2.736299 9.52E-06 0.006098 SYT14a NM_001146264 1q32.2 synaptotagmin XIV -4.57899 9.59E-06 0.006098 RSPO4 NM_001040007 20p13 R-spondin 4 5.786784 1.03E-05 0.00614 SYT14a NM_153262 1q32.2 synaptotagmin XIV -4.5614 1.03E-05 0.00614 IGFBP2 NM_000597 2q35 3.950754 1.04E-05 0.00614 SYT14a NM_001146261 1q32.2 insulin-like growth factor binding protein 2, 36kDa synaptotagmin XIV -4.52322 1.13E-05 0.00649 CD4a NM_001195014 12p13.31 CD4 molecule 5.139769 1.19E-05 0.00656 SYT14a NM_001146262 1q32.2 synaptotagmin XIV -4.50598 1.22E-05 0.00656 CD4a NM_001195016 12p13.31 CD4 molecule 5.143751 1.26E-05 0.00656 CD4a NM_001195015 12p13.31 CD4 molecule 5.143824 1.26E-05 0.00656 CD4a NM_001195017 12p13.31 CD4 molecule 5.139715 1.28E-05 0.00656 MEIS2a NM_170674 15q14 Meis homeobox 2 -1.4652 1.42E-05 0.007031 MEIS2a NM_170677 15q14 Meis homeobox 2 -1.46453 1.43E-05 0.007031 MEOX2a NM_005924 7p21.2 mesenchyme homeobox 2 5.444285 1.49E-05 0.007193 ADAMTS7 NM_014272 15q25.1 2.62909 1.56E-05 0.007388 CD4a NM_000616 12p13.31 ADAM metallopeptidase with thrombospondin type 1 motif, 7 CD4 molecule 5.093365 1.59E-05 0.007388 MEIS2a NM_170675 15q14 Meis homeobox 2 -1.46041 1.71E-05 0.007653 MEIS2a NM_170676 15q14 Meis homeobox 2 -1.4611 1.71E-05 0.007653 CDH2a NM_001792 18q12.1 -2.81553 1.80E-05 0.007927 MEIS2a NM_172315 15q14 cadherin 2, type 1, N-cadherin (neuronal) Meis homeobox 2 -1.45909 1.88E-05 0.008046 MEIS2a NM_172316 15q14 Meis homeobox 2 -1.45825 1.90E-05 0.008046 MEIS2a NM_002399 15q14 Meis homeobox 2 -1.45562 1.99E-05 0.008276 MEIS2a NM_001220482 15q14 Meis homeobox 2 -1.45139 2.08E-05 0.008528 ABI3BP NM_015429 3q12.2 2.316645 2.13E-05 0.00858 TSTD1 NM_001113205 1q23.3 -8.11015 2.57E-05 0.010161 SFRP1 NM_003012 8p11.21 ABI family, member 3 (NESH) binding protein thiosulfate sulfurtransferase (rhodanese)-like domain containing 1 secreted frizzled-related protein 1 -4.11451 2.74E-05 0.010681 TSTD1 NM_001113207 1q23.3 -7.96624 2.83E-05 0.010861 KRT33B NM_002279 17q21.2 thiosulfate sulfurtransferase (rhodanese)-like domain containing 1 keratin 33B 3.494378 3.48E-05 0.013149 ATF5a 19q13.33 activating transcription factor 5 -1.95509 3.65E-05 0.013577 COL5A3 NM_015719 19p13.2 collagen, type V, alpha 3 2.15156 3.95E-05 0.014457 TSTD1 NM_001113206 1q23.3 thiosulfate sulfurtransferase (rhodanese)-like domain containing 1 -7.70873 4.39E-05 0.015817 NM_001193646 91 RPL9 NM_000661 4p14 ribosomal protein L9 -2.19224 4.63E-05 0.016455 ATF5a NM_012068 19q13.33 activating transcription factor 5 -1.89412 4.72E-05 0.016518 SERPINB2 NM_002575 18q21.33 3.058806 4.80E-05 0.016581 SERPINB2 NM_001143818 18q21.33 3.0513 4.96E-05 0.016866 SGK1a NM_001143677 6q23.2 -1.66558 5.60E-05 0.018674 SGK1a NM_001143676 6q23.2 -1.66351 5.67E-05 0.018674 SGK1a NM_001143678 6q23.2 -1.66198 5.72E-05 0.018674 CHST15 NM_015892 10q26.13 3.312943 5.99E-05 0.019299 SGK1a NM_005627 6q23.2 -1.66094 6.19E-05 0.019668 ADA NM_000022 20q13.12 serpin peptidase inhibitor, clade B (ovalbumin), member 2 serpin peptidase inhibitor, clade B (ovalbumin), member 2 serum/glucocorticoid regulated kinase 1 serum/glucocorticoid regulated kinase 1 serum/glucocorticoid regulated kinase 1 carbohydrate (Nacetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 serum/glucocorticoid regulated kinase 1 adenosine deaminase 2.19904 6.32E-05 0.019818 CCDC85A NM_001080433 2p16.1 coiled-coil domain containing 85A -2.91549 6.46E-05 0.020009 NFATC2 NM_001136021 20q13.2 3.869965 6.58E-05 0.020107 HSD17B14 NM_016246 19q13.33 2.570196 6.82E-05 0.02051 NFATC2 NM_173091 20q13.2 3.899034 6.88E-05 0.02051 NFATC2 NM_012340 20q13.2 3.864943 7.05E-05 0.020784 BDKRB2 NM_000623 14q32.2 nuclear factor of activated T-cells, cytoplasmic, calcineurindependent 2 hydroxysteroid (17-beta) dehydrogenase 14 nuclear factor of activated T-cells, cytoplasmic, calcineurindependent 2 nuclear factor of activated T-cells, cytoplasmic, calcineurindependent 2 bradykinin receptor B2 -2.60885 7.89E-05 0.02291 RPL9 NM_001024921 4p14 ribosomal protein L9 -2.05859 7.97E-05 0.02291 CDH10a NM_006727 5p14.1 cadherin 10, type 2 (T2-cadherin) -5.16723 8.64E-05 0.024561 FXYD1 NM_005031 19q13.12 2.638583 8.89E-05 0.024984 HLA-DPA1 NM_001242524_1 6p21.32 2.813533 9.25E-05 0.025679 FXYD1 NM_021902 19q13.12 2.638846 0.000101 0.027683 HLA-DPA1 NM_001242525_3 6p21.32 2.802061 0.000107 0.028925 HLA-DPA1 NM_033554_7 6p21.32 3.002312 0.000113 0.030465 HAND2 NM_021973 4q34.1 -1.96448 0.000118 0.031371 KRT33A NM_004138 17q21.2 FXYD domain containing ion transport regulator 1 major histocompatibility complex, class II, DP alpha 1 FXYD domain containing ion transport regulator 1 major histocompatibility complex, class II, DP alpha 1 major histocompatibility complex, class II, DP alpha 1 heart and neural crest derivatives expressed 2 keratin 33A 3.524094 0.000124 0.032116 PCDH7a NM_032457 4p15.1 protocadherin 7 -3.82714 0.000125 0.032116 PCDH7a NM_001173523 4p15.1 protocadherin 7 -3.82798 0.000125 0.032116 TSPAN10 NM_031945 17q25.3 tetraspanin 10 3.326484 0.000157 0.040007 KRT8 NM_001256293 12q13.13 keratin 8 -3.99615 0.000162 0.040824 KRT34 NM_021013 17q21.2 keratin 34 2.951347 0.000166 0.041394 KRT8 NR_045962 12q13.13 keratin 8 -3.93027 0.00017 0.041882 PCDH7a NM_002589 4p15.1 protocadherin 7 -3.86163 0.000172 0.042002 SOX9 NM_000346 17q24.3 -2.99962 0.000185 0.044552 F2R NM_001992 5q13.3 SRY (sex determining region Y)-box 9 coagulation factor II (thrombin) receptor 2.493061 0.000189 0.044552 92 NPTX2a NM_002523 7q22.1 neuronal pentraxin II 4.463869 0.000189 0.044552 LOXL3 NM_032603 2p13.1 lysyl oxidase-like 3 1.489323 0.000192 0.044552 CDH13a NM_001220490 16q23.3 cadherin 13, H-cadherin (heart) 1.512014 0.000195 0.044552 CDH18a 5p14.3 cadherin 18, type 2 -4.16604 0.000198 0.044552 CDH13a NM_001220489 NM_004934 16q23.3 cadherin 13, H-cadherin (heart) 1.50877 0.000198 0.044552 COL4A5 NM_000495 Xq22.3 collagen, type IV, alpha 5 3.351482 0.000199 0.044552 COL4A5 NM_033380 Xq22.3 collagen, type IV, alpha 5 3.351482 0.000199 0.044552 OLFML2B NM_015441 1q23.3 olfactomedin-like 2B 1.573713 0.000201 0.04459 CHI3L1 NM_001276 1q32.1 -3.78675 0.000205 0.044994 CDH18a NM_001167667 5p14.3 chitinase 3-like 1 (cartilage glycoprotein-39) cadherin 18, type 2 -4.15824 0.000209 0.045506 CDH13a NM_001257 16q23.3 cadherin 13, H-cadherin (heart) 1.500327 0.000213 0.045926 MGP NM_001190839 12p12.3 matrix Gla protein -3.79014 0.000218 0.046606 CDH13a 16q23.3 cadherin 13, H-cadherin (heart) 1.497982 0.000225 0.047474 GALNT5 NM_014568 2q24.1 -1.24089 0.000226 0.047474 LPHN2 NM_012302 1p31.1 UDP-N-acetyl-alpha-Dgalactosamine:polypeptide Nacetylgalactosaminyltransferase 5 (GalNAc-T5) latrophilin 2 1.343875 0.000232 0.048233 GJC1 NM_001080383 17q21.31 1.435947 0.000236 0.048728 GJC1 NM_005497 17q21.31 1.434209 0.000238 0.048728 MGP NM_000900 12p12.3 gap junction protein, gamma 1, 45kDa gap junction protein, gamma 1, 45kDa matrix Gla protein -3.80473 0.000242 0.048969 PCDH7a 4p15.1 protocadherin 7 -3.75958 0.000243 0.048969 aGene NM_001220488 NM_032456 is associated with brain and/or neurons according to Entrez Gene or UniProtKB/Swiss-Prot. Supplementary Table S6. Differentially expressed transcripts with FDR < 0.05 in edgeR analysis for Phe408del vs. Pro544Leu contrast. A total of 60 transcripts derived from 42 genes were significantly differential. Gene / transcript name Location Description logFC PValue FDR CALR3 NM_145046 19p13.11 calreticulin 3 12.43883 2.65E-16 6.39E-12 HSH2D NM_032855 19p13.12 7.610412 5.88E-14 7.10E-10 CIB3 NM_054113 19p13.12 12.30106 1.93E-11 1.56E-07 SLC26A3 NM_000111 7q31.1 hematopoietic SH2 domain containing calcium and integrin binding family member 3 solute carrier family 26, member 3 9.361527 1.10E-10 6.63E-07 FSCN2 NM_012418 17q25.3 6.415986 7.46E-10 3.06E-06 FSCN2 NM_001077182 17q25.3 6.39625 7.59E-10 3.06E-06 C11orf87 NM_207645 11q22.3 fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus) fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus) chromosome 11 open reading frame 87 keratin 33B -3.39455 1.36E-08 4.68E-05 KRT33B NM_002279 17q21.2 C19orf44 NM_032207 19p13.11 KRT33A NM_004138 17q21.2 EPS15L1 NM_021235 19p13.11 CD4a NM_001195014 12p13.31 5.132913 1.88E-08 5.67E-05 chromosome 19 open reading frame 44 keratin 33A 3.041555 3.14E-08 8.42E-05 5.086512 2.74E-07 0.000662 epidermal growth factor receptor pathway substrate 15-like 1 CD4 molecule 2.302651 4.26E-07 0.000884 6.174942 5.45E-07 0.000884 93 CD4a NM_001195016 12p13.31 CD4 molecule 6.205923 5.48E-07 0.000884 CD4a NM_001195015 12p13.31 CD4 molecule 6.205995 5.48E-07 0.000884 CD4a NM_001195017 12p13.31 CD4 molecule 6.199787 5.56E-07 0.000884 CD4a 12p13.31 CD4 molecule 6.22002 5.85E-07 0.000884 KRT34 NM_021013 NM_000616 17q21.2 keratin 34 4.104666 6.75E-07 0.000959 F8 NM_000132 Xq28 2.848212 8.35E-07 0.001121 TBX2 NM_005994 17q23.2 coagulation factor VIII, procoagulant component T-box 2 4.024194 1.24E-06 0.001574 VAT1La NM_020927 16q23.1 -5.01068 1.47E-06 0.001771 GDF6 NM_001001557 8q22.1 vesicle amine transport protein 1 homolog (T. californica)-like growth differentiation factor 6 -3.50212 2.20E-06 0.002454 EMCN NM_016242 4q24 endomucin -4.14756 2.24E-06 0.002454 SAMD14 NM_174920 17q21.33 -2.9259 2.69E-06 0.002829 ADAMTS7 NM_014272 15q25.1 2.853724 3.40E-06 0.003418 EMCN NM_001159694 4q24 sterile alpha motif domain containing 14 ADAM metallopeptidase with thrombospondin type 1 motif, 7 endomucin -4.08362 3.57E-06 0.00345 CHERP NM_006387 19p13.11 1.976249 3.96E-06 0.003681 HAPLN1 NM_001884 5q14.3 -4.68349 9.16E-06 0.008196 MAMSTR NM_001130915 19q13.33 3.863409 9.71E-06 0.008381 LOC100507404 NR_039991 Xq28 calcium homeostasis endoplasmic reticulum protein hyaluronan and proteoglycan link protein 1 MEF2 activating motif and SAP domain containing transcriptional regulator TMLHE antisense RNA 1 3.461318 1.59E-05 0.013207 MAMSTR NM_182574 19q13.33 3.629046 1.77E-05 0.014233 AK8 NM_152572 9q34.13 MEF2 activating motif and SAP domain containing transcriptional regulator adenylate kinase 8 -3.70045 1.87E-05 0.014554 GFPT2 NM_005110 5q35.3 -1.83738 2.11E-05 0.015966 MYH4 NM_017533 17p13.1 -5.76038 2.36E-05 0.017295 RPL9 NM_000661 4p14 glutamine-fructose-6-phosphate transaminase 2 myosin, heavy chain 4, skeletal muscle ribosomal protein L9 -2.27753 2.46E-05 0.017356 CDH2a NM_001792 18q12.1 -2.76042 2.51E-05 0.017356 KRT31 NM_002277 17q21.2 cadherin 2, type 1, N-cadherin (neuronal) keratin 31 4.300765 3.27E-05 0.021915 MYH1 NM_005963 17p13.1 -5.46032 3.98E-05 0.024982 COL4A5 NM_000495 Xq22.3 myosin, heavy chain 1, skeletal muscle, adult collagen, type IV, alpha 5 3.772011 4.03E-05 0.024982 COL4A5 NM_033380 Xq22.3 collagen, type IV, alpha 5 3.772011 4.03E-05 0.024982 RPL9 NM_001024921 4p14 ribosomal protein L9 -2.13395 4.52E-05 0.027308 ITGA4 NM_000885 2q31.3 -1.27713 5.11E-05 0.029384 MYH2 NM_017534 17p13.1 -4.6088 5.24E-05 0.029384 MYH2 NM_001100112 17p13.1 -4.60333 5.30E-05 0.029384 LDHC NM_002301 11p15.1 integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) myosin, heavy chain 2, skeletal muscle, adult myosin, heavy chain 2, skeletal muscle, adult lactate dehydrogenase C 1.577383 5.55E-05 0.029384 LDHC NM_017448 11p15.1 lactate dehydrogenase C 1.577383 5.58E-05 0.029384 NMNAT2a NM_170706 1q25.3 3.46054 5.78E-05 0.029384 NMNAT2a NM_015039 1q25.3 3.46054 5.81E-05 0.029384 TRIM55 NM_033058 8q13.1 nicotinamide nucleotide adenylyltransferase 2 nicotinamide nucleotide adenylyltransferase 2 tripartite motif containing 55 -4.80192 5.84E-05 0.029384 94 TRIM55 NM_184085 8q13.1 tripartite motif containing 55 -4.77795 6.11E-05 0.030132 TRIM55 NM_184086 8q13.1 tripartite motif containing 55 -4.75011 6.70E-05 0.032387 TSPAN10 NM_031945 17q25.3 tetraspanin 10 3.495612 8.12E-05 0.038001 BRCC3 NM_024332 Xq28 1.786308 8.18E-05 0.038001 ADA NM_000022 20q13.12 BRCA1/BRCA2-containing complex, subunit 3 adenosine deaminase 2.159596 8.34E-05 0.038001 TSC1 NM_001162426 9q34.13 tuberous sclerosis 1 -2.16923 8.80E-05 0.038657 TSC1 NM_000368 9q34.13 tuberous sclerosis 1 -2.16904 8.80E-05 0.038657 TSC1 NM_001162427 9q34.13 tuberous sclerosis 1 -2.14949 9.47E-05 0.040467 SRD5A2 NM_000348 2p23.1 -6.29054 9.55E-05 0.040467 ITGA8a NM_003638 10p13 steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alphasteroid delta 4-dehydrogenase alpha 2) integrin, alpha 8 2.539064 0.000107 0.044441 BRCC3 NM_001018055 Xq28 1.742028 0.00012 0.048532 1.742028 0.000121 0.048532 BRCA1/BRCA2-containing complex, subunit 3 BRCC3 NM_001242640 Xq28 BRCA1/BRCA2-containing complex, subunit 3 aGene is associated with brain and/or neurons according to Entrez Gene or UniProtKB/Swiss-Prot. Supplementary Table S7. Differentially expressed transcripts with FDR < 0.05 in edgeR analysis for nonsense mutation vs. WT contrast. A total of 44 transcripts derived from 27 genes were significantly differential. Gene / transcript name Location Description logFC PValue FDR PPP1R12B NM_032104 1q32.1 4.72081 1.92E-20 4.64E-16 PPP1R12B NM_032103 1q32.1 4.614609 1.52E-19 1.83E-15 PPP1R12B NM_002481 1q32.1 4.436191 2.62E-19 2.11E-15 HSH2D NM_032855 19p13.12 8.604616 1.14E-14 6.91E-11 CALR3 NM_145046 19p13.11 protein phosphatase 1, regulatory subunit 12B protein phosphatase 1, regulatory subunit 12B protein phosphatase 1, regulatory subunit 12B hematopoietic SH2 domain containing calreticulin 3 10.77506 2.56E-13 1.24E-09 PPP1R12B NM_001197131 1q32.1 4.037987 3.19E-13 1.29E-09 CIB3 NM_054113 19p13.12 11.79294 1.87E-10 6.47E-07 KDM5B NM_006618 1q32.1 protein phosphatase 1, regulatory subunit 12B calcium and integrin binding family member 3 lysine (K)-specific demethylase 5B 2.353923 2.71E-09 8.18E-06 C19orf44 NM_032207 19p13.11 3.632156 2.80E-08 7.51E-05 SLC6A8a NM_005629 Xq28 -3.2085 8.91E-08 0.000215 SLC6A8a NM_001142806 Xq28 -3.20142 1.27E-07 0.000259 SLC6A8a NM_001142805 Xq28 -3.20027 1.29E-07 0.000259 PTGIS NM_000961 20q13.13 -6.20105 2.39E-07 0.000445 EPS15L1 NM_021235 19p13.11 2.866496 2.76E-07 0.000476 EPB41L3 NM_012307 18p11.31 -2.74367 5.20E-07 0.000837 CHERP NM_006387 19p13.11 chromosome 19 open reading frame 44 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 prostaglandin I2 (prostacyclin) synthase epidermal growth factor receptor pathway substrate 15-like 1 erythrocyte membrane protein band 4.1-like 3 calcium homeostasis endoplasmic reticulum protein 2.543635 1.77E-06 0.002671 95 AGTR1 NM_031850 3q24 angiotensin II receptor, type 1 3.782574 2.16E-06 0.003074 HAND2 NM_021973 4q34.1 -4.34468 2.73E-06 0.00332 AGTR1 NM_004835 3q24 heart and neural crest derivatives expressed 2 angiotensin II receptor, type 1 3.773031 2.74E-06 0.00332 AGTR1 NM_000685 3q24 angiotensin II receptor, type 1 3.772552 2.78E-06 0.00332 AGTR1 NM_032049 3q24 angiotensin II receptor, type 1 3.778037 2.89E-06 0.00332 AGTR1 NM_009585 3q24 angiotensin II receptor, type 1 3.762507 3.78E-06 0.004153 TSPAN18 NM_130783 11p11.2 tetraspanin 18 2.849367 4.31E-06 0.00453 NDNFa NM_024574 4q27 3.245657 6.85E-06 0.006893 HMCN1a NM_031935 1q25.3 neuron-derived neurotrophic factor hemicentin 1 2.560517 1.01E-05 0.009771 FTCD NM_006657 21q22.3 6.335793 1.44E-05 0.013072 IGFBP7 NM_001553 4q12 2.872799 1.51E-05 0.013072 IGFBP2 NM_000597 2q35 4.476771 1.52E-05 0.013072 IGFBP7 NM_001253835 4q12 2.848819 1.57E-05 0.013105 FTCD NM_206965 21q22.3 6.249194 2.20E-05 0.01773 CXCL12 NM_001033886 10q11.21 formiminotransferase cyclodeaminase insulin-like growth factor binding protein 7 insulin-like growth factor binding protein 2, 36kDa insulin-like growth factor binding protein 7 formiminotransferase cyclodeaminase chemokine (C-X-C motif) ligand 12 -2.98868 2.42E-05 0.018869 LAMA4 NM_001105206 6q21 laminin, alpha 4 -2.55132 2.89E-05 0.02061 LAMA4 NM_002290 6q21 laminin, alpha 4 -2.55117 2.89E-05 0.02061 LAMA4 NM_001105207 6q21 laminin, alpha 4 -2.55122 2.90E-05 0.02061 CXCL12 NM_000609 10q11.21 chemokine (C-X-C motif) ligand 12 -2.78343 3.93E-05 0.027125 ADH1C NM_000669 4q23 -6.80196 4.08E-05 0.027386 MOXD1 NM_015529 6q23.2 alcohol dehydrogenase 1C (class I), gamma polypeptide monooxygenase, DBH-like 1 -3.09077 4.82E-05 0.031498 CXCL12 NM_001178134 10q11.21 chemokine (C-X-C motif) ligand 12 -2.93299 5.06E-05 0.032089 NGEFa 2q37.1 -13.8292 5.27E-05 0.032089 -13.8018 5.31E-05 0.032089 2.809683 7.86E-05 0.046183 NM_001114090 NGEFa NM_019850 2q37.1 LOC255130 NR_034081 4q12 neuronal guanine nucleotide exchange factor neuronal guanine nucleotide exchange factor uncharacterized LOC255130 C10orf116 NM_006829 10q23.2 adipogenesis regulatory factor -3.27284 8.03E-05 0.046183 CXCL12 NM_199168 10q11.21 chemokine (C-X-C motif) ligand 12 -2.90411 8.33E-05 0.046794 ADH1B NM_000668 4q23 -6.77443 8.59E-05 0.047164 alcohol dehydrogenase 1B (class I), beta polypeptide aGene is associated with brain and/or neurons according to Entrez Gene or UniProtKB/Swiss-Prot. Supplementary Table S8. Differentially expressed transcripts with FDR < 0.05 in edgeR analysis for SLC6A8 del1–13 vs. WT contrast. A total of 34 transcripts derived from 20 genes were significantly differential. Gene / transcript name Location Description logFC PValue FDR UBE2Q2P2 NR_004847 15q25.2 5.674606 1.80E-42 4.36E-38 UBE2Q2P3 NR_024474 15q25.2 5.688236 2.43E-41 2.94E-37 GOLGA6L9 NM_198181 15q25.2 ubiquitin-conjugating enzyme E2Q family member 2 pseudogene 2 ubiquitin-conjugating enzyme E2Q family member 2 pseudogene 3 golgin A6 family-like 9 5.610332 2.09E-37 1.68E-33 LOC727849 NR_033936 15q25.2 golgin A2 pseudogene 5.2362 2.92E-35 1.76E-31 LOC440297 NR_033579 15q25.2 chondroitin sulfate proteoglycan 4 pseudogene 5.472136 1.18E-34 5.70E-31 96 AGSK1 NR_026811 15q25.2 golgin subfamily A member 2-like 5.266418 1.76E-34 7.07E-31 BCAP31 NR_024450 Xq28 -6.17514 2.45E-23 7.44E-20 BCAP31 NM_001256447 Xq28 -6.17514 2.46E-23 7.44E-20 BCAP31 NM_001139441 Xq28 -6.17703 3.18E-23 8.12E-20 BCAP31 NM_005745 Xq28 -6.17079 3.40E-23 8.12E-20 BCAP31 NM_001139457 Xq28 -6.17664 3.70E-23 8.12E-20 SLC6A8a NM_005629 Xq28 -5.38797 5.38E-15 1.08E-11 SLC6A8a NM_001142805 Xq28 -5.37008 1.18E-14 2.15E-11 SLC6A8a NM_001142806 Xq28 -5.3615 1.25E-14 2.15E-11 CCDC85A NM_001080433 2p16.1 B-cell receptor-associated protein 31 B-cell receptor-associated protein 31 B-cell receptor-associated protein 31 B-cell receptor-associated protein 31 B-cell receptor-associated protein 31 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 coiled-coil domain containing 85A -8.86819 6.30E-08 0.000101 THBS4 NM_003248 5q14.1 thrombospondin 4 4.712385 1.20E-07 0.000181 COL15A1 NM_001855 9q22.33 collagen, type XV, alpha 1 3.016657 3.47E-07 0.000493 ITIH5 NM_030569 10p14 3.255986 4.51E-06 0.006058 ITIH5 NM_032817 10p14 3.255208 5.17E-06 0.006579 ITIH5 NM_001001851 10p14 3.233844 7.60E-06 0.009186 FTCD NM_006657 21q22.3 6.493575 9.67E-06 0.011129 AQP1 NM_198098 7p14.3 inter-alpha-trypsin inhibitor heavy chain family, member 5 inter-alpha-trypsin inhibitor heavy chain family, member 5 inter-alpha-trypsin inhibitor heavy chain family, member 5 formiminotransferase cyclodeaminase aquaporin 1 (Colton blood group) 3.765411 1.18E-05 0.012642 AQP1 NM_001185062 7p14.3 aquaporin 1 (Colton blood group) 3.729217 1.24E-05 0.012642 AQP1 NM_001185060 7p14.3 aquaporin 1 (Colton blood group) 3.73262 1.26E-05 0.012642 AQP1 NM_001185061 7p14.3 aquaporin 1 (Colton blood group) 3.719051 1.31E-05 0.012642 GBP3 NM_018284 1p22.2 guanylate binding protein 3 -2.45365 1.43E-05 0.012975 FTCD NM_206965 21q22.3 6.417781 1.45E-05 0.012975 ID3 NM_002167 1p36.12 -2.57998 3.65E-05 0.031495 C13orf15 NM_014059 13q14.11 formiminotransferase cyclodeaminase inhibitor of DNA binding 3, dominant negative helix-loop-helix protein regulator of cell cycle 3.471337 4.22E-05 0.035179 TRIM55 NM_184086 8q13.1 tripartite motif containing 55 5.459388 5.51E-05 0.043195 TRIM55 NM_184085 8q13.1 tripartite motif containing 55 5.450672 5.54E-05 0.043195 TRIM55 NM_033058 8q13.1 tripartite motif containing 55 5.443594 5.76E-05 0.043506 RHD NM_016124 1p36.11 Rh blood group, D antigen -7.13963 6.60E-05 0.048217 CMKLR1 NM_001142343 12q23.3 chemokine-like receptor 1 4.411888 6.79E-05 0.048217 aGene is associated with brain and/or neurons according to Entrez Gene or UniProtKB/Swiss-Prot. 97 Supplementary Fig. 1. Venn diagrams of differentially expressed transcripts in SLC6A8 deficiency. Each of the SLC6A8 mutations versus WT contrasts is compared with one another. Shown are the number of significantly differentially expressed transcripts (FDR < 0.05) identified with edgeR analysis. The name of genes and transcripts that overlap between two contrasts are shown below. 98 99 Chapter 7 Summary, concluding remarks and perspectives. "No research will answer all queries that the future may raise. It is wiser to praise the work for what it has accomplished and then to formulate the problems still to be solved" Theobald Smith 100 101 Summary and concluding remarks Continuous loss of creatine/phosphocreatine in the form of creatine means there is a need for creatine replacement either through biosynthesis or from the diet. The physiological relevance of creatine is evident in individuals with a genetic defect of creatine synthesis – AGAT (OMIM: 602360) or GAMT (OMIM: 601240) or a genetic defect of creatine transport – SLC6A8 (OMIM: 300036) characterized by symptoms such as; intellectual disability, autistic behavior, speech/language and hypotonia delay. Dietary creatine supplementation has proved useful in treating these patients, especially in the case of patients with defects in AGAT and GAMT, and also heterozygous SLC6A8 female patients [1]. Being an endogenously synthesized compound, it is not surprising that the few issues raised on the side effects of creatine can be attributed to the purity of the supplemented creatine itself. Although patients will require lifelong creatine supplementation in order to avoid a relapse of symptoms, consolation can be drawn from the fact that near-complete remittance from (or prevention of onset of) symptoms seems to be possible. It is evident that phenotypic outcome in response to treatment of AGAT and GAMT deficiency depends on; timely diagnosis, early treatment onset and the duration of treatment (in this order), reason why we cannot sufficiently emphasize the importance of early diagnosis. In this regard we have developed an online database for both AGAT (www.lovd.nl/GATM) (Chapter 2) and GAMT (www.lovd.nl/GAMT) (Chapter 3) deficiency, which provides information on diagnosis and functional analysis of nontruncating variants. This initiative targets the provision of information to clinicians seeking confirmatory diagnosis and therapeutic approaches in patients suspected of creatine deficiency. As such we recommend that the first step towards diagnosis of a suspected creatine deficiency patient should be metabolite testing and/or DNA sequencing of either the GATM, GAMT or SLC6A8 genes, followed by online verification of any identified variants to check if they have been identified in previous patients and whether or not they are pathogenic. In chapter 3 we described the functional analysis of missense variants in GAMT, which is of pivotal importance for proper interpretation. Evidence in the form of creatine synthesis deficient patients suggests that endogenous creatine synthesis is quantitatively insufficient to fully make up for the CNS creatine requirement - be it as ATP provider or neurotransmitter. The relevance of studies aimed at unravelling how the creatine transporter can be stimulated and/or inhibited is highlighted by the fact that biosynthesis patients rely on creatine transport to benefit from therapy, while stimulation of creatine synthesis (via arginine and glycine supplementation) has shown some therapeutic potential in SLC6A8 deficient individuals. In fact there are studies that have shown a repression of AGAT expression in response to elevated creatine levels [2–5]. We have provided insight on two key areas (Chapter 4/5) that affect transcript and protein levels of the creatine transporter. In Chapter 4, we show that overexpression of CTR1 splice variants is associated with an increase in expression levels of the of the full-length CTR1 transporter. This highlights a potent avenue through which the expression levels of the creatine transporter can be manipulated. Differential transcriptional potential of the SLC6A8 promoter seen across cell types, suggests that alternative transcription factor expression is one of the ways that SLC6A8 transcript levels between different cell types are regulated (Chapter 5). It remains to be determined if genetic variants in this region can lead to SLC6A8 deficiency as a result of downregulated mRNA expression. By identifying the previously unknown promoter region of SLC6A8, we uncover a functional area that can also be screened for the presence of variants that could potentially alter the expression/function of the SLC6A8 creatine transporter. Surprisingly we found out that the SLC6A10P pseudogenes have a very high transcriptional 102 potential – another indication of their potentially significant, but yet unknown endogenous function(s) (Chapter 5). The most common symptoms of creatine synthesis or transport (ID, language delay and behavioral disorders) indicate a disturbance of higher cortical function [6]. Some of these features are replicated in the animal models of inborn errors of creatine metabolism [7–10] and they will be crucial in understanding the pathophysiology of these diseases. Nonetheless, unravelling the molecular events associated with creatine deficiency could provide important clarifications on its phenotypic outcome as well as potential therapeutic targets. Global transcription analysis revealed that the major outcome of the energy dysfunction due to creatine deficiency at the cellular level could be a disruption of the extracellular matrix with the potential consequence of compromised cellular integrity (Chapter 6). This provides an exciting avenue to explore the pathogenicity of creatine deficiency, whilst also providing a previously unappreciated role of creatine. Perspectives Since all creatine deficiencies share a cluster of symptoms, it is safe to assume that the primary determinant of their pathological consequence is creatine. And that the organs most affected will be those without secondary mechanisms to maintain/replenish their phosphocreatine stores. A case in point is that of SLC6A8 deficient patients, where it has been shown in vitro that in recombinant cells whereof the mutated transporter was still capable of partial creatine transport there was a corresponding mild phenotype in the individuals harboring these mutations [11]. Furthermore, muscle creatine levels are not as severely depleted as brain creatine levels in patients with either GAMT or SLC6A8 deficiency [12,13]. This is all very encouraging as it highlights the therapeutic potential of replenishing depleted creatine stores in these patients. Understanding how creatine transport is regulated could prove very useful for biosynthesis deficient patients as they rely on a properly functioning creatine transporter for treatment to be effective. In particular the function of the SLC6A10P pseudogenes should be explored, especially with their potential implication in the autistic phenotype of a patient. In view of the open questions on alternative creatine transport mechanisms in tissues less susceptible to creatine deficiency, as well as a reported patient with a deletion in the promoter region of SLC6A10pA, we recommend functional studies on the physiological relevance of these pseudogenes. Understanding the mechanisms through which creatine transport can be regulated has the potential to impact many different areas of neuroscience research and drug use in general, but particularly those patients that have been diagnosed with inborn errors of creatine metabolism and also those patients suffering from neurodegenerative diseases who currently benefit from creatine supplementation. In summary it seems obvious that understanding the full scope of the physiological relevance of creatine, creatine synthesis and creatine transport will shed more light on the pathophysiology of creatine deficiency. 103 References [1] S. Mercimek-Mahmutoglu, S. Stöckler-Ipsiroglu, G.S. Salomons GS. Creatine Deficiency Syndromes. 2009 Jan 15 [Updated 2011 Aug 18]. In: Pagon RA, Adam MP, Ardinger HH, et al., editors. GeneReviews® [Internet]. Seattle (WA): University of Washington, Seattle; 1993-2014. Available from: http://www.ncbi.nlm.nih.gov/books/NBK3794/. [2] D.M. McGuire, M.D. Gross, J.F. Van Pilsum, H.C. Towle, Repression of rat kidney L-arginine:glycine amidinotransferase synthesis by creatine at a pretranslational level., J. Biol. Chem. 259 (1984) 12034–8. [3] J.F. van Pilsum, D. M. McGuire, and C. A. Miller. "The antagonistic action of creatine and growth hormone on the expression of the gene for rat kidney L-arginine: glycine amidinotransferase." Guanidino compounds in biology and Medicine (1992): 147-151. [4] R. da Silva, I. Nissim, Creatine synthesis: hepatic metabolism of guanidinoacetate and creatine in the rat in vitro and in vivo, … Metab. 9 (2009) 256–261. [5] P. Guthmiller, J. Van Pilsum, Cloning and sequencing of rat kidney L-arginine: glycine amidinotransferase. Studies on the mechanism of regulation by growth hormone and creatine., J. Biol. …. 269 (1994) 17556–17560. [6] V. Leuzzi, M. Mastrangelo, R. Battini, G. Cioni, Inborn errors of creatine metabolism and epilepsy., Epilepsia. 54 (2013) 217–27. [7] A. Schmidt, B. Marescau, E. a Boehm, W.K.J. Renema, R. Peco, A. Das, et al., Severely altered guanidino compound levels, disturbed body weight homeostasis and impaired fertility in a mouse model of guanidinoacetate N-methyltransferase (GAMT) deficiency., Hum. Mol. Genet. 13 (2004) 905–21. [8] M.R. Skelton, T.L. Schaefer, D.L. Graham, T.J. Degrauw, J.F. Clark, M.T. Williams, et al., Creatine transporter (CrT; Slc6a8) knockout mice as a model of human CrT deficiency., PLoS One. 6 (2011) e16187. [9] C.I. Nabuurs, C.U. Choe, a Veltien, H.E. Kan, L.J.C. van Loon, R.J.T. Rodenburg, et al., Disturbed energy metabolism and muscular dystrophy caused by pure creatine deficiency are reversible by creatine intake., J. Physiol. 591 (2013) 571–92. [10] C. Choe, C. Nabuurs, M.C. Stockebrand, A. Neu, P. Nunes, F. Morellini, et al., L-arginine:glycine amidinotransferase deficiency protects from metabolic syndrome., Hum. Mol. Genet. 22 (2013) 110–23. [11] O.T. Betsalel, A. Pop, E.H. Rosenberg, M. Fernandez-Ojeda, C. Jakobs, G.S. Salomons, Detection of variants in SLC6A8 and functional analysis of unclassified missense variants., Mol. Genet. Metab. 105 (2012) 596–601. 104 [12] R. Ensenauer, T. Thiel, K.O. Schwab, U. Tacke, S. Stöckler-Ipsiroglu, A. Schulze, et al., Guanidinoacetate methyltransferase deficiency: differences of creatine uptake in human brain and muscle., Mol. Genet. Metab. 82 (2004) 208–13. [13] G.J. Pyne-Geithman, T.J. deGrauw, K.M. Cecil, G. Chuck, M. a Lyons, Y. Ishida, et al., Presence of normal creatine in the muscle of a patient with a mutation in the creatine transporter: a case study., Mol. Cell. Biochem. 262 (2004) 35–9. 105 Appendices Nederlandse samenvatting Acknowledgements Curriculum vitae List of Publications "Let me tell you the secret that has led me to my goal. My only strength lies in my tenacity" Louis Pasteur 106 107 NEDERLANDSE SAMENVATTING Creatine Deficiëntie Syndromen: Klinische, Moleculaire en Functionele Aanpak. 108 NEDERLANDSE SAMENVATTING Creatine deficiëntie syndromen (CDS) zijn aangeboren stofwisselingsziekten met als biochemisch kenmerk, de afwezigheid van creatine/fosfocreatine in de hersenen. Klinische manifestaties worden gekenmerkt door verstandelijke beperking, vertraagde spraak- en taalontwikkeling, autistisch gedrag en epilepsie. Er wordt geschat dat de endogene creatine synthese (door arginine:glycine amidinotransferase – AGAT en guanidinoacetaat methyltransferase – GAMT) voorziet in ongeveer de helft van onze dagelijkse behoefte aan creatine. De andere helft wordt verkregen uit de voeding. De creatine transporter (CT1 wordt door het SLC6A8 gen gecodeerd) is verantwoordelijk voor de opname van creatine in de cellen. Genetische afwijkingen in ofwel AGAT, GAMT of SLC6A8 veroorzaken CDS. Creatine suppletie heeft opmerkelijke successen opgeleverd in de behandeling van individuen met een AGAT - of GAMT deficiëntie. Creatine suppletie is tot nu toe niet effectief bewezen in de behandeling van patiënten met een SLC6A8 deficiëntie. De afwezigheid van klinische verschijnselen bij pre-symptomatische individuen met een AGAT - of GAMT deficiënte waarbij de behandeling vroeg in het leven werd gestart, illustreert het belang van vroegtijdige diagnose en behandeling. Het is dan ook belangrijk om bekendheid met deze aandoening te vergroten. Hiertoe hebben wij het klinische fenotype en de lange termijn behandelingsresultaten beschreven van een patiënt aangedaan met AGAT deficiëntie (hoofdstuk 2), als ook een overzicht gemaakt van de tot dan toe in de literatuur beschreven AGAT deficiënte patiënten. GAMT deficiëntie was al wel grondig beschreven, hoewel studies naar missense mutaties in het GAMT gen nog ontbraken. Aangezien missense mutaties meestal moeilijk te interpreteren zijn, hebben wij een functionele studie opgezet voor het karakteriseren van dit type mutaties. We onderzochten de tot nu toe bekende missense mutaties, inclusief nieuwe missense mutaties gevonden in 13 GAMT patiënten (hoofdstuk 3). Wij hebben ook een online database ontwikkeld voor zowel AGAT (www.lovd.nl/GATM) (hoofdstuk 2) als GAMT (www.lovd.nl/GAMT) (hoofdstuk 3) deficiëntie. Deze databases bevatten informatie over de pathogeniciteit van de varianten en de functionele analyses van diverse varianten. Dit initiatief richt zich vooral op de verstrekking van informatie aan diagnostici en clinici, die op zoek zijn naar de bevestiging/uitsluiting van een diagnose. De behandeling van AGAT en GAMT deficiëntie is afhankelijk van functioneel creatine transport. Door het onderzoek naar de SLC6A8 genregulatie, kunnen deze behandelingsmethoden mogelijk worden verbeterd. Daarom onderzochten wij de mogelijke aanwezigheid van alternatieve splice varianten van de creatine transporter. Wij hebben twee splice varianten geïdentificeerd met een vergelijkbaar expressie profiel als dat van het creatine transporter gen. Door middel van overexpressie experimenten is onderzocht of deze splice varianten in staat zijn creatine transport te reguleren. Inderdaad bleek overexpressie van deze varianten CT1 expressie positief te reguleren (hoofdstuk 4). Bij patiënten met een (X-gebonden) verstandelijke beperking is de kans op een defect in de creatine transporter aanwezig. Bij deze patiënten kan DNA analyse van het SLC6A8 gen worden ingezet. Echter, bij deze screening is geen rekening gehouden met de nog onbekende promotor regio van het SLC6A8 gen. Uit diverse whole genome sequencing projecten is gebleken dat ziekte veroorzakende varianten ook gevonden kunnen worden binnen niet-coderende gebieden, waardoor wij de promotor van het SLC6A8 gen als ook dat van het SLC6A8 pseudogen op chromosoom 16 (SLC6A10P) graag wilde identificeren(hoofdstuk 5). In tegenstelling tot SLC6A8, is de expressie van het SLC6A10P pseudogen alleen gerapporteerd in de hersenen en de testis. Vervolgens hebben wij zowel de promotor regio van het pseudogen als van SLC6A8 gekloneerd en onderzocht op het transcriptie potentiaal. Verassend genoeg bleek ten opzichte van de SLC6A8 promotor het transcriptie potentiaal van de SLC6A8P promotor in verschillende celtypen hoger te liggen dan dat van SLC6A8 (hoofdstuk 5). 109 NEDERLANDSE SAMENVATTING Tot nu toe zijn pogingen voor de behandeling van patiënten met een SLC6A8 deficiëntie nog niet succesvol gebleken. Door een beter inzicht te verkrijgen in de moleculaire pathofysiologie van creatine deficiëntie, kunnen alternatieve behandelingsstrategieën worden ontwikkeld. Voor verdere verbetering van onze kennis over de achtergrond van creatine deficiëntie pathways is er een differentieel genome–wide RNAexpressie experiment uitgevoerd in SLC6A8 deficiënte fibroblasten. In vergelijking met controle fibroblasten, bleken in fibroblasten van verschillende patiënten diverse genen extracellulaire matrix betroken. Ook genen die coderen voor sommige synaptische eiwitten bleken differentieel tot expressie te komen in fibroblasten van patiënten (hoofdstuk 6). 110 ACKNOWLEDGEMENTS Dear Supervisors, Colleagues, Friends and Family, Several years of work have eventually led to some good publications and finally my thesis is ready. To quote one of the members on my thesis review committee “…. I think that it is of very high quality. I suggest that you proceed with the public defense of this thesis. Ndika’s work will contribute significantly to our knowledge about the syndromes of Creatine Deficiency.” It is tempting to be enveloped with a sense of smug satisfaction with myself, but I do not indulge, for I realize that none of this would have been possible without your tremendous help and support all these years. It is of course well documented how the right attitude, hard work, some luck and being at the right place at the right time are the key ingredients to any kind of success, but I will want to add that for me it has also been about being surrounded by the right people. In one way or the other, directly or indirectly, you have all been extremely helpful in putting together the pieces which make up the final picture. I could go on and on about how each of you have been an intricate part of the whole stuff, from its conception to where it is today, but first I want to say that I am overwhelmingly grateful to those who provided the pieces to the puzzle. These are my promoters; Gajja Salomons and Cornelis Jakobs, who first of all gave me the opportunity to do my PhD in this lab. Karel you have the ability to be extremely critical and very encouraging at the same time – the perfect combination for molding anyone into a top scientist. It was easy for me to settle in when I just started because every now and then Karel will stop by to ask how things (especially besides work) were going. You once told me work can take care of itself but family is very important! It is an honor for me to have been your student. At face view my relationship with Gajja seems to be about a decent amount of cancelled appointments (I actually still have our monthly lunch meeting in my calendar), but what you don’t see is the numerous hours behind separate computers and way into the night getting these manuscripts ready for submission and resubmission. As a young researcher our minds are typically running wild with all these amazing experiments we will like to do, and I can still hear Gajja’s voice saying something along the lines of “yes you will conquer the world, but one day at a time – make a deadline and let’s send out the paper firstJ”. Gajja you have always encouraged us to drop by your office anytime – even if it wasn’t about work (jeeeej!). It has been all fun working in your group, and you are such an easy-going person. Thanks for the all-round support, especially with de laatste loodjes. Those who have done it will agree with me that when you leave most of your family behind and go abroad to work, the hospitality of your bosses and colleagues become extremely crucial to your performance at work. It has been a bumpy (nonetheless merry) ride all the way and they (Gajja and Karel) have been the catalyst of such a pleasant working atmosphere. Cristina Martinez – my copromoter and weekly supervisor during my first year, was the hand in charge of steadying the ship. In her research life Cris has been in the thick of it and still came out on top, and this is the tenacity that she passed on to me. A moment I will like to recall was some 6 months into my PhD training, when you told me that in the ideal world it will be awesome as a PhD student to have a senior researcher in your same line of research to help you out along the way when you get stuck. But you were going to only be around for another half year – although not ideal, the advantage will be that I will have the opportunity to learn how to become an independent research scientist. I looked on the bright side like you said, kept at it, and in my current position as research scientist I am glad to say I am reaping the benefits you talked about. Words cannot sufficiently express my gratitude for your immense support and guidance, but I must say that it was great working with you and to date I haven’t learnt more in a single year than I did while working with you. 111 ACKNOWLEDGEMENTS It dawned on me just how much this lab meant to me when I had to leave. Being such an adventurous person who has always been on the lookout for the next new experience, this came as a surprise to me. I still remember my first day at the lab, when after my interview Cris gave me a tour of the lab. There was an immediate connection, but at first I couldn’t put my finger on it. It must have been the enthusiasm and openness of Cris when she talked about research at the Metabool lab, or that we were making a joke about Silvy’s birthday in Gajja’s office or even that Ofir (who has always been my go-to guy from day 1) had already been asking me if I liked my potential sitting spot, and what kind of configurations I will like for my PC. I mean, all these with the “potential” PhD student. So much for the “foreigners-should-avoiddoing-their-first-internships-at-the-VUMC” speech we got from our tutors during the Masters at the University. Obviously there may have been a couple of issues involving international students who had been doing their internships at the VUMC, and the general feeling was that the VUMC had some issues with integrating different cultures. But this was definitely not the case of the Metabool lab or the Clinical Chemistry department for that matter. I had just seen some Romanians, Surinamese, Moroccans, Peruvians, Vietnamese…and finally even Dutch people! J Those of you who worked very closely with me may think my favorite moment in the lab, will have to be either when we finally cloned the creatine transporter (took us about a year) and if not maybe when we were first able to set up the optimized creatine uptake assay using the depletion method, or maybe when we were finally able to clone and sequence the GC-rich CT1 promoter…or maybe it is when each of the articles presented in this thesis got accepted….well, NO! My ultimate best memories from the lab, are all the parties we had! At Karel’s boat, at the coffee corner (Christmas, New Year, Rien’s birthday…), at “The Basket”, at Gajja’s place, at Silvy’s place, at my place, at “Coco’s outback” …. Etc. And I’ll tell you why – with such familiarity at work, work became a way of life. Gone is the stress when things are not working, gone is the “nine-to-five” mentality and you get tremendous support from colleagues when you need help with experiments. This is the memory I will always have of this lab. When I talk about how I miss Amsterdam my colleagues in Helsinki sometimes ask me if I have family back there….well yes – my brother and the Metabool lab! What I missed doing my research, in terms of state of the art equipment was more than sufficiently compensated for by amazing colleagues. We didn’t for example have a (?00000 €) cell culture robot like the one they have at the CNCR, but I always had the girls – Ana, Matilde Fernandez, Silvy and Warsha to look after my precious cells in the ML2 when I couldn’t … priceless! I am extremely grateful for the tremendous help I got from Warsha Kanhai and Silvy van Dooren. We had already worked together on a couple of projects, BUT, even when I left the lab and the reviewers asked for additional experiments they stepped in to do them for me. Without you guys this will have been by no means be over when it did. After working at such a bustling lab for half a decade I now have a huge task of trying to remember all of you who have been an integral part of my VUMC life. I especially have fond memories of; -Former AIO’s; Martijn Kranendijk, Leonard van der Zwan, Daan van Abel, MARISKA Davids, Ofir Betsalel, Hong Bui, Jiddeke van de Kamp, Saadet Mahmutoglu, the Portuguese crew; MONICA Rocha, Ruben Esse, Marisa Mendes. It was fun to have worked with you guys. It seems like a lifetime ago that we were all working together. I am happy that we are all moving forward with our careers. Special thanks to Ofir – my software expert, movie dealer, manuscript figures editor … -The metabolite guys; Henk Blom, Eduard Struys, Birthe Roos, Abdellatif Bakkali, Bram Grob, Ulbe Holwerda, ERIC (dude) Wever, Willeke Klappe, Fariza El Aomari-Bel, Mirjam Wamelink, Desirée Smith, Erwin Jansen…it was great working with you guys. Eric thanks a lot for always taking care of my PC issues. 112 ACKNOWLEDGEMENTS On an entirely different note, we should definitely have a few more beers for the roadJ. Abdelatif we live today to talk politics another day. Erwin please let me know when you set up the betting pool for the upcoming FIFA world cup, the Dutch team is not looking in great shape this time around so I fancy my chances of making some quick cash. My sincere gratitude to the GC-MS guys (Erwin and Ulbe) and the LCMS girl (Desire), you ran countless samples for me. -The chemists; Herman ten Brink, Peter Bier, thanks for the “home-made” isotope-labelled creatine. -My students; Vera Lusink, Claudine Beaubrun, Fay Visser, Nandaja Anand and Gaby Steba. It was a great experience and a learning moment for both supervisor and student. You all did such great work on your projects and I wish you guys all the best to come. -The MBL lab guys; Marie van Dijk, Omar Michel, Daan, Hari Thulluru, we had such a great collaboration – sharing lab space, lab equipment, enzymes and even cell lines. Thanks guys. -The present AIO’s; Ana Pop, Hari, Arjan Malekzadeh (my other movie dealer) – we all get there! Wish you guys all the best as you approach your final stages. Ana, you are just starting but I am very sure you will quickly find out that it is not all different from what you have been doing all these years, well except maybe more fun. -My other go-to ladies – Anneke Tekkelenburg, Karin Studer and Anne Zijtregtop, thanks for all your great help with the never-ending administrative and immigration hassles. -And finally at the end I got my postdoc – Ben Nota! “… we don’t do duplicates – they are useless for statistics”. Oh, I forgot you did mention that there is another kind of statistics for duplicates and single samples … It was great having you around and working with you. You came with the next generation flow, and we learnt a great deal together and I learnt a lot from you – yes statisticsJ. Well, all this talk about colleagues, but the real architects of the whole thing…way back when – my parents, Henry Tanyi (in loving memory) and Beatrice Tanyi. Mum and Dad I can never thank you enough for your ever-present and ongoing support, and above all your unwavering confidence in me. And finally, from the bottom of my heart I want to thank the one person who kept all of this neatly bound together; my rock, my loving wife Jane Besong-Ndika. For nine years you have always been there picking up the pieces and offering the most support even though it was you who sacrificed the most. With you by my side I feel I only need to want it to get it. Like Martijn said, being a father is the greatest title I will ever get, and that is all thanks to you and our little jumpy boy Jaycie Ndika. In a nutshell, for me this is no “happy ending”, only a cherished moment in time to be continued someday somehow …. I wish you all good health and lots of happiness. And for the AIO’s, 1000 publications! Sincerely, Joe. 113 CURRICULUM VITAE Joseph Ndika was born in Bamenda, Cameroon on December 5 th 1983. From 2001 – 2004, he was an undergraduate student at the University of Buea, where he obtained a BSc. degree, with honors, in Biochemistry/Medical Laboratory Technology. In the same year he took up a Biochemistry/Genetic Engineering postgraduate study program at the Université de Yaoundé I. In 2006, he gave up this rather theoretical study program and moved to Amsterdam to pursue a Masters degree in Molecular Cell Biology at Vrije University. He obtained his MSc. in 2008, after two internships; first in the group of dr. Henk Schallig [Royal Tropical Institute (KIT) – Parasitology] – where he was involved in the development of PCR-based rapid diagnostic tests for Malaria, and subsequently in the group of prof. Sander Tans [FOM Institute for Atomic and Molecular Physics (AMOLF) – Biophysics] – where he applied a directed evolution approach to elucidate the mutational trajectories during the adaptive evolution of a novel regulatory function in a variable environment, using the lac repressor as a model system. In 2008 he was admitted as a graduate student of the Neuroscience Campus Amsterdam, to carry out his PhD research at the VU, University Medical Center, in the group of prof. Gajja Salomons (Metabolic Lab – DNA group) at the Department of Clinical Chemistry. The results of this work are described in this thesis. Since 2013, Joe has been working as a Research Scientist at the Finnish Institute of Occupational Health, in the group of prof. Harri Alenius (Systems Toxicology), where he employs high-throughput proteomics and a systems biology approach to; 1 – study the health effects of engineered nanomaterials and, 2 – characterize the genetic and/or environmental components of exposure-linked allergic reactions. Joe is married to Jane Besong-Ndika and they live together with their son Jaycie in Helsinki. 114 LIST OF PUBLICATIONS [1] J.D.T. Ndika, K. Johnston, J. A Barkovich, M.D. Wirt, P. O’Neill, O.T. Betsalel, et al., Developmental progress and creatine restoration upon long-term creatine supplementation of a patient with arginine:glycine amidinotransferase deficiency., Mol. Genet. Metab. 106 (2012) 48–54 [2] M. Davids, J.D.T. Ndika, G.S. Salomons, H.J. Blom, T. Teerlink, Promiscuous activity of arginine:glycine amidinotransferase is responsible for the synthesis of the novel cardiovascular risk factor homoarginine., FEBS Lett. 586 (2012) 3653–7 [3] M.G.J. de Vos, F.J. Poelwijk, N. Battich, J.D.T. Ndika, S.J. Tans, Environmental dependence of genetic constraint., PLoS Genet. 9 (2013) e1003580 [4] J.D.T. Ndika, V. Lusink, C. Beaubrun, W. Kanhai, C. Martinez-Munoz, C. Jakobs, et al., Cloning and characterization of the promoter regions from the parent and paralogous creatine transporter genes., Gene. 533 (2014) 488–93. [5] J. Ndika*, S. Mercimek-Mahmutoglu*, W. Kanhai, T. Billette de Villemeur, D. Cheillan, E. Christensen, et al., Thirteen new patients with guanidinoacetate methyltransferase deficiency and functional characterization of nineteen novel missense variants in the GAMT gene, Hum. Mutat. 35 (2014) 462-469 [6] J.D.T. Ndika, C. Martinez-Munoz, N. Anand, S.J.M. van Dooren, W. Kanhai, D.E.C. Smith, et al., Posttranscriptional regulation of the creatine transporter gene: Functional relevance of alternative splicing., Biochim. Biophys. Acta. (2014)- General Subjects. 1840 (6) 2070-2079 [7] Benjamin Nota, Joseph D. T. Ndika, Jiddeke M. van de Kamp, Warsha A. Kanhai, Silvy J. M. van Dooren, Mark A. van de Wiel, Gerard Pals, and Gajja S. Salomons., RNA sequencing of creatine transporter (SLC6A8) deficient fibroblasts reveals impairment of the extracellular matrix. Submitted article. *Contributed equally 116
© Copyright 2026 ExpyDoc