From www.bloodjournal.org by guest on January 20, 2015. For personal use only. Mutational Analysis of the CDKN2 (MTSI/p16i”k4A)Gene in Primary B-Cell Lymphomas By Toshiki Uchida, Takashi Watanabe, Tomohiro Kinoshita, Takashi Murate, Hidehiko Saito, and Tomomitsu Hotta The CDKNZ gene located on chromosome 9p21 encodes the cyclin-dependentkinase4 inhibitor p16. This gene isputaa tive tumor-suppressor gene because of its frequent alterations in many kinds of tumor cell lines. We analyzed the CDKNZ gene to evaluate its alterations in 52 primary specimens of non-Hodgkin’s lymphoma (NHL) or chronic lymphocytic leukemia (CLL) of B-cell origin by Southernblot analysis, polymerase chain reaction-mediated single-strand conformationpolymorphism (PCR-SSCP)analysis,anddirect sequencing.By Southern blot analysis, we showed homozygous deletion of the CDKNZ gene in 3 of 42 patients with B-NHL (7.1%). After screening by PCR-SSCP analysis, direct sequencing identified one missense mutation at codon 72 (nucleotide 233) and two frameshifts due to a 35-bp deletion arising at codon 3 (nucleotides 27 to 61) and a 13bp deletion arising at codon 49 (nucleotides 163 to 175) in patients with B-NHL (3 of 42, 7.1%). In the patient carrying the missense mutation, hemizygous deletion of the CDKNZ gene was also suspected. In this study, we detected alterations in CDKNZ in 6 of 42 patients (14.3%) with B-NHL and in none of 10 patients with B-CLL. Our results suggest that the CDKNZ alterations contribute in tumorigenesisin some patients with B-NHL. 0 1995 by The American Societyof Hematology. T fragment 1, also known as CIPI, SDII, CAPI, and CDKNI) were absent in many primary tumors.” Alterations in CDKN2 have been reported inmanyprimaryhuman cancers?O-29 following their demonstration in cell lines. In contrast to WAF1 mutations, the CDKN2 gene was found to be homozygously deleted or mutated at a high frequency in some types of primary tumors, showing thatthe CDKN2 gene is a tumor suppressor.20”2However, because there was a discrepancy between the rate of the CDKN2 mutations and that of loss of heterozygosity at 9p21 in primary tumors” and also between the rate of CDKN2 alterations in primary tumors and that of cell line^,*^-*^ itis still unclear whether the CDKN2 gene also plays an important role in tumorigenesis of other primary tumors. The extent to which the CDKN2 gene is involved in tumorigenesis is currently under intensive investigation. In hematologic malignancies, the CDKN2 alteration has beenwell investigated in acute lymphocytic leukemias (ALL),’4.’o.’I which frequently show chromosome 9 abnormalities.17 However, detailed investigations of this gene in other hematologic malignancies have not yet been reported. In this study, to evaluate the alterations in the CDKN2 gene and to determine whether this gene plays an important role in tumorigenesis or disease progression of primary B-cell lymphomas, we performed Southern blotting, polymerase chain reaction-mediated single-strand conformation polymorphism (PCR-SSCP), and direct sequence analyses of the CDKN2 gene in patients with non-Hodgkin’s lymphoma (NHL) or chronic lymphocytic leukemia (CLL). HE CYCLIN-DEPENDENT kinases (CDKs) bindto G1-cyclins and control the GUS transition of the cell cycle by phosphorylation of the retinoblastoma protein. CDK inhibitory proteins bind to the CDKs and inhibit the catalytic activity of the CDIUGl-cyclin complex.’,2Several inhibitors of CDK-cyclin activity have been identified to date in mammalian cells: p1.5,’p16: ~ 1 8 , ~ ~ and 2 1 ,~~2 -7 *. ~ CDK4” ,’” and its closest homologue CDK6” are activated by binding to cyclin D l , which is one of the G1-cyclins. The p16 protein specifically inhibits CDK4-cyclin D l and CDK6-cyclin D1 kinase activity in ~ i t r o ,and ~ , ~perhaps prevents inappropriate phosphoryration of the retinoblastoma protein.* Recently the CDKN2 (also known as multiple tumor suppressor 1: MTSI, p16INK4*, CDK4 Inhibitor: CDK41) gene was found on chromosome 9 ~ 2 1 , where ’~ molecular, genetic, and cytogenetic abnormalities have been reported in many kinds of malignancies, including malignant melanoma^,'^ gliomas,15lung cancers,I6 and 1e~kemias.l~ The in vivo importance of p16 was suggested by the discovery that p16 protein is encoded by this gene.” Recent studies showed frequent homozygous deletions and point mutations of the CDKN2 gene in many tumor cell lines.”.” These results imply that the CDKN2 gene functions as a tumor suppressor and that mutations in the CDKN2 gene are involved in tumorigenesis in many human cancers. The involvement of CDK inhibitors in cancer development was first demonstrated by studies on p21, which is a potent and universal inhibitor of G1 cyclin-dependent kinases6-’ However, it was reported recently that mutations of the p21 encoding gene WAF1 (wild-type p53-activated MATERIALSANDMETHODS From the First Department of Internal Medicine, Nagoya University School of Medicine, Nagoya, Japan. Submitted March 27, 1995; accepted May 30, 1995. Supported in part by Grants-in-Aid for Cancer Research (4-5) from the Ministry of Health and Welfare of Japan. Address reprint requests to Tomomitsu Hotta, MD, First Department of Internal Medicine, Nagoya Universiry School of Medicine, 65 Tsurumai-cyo, Showa-ku, Nagoya 466, Japan. The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. section 1734 solely to indicate this fact. 0 1995 by The American Society of Hematology. 0006-4971/9.5/8607-00I6$3.00/0 2124 Patient profiles. We analyzed a total of 52 patients, 10 with CLL/small-cell lymphocytic lymphoma and 42 with NHL, other than small-cell lymphocytic lymphoma of B-cell origin, who were admitted to our hospital between July 1987 and September 1994. Sixteen of these patients were treated in our affiliated hospitals and seven patients were admitted at relapse. The profiles of these patients are shown in Table l . Histologic and surface marker studies using immunohistochemical techniques showed B-cell phenotype in all patients. Preparation of DNA. DNA extraction was performed bythe standard p r ~ c e d u r eDNA . ~ ~ samples from lymph nodes or extranodal tumors were obtained at biopsy performed after informed consent was obtained. We also obtained DNA samples from mononuclear cells, which were separated on Ficoll-Paque (Pharmacia, Uppsala, Blood, Vol 86, No 7 (October l ) , 1995: pp 2724-2731 From www.bloodjournal.org by guest on January 20, 2015. For personal use only. MUTATIONALANALYSISOF THE CDKNZ (MTSl/p7GfNKa)GENE with a laser image analyzer (FUJIX BAS2000; Fuji Photo Film).37 We measured phosphostimulated luminescence of bands, correNo. patients 52 sponding to the CDKN2/MTSI gene, the MTS2 gene, and the c-myb CLL 10 gene. Age (yrs) 54-78 As a normal control, we used DNA obtained from normal B cells Median 63 of the spleen excised from a patient with gastric cancer, as described Clinical stage of CLL in detail previously.'* We also used DNA of MOLT4 and Jurkat A 1 cells as controls, inbothofwhich homozygous deletion of the B 2 CDKN2 gene were reported previou~ly.~~ C 7 PCR-SSCP analysis. Analysis by PCR-SSCP was performed esNHL 42 sentially as described p r e v i o ~ s l y .We ~ ~ .analyzed ~~ exon 1 and exon Age (yrs) 15-83 2 of the CDKN2 gene, comprising 97% of the coding sequence. For Median 56 exon 1, weused the primers published previo~sly.'~ Because the Clinical stage of NHL fragment size of exon 2 seemed to be too long for PCR-SSCP l 1 analysis, we divided it into three fragments, designated as CDKN2II 9 exon 2A, CDKN2-exon 2B, andCDKN2-exon2C.We amplified 111 11 genomic DNAofCDKN2 gene by PCR in the presence of5% IV 21 dimethylsulfoxide. For exon 2, we performed nested PCR to exclude Histopathology of N H L amplification of the MTS2 gene. Nucleotide sequences of the primers Follicular small cleaved are shown in Table 2. Thirty-five cycles of the PCR reaction at 94, Follicular mixed 55,and 72°Cfor 0.5,0.5, and 1 minute, respectively, were performed Follicular large in a Thermal cycler (Perkin-Elmer Cetus, Norwalk, CT). In amplifiDiffuse small cleaved cation of exon 2, 1 p L of the first PCR products was subjected to Diffuse mixed the second roundofPCR under the same conditions as the first Diffuse large reaction except for the use of 30 cycles and the second-round PCR The diagnosis of CLL was based on the criteria proposed by the primer set. The products were diluted 100 times with98% forInternational Workshop on CLL,= and the clinical stage was decided mamide, 20 mmoliL EDTA, 0.05% bromophenol blue, and 0.05% according to a revised prognostic staging system also proposed by xylene cyanol, and heated at 94°C for 4 minutes. Aliquots of 2 the International Workshop on CLL.33 The Modified WorkingFormulapL were then promptly applied to 5% polyacrylamide gels without tion Classificationwas applied for histological classificationof NHL.= glycerol. After electrophoresis at room temperature for 1 to 2 hours at a constant power of 40 W with vigorous air cooling, the gels were dried on Whatman 3MM paper (Whatman International, Maidstone, UK) and exposed to x-ray filmfor appropriate times at -70°C. Sweden) density gradient centrifugation of peripheral blood, pleural These conditions for electrophoresis were selected as the best for effusions, or ascites with lymphoma cell invasion. By morphologic the separation of products among several conditions examined emexamination and surface marker analysis, we confirmed that the pirically in a preliminary study (data not shown). proportion of tumor cells exceeded 70% in all the specimens examDirect DNA sequencing. Sequences of samples showing mobilined. ity shifts by PCR-SSCP analysis were confirmed by direct sequencSouthern blor analysis. Ten micrograms ofDNAwas digested ing as described previo~sly.~' Briefly, a small area of the gel correwith EcoRI (Boehringer Mannheim, Mannheim, Germany), sepasponding to the position of the band was cut out, and single-stranded rated by electrophoresis through 0.7% agarose gels, and blotted onto DNA from the dried gel was eluted into 50 pL of distilled water. nylon membranes (Hybond N; Amersham, Buckinghamshire, UK). Four microliters of the eluted solution was subjected to asymmetrical p26 cDNA was used as a probe for detection of the EcoRI-digested amplification by PCR. The amplified reaction mixture was purified fragments of the CDKN2 genomic DNA. The 471-bp p26 cDNA in a micro-concentrator Centricon 30 (Amicon; W.R. Grace and CO, probe was produced by reverse transcriptase (RT)-PCR, using cDNA Beverly, MA), and the single-stranded DNA was annealed to a 5'from normal human peripheral blood lymphocytes as a template. end labeled primer. Chain elongation and termination were perThe primers for RT-PCR were designed to amplify the region formed using a Sequenase kit (Sequenase Ver. 2.0; US Biochemical covering the entire coding sequence of the p16 cDNA reported Corp. Cleveland, OH), and the products were run in 6% polyacrylprevio~sly.~ These sequences were as follows: 5"CGAGGCAGCATGGAGCCTT-3' and 5'-GCCTCTCTGGTTCITTCAAT-3'. amide gels containing 7 m o m urea. The products from bands with a mobility shift wererun in parallel with those without mobility Oligonucleotide primers in the PCR reactions were synthesized by shift in the same gel. After electrophoresis at room temperature for the phosphoroamide method with a 391 DNA synthesizer (Applied appropriate times at a constant current of 30 mA, the gels were Biosystems, Foster City, CA). This probe can identify fragments of dried on Whatman 3MM paper and exposed to x-ray film at room both the CDKN2IMTS2 gene and the multiple tumor suppressor 2 temperature. (MTS2, also known as ~ 1 5 " ~gene. ~ ~ The ) p16 cDNA probe was labeled with [a-32P]dCTPby the random primer method, and hybridRESULTS ization was performed for 2 hours at 65°C using a Rapid-hyb buffer (Amersham). After washing at high stringency with 0.1 X SSC and Analysis of the CDKN2 gene by Southern blotting. We 0.1% sodium dodecyl sulfate (SDS) at 6 5 T , membranes were exinvestigated the genomic DNAcorresponding to the CDKN2 posed toKodakXARfilm (Eastman Kodak, Rochester, NY) at gene by Southern blotting to detect gross alterations. The -70°C. The same membranes were then rehybridized with labeled p16 cDNA probe hybridized with EcoRI digestion fragments human c-myb cDNA probe36to confirm the integrity of the sample of about 4.2- and 6.0-kb corresponding to the CDKN2MTS1 DNA and completeness of EcoRI digestion. gene and the MTS2 gene, respectively. Figure 1 shows part To evaluate deletions of the CDKN2 gene, we also exposed the blots to phosphor imaging plates (Imaging plate BAS 111; Fuji Photo of the results of Southern blot analysis. The band reflecting Film, Minami-ashigara, Japan), whichwere subsequently studied the CDKN2lMTSI gene disappeared clearly in patients 7 Table 1. Patient Profiler of 2725 nt From www.bloodjournal.org by guest on January 20, 2015. For personal use only. 2726 UCHIDA ET AL Table 2. Primers for PCR-SSCP Analysis and Direct Sequencing of the CDKN2 Gene Amplified (bp) Exon 1 343 Exon 2A 210 Sequence 5'-GAAGAAAGAGGAGGGGCTG-3' 5"GCGCTACCTGAlTCCAAlTC-3' ~"CTCTACACAAGC~TCCTT-~' 5"CAAAlTCTCAGATCATCA-3' 5'-CTCTACACAAGClTCClT-3' 5'-AGCACCACCAGCGTGTCCAG-3' 5"CTCTACACAAGClTCClT-3' 5'-CAAATTCTCAGATCATCA-3' 5"CCGTGCACGACGCTGC-3' 5'-GCATCGCGCACGTCCA-3' 5"CCGTGCACGACGCTGC-3' 5"TGAGClTGGAAGCTCT-3' 5'-lTCCTGGACACGCTGGT-3' 5'-CAAAlTCTCAGATCATCA-3' 2F 1108R For first PCR For second PCR 83 Exon 28 For first PCR For second PCR Exon 2C For first PCR 216 For second PCR (FigIA, lane 6), 25 (Fig l A, lane 3), and 26 (Fig IA, lane 2). We found no significant increase or decrease in radioactivity of the band reflecting the MTS2 gene in any specimens, and no rearranged band was shown in any of the patients. Thus, we detected three homozygous deletions in patients with B-NHL (3 of 42, 7.l%), and no deletions in patients with B-CLL. Analysis of the CDKN2 gene by the PCR-SSCP method. To determine whether CDKN2 mutations were present in primary B-cell lymphomas, PCR-SSCP analysis was performedusing the same specimens as those examined by Southern blotting of all 52 CLLNHL patients. In 5 of 42 patients with B-NHL, we detected band shifts. These changes were also confirmed under other electrophoresis D V V V conditions (data not shown). Three such aberrantly migrating bands were found by analysis of the CDKN2-exon 2A fragment (patient 3, 12, and 14) and one was found by analysis of the CDKN2-exon 2C fragment (patient 41). We also found aberrantly migrating bands in one patient (patient 2) by analysis of exon I fragment. But, we found no aberrantly migrating bands by analysis of theCDKN2-exon 2B fragment. Figure 2 shows part of the results of PCR-SSCP analysis using the primer sets for the exon 1 and the CDKN2-exon 2A fragment. Two aberrantly migrating bands with no normally migrating bands were detected in patient 3 (Fig 2B, lane 9). Aberrantly migrating bands with residual normally migrating bands were found in patient 2 (Fig 2A, lane 7). patient 12 (Fig 2B, lane 3), patient 14 (Fig 2B, lane 13), and patient C D V c-myb C --- 23.1 kb 9.4kb 6.6 kb 4.4 kb 2.3 kb 2.0 kb l 2 3 4 5 6 7 8 9 1 01 2 3 4 5 6 7 8 A B Fig 1. Southern blot analysis of the CDKNUMTSl and MTS2 genes. The CDKNWMTSl and MTS2 genes were detected as two bands of approximately 4.2 and 6.0-kb, respectively, in EcoRI-digested DNA. The positions of molecular weight markers electrophoresed in parallel and one of EcoRl fragments recognized by c-myb cDNA probe are also shown. D, samples from cell lines showinghomozygous deletion of the CDKNZ gene; C, splenic B cell as a normal control. (A)Lane 1, MOLT4; lanes 2 through 9, patient samples; lane 10, splenic B cells as a normal control. Lanes 2, 3, and 6 show homozygous deletions of theCDKNZ/MTSl gene without deletions of the MTS2 gene in patients 26,25, and 7, respectively (V).(B) Lane 1, Jurkat; lanes 2 through 7, patient samples; lane 8, splenic B cells. Lane 6 shows possible monoallelic loss of the CDKN2/MTS1 gene in patient 3 ( W . From www.bloodjournal.org by guest on January 20, 2015. For personal use only. MUTATIONAL ANALYSIS OF THE CDKNZ (MTS7/p76'NKa)GENE v 2727 v v v v B A l 2 3 4 5 6 7 8 9 1 0 1 2 3 4 59876 CDKNZ-exon 1 10 11121314151617181920 CDKNZ-exon 2A Fig 2. PCR-SSCP analysis of the CDKN2gene in B-NHL. Mobility shift pattern of DNA fragments amplifiedby theprimer sets of exon 1 and CDKfV2-exon 2A are shown. (A) Lane 7 shows an aberrantly migrating fragmentin addition t o wild-type fragments in patient 2 W ) . (B) Lane 3 shows an aberrantly migrating fragment in addition t o wild-type fragments in patient 12 (V).Lane 9 shows aberrantly migrating fragments with no bands corresponding t o wild-type fragments in patient 3 (V).Lane 13 shows four bands of wild-type and aberrantly migrating fragments in patient 14 (V).Lanes 15 and 17 show the absence of bands in patients 25 and 7, respectively (V), as the result of failure of PCR amplification due t o homozygous deletions of theCDKNZ gene. 41 (data not shown). No bands were detected by analysis of any of these fragments in patients 7 (Fig 2B, lane 15), 25 (Fig 2B, lane 17), or 26 (data not shown). Analysis of other samples of patient 3 containing normal tissue showed predominantly normal pattern (Fig 3A). To determine the sensitivity of our PCR-SSCP assay for mobility shift, we also performed a mixing experiment (Fig 3B). We performed PCR-SSCP assay using both mutated sample (patient 3). which showed only aberrantly migrating bands and control sample. As a result, we could detect positive aberrant bands when 5% of mutated sample was mixed with control sample. Nucleotide sequence analysis of the CDKN2 gene. Nucleotide sequences of the CDKN2 gene in patients with mobility shifts on PCR-SSCP analysis were determined by direct DNA sequencing. Six nucleotide changes were identitied by direct sequencing in five patients with B-NHL. One B A Fig 3. PCR-SSCP analysis of the CDKNZ gene in patient 3. (A) Lymph nodesample (LN) showed only aberrantly migrating band without normally migrating band. Mononuclear cells of bone marrow (BM) andperipheralblood (PB) showedpredominantly normal pattern. Because a small number of tumor cells were involved in BM and PB, mobility shifts were also detected. (B) Sensitivity of PCR-SSCP method. Detection of only5% mutated sample was possible. r z Patient 3 Blotting From www.bloodjournal.org by guest on January 20, 2015. For personal use only. 2728 UCHIDA ET AL Table 3. Results of Analysis of the C D K W Gene in B-NHL - Nucleotide Sequence of Mutated Allele No. Southern Codon PCA-SSCP 2 ti+ MM Patient Nucleotide 3-t GAGCC-. Change' . . . . CGGGGTCGG L GAGCCIGTCGG (35-bp deletion) ACCCGACCC-ACCC&4CCC CS Histopathology NI* FL IV FSC IV DL DL --t 3 7 14 25 26 +i- -1+I+ -1- -1- MI- -1MM -1-1- 72 (Arg) - 49- t - - (GM AGCGCCCGAGTGGCGGAGCT --t AGCIAGCT (13-bp deletion) 111 - II* - 1 l DM DL Abbreviations: +I+, n o deletion; +I-, hemizygous deletion; -I-, homozygous deletion; M, mutated allele; W, wild-type allele; CS, clinical stage at presentation; FL, follicular large; FSC. follicular small cleaved; DL, diffuse large; DM, diffuse mixed. Italic and bold type with underline indicates mutatedsites. t First codon of deletion. Sample at relapse was used in this study. * nucleotide change in exon 1 and three nucleotide changes in exon 2 were found individually in four patients, and two base changes in intron 1 were found in one patient. Three of these six nucleotide changes led to amino acid changes (Table 3). One frameshift caused by a 35-bp deletion arising at codon 3 (nucleotides 27 to 61) was detected in patient 2, which introduced a translational stop codon at codon 23 of exon l (nucleotide numbering system is as described by Serrano et a14). In exon 2, one missense mutation at codon 72 (CGA to CAA, nucleotide 233, Arg to Gln) was detected in patient 3, and one frameshift caused by a 13-bp deletion arising at codon 49 (nucleotides 163 to 175) was detected in patient 14, which introduced a translational stop codon at codon 133. Figure 4 shows the results of direct sequence analysis of the CDKN2 gene around these mutations in these three patients. Two base changes in intron 1 (G to A, and G to T substitutions at 4th and 14th nucleotides 5' of the intron l-exon 2 splice junction, respectively) were detected in patient 12, and a silent base change at codon 127 (GGG to GGA, nucleotide 399, Gln to Gln) was detected in patient 41. In patients showing normally migrating bands, nucleotide sequences corresponded with those of the CDKN2 gene reported previ~usly.~ We confirmed three mutations among 42 patients with B-NHL (7.1%) and no mutations in patients with CLL by PCR-SSCP analysis and direct sequencing. DISCUSSION Tumor-suppressor genes are inactivated by alterations in the properties of the gene product (qualitative changes) or in a decrease or complete loss of gene products (quantitative changes). Mutations or gene rearrangements within the coding region can induce qualitative changes, whereas downregulation caused by other genes or homozygous deletion can lead to quantitative changes. Most tumor-suppressor genes frequently involved in human cancers, for example p53 or RB genes, are known to be inactivated by mutation^^^'^' whereas the CDKN2 alterations seem to frequently involve quantitative, rather than qualitative, changes. Previous re- ports showed the frequent occurrence of homozygous deletions of this We performed Southern blotting to detect mainly quantitative changes and PCR-SSCP analysis to detect qualitative changes in this study. As a result, we could detect both qualitative and quantitative changes of the CDKN2 gene in B-NHL,. Six patients (14.3%) with B-NHL showed alterations of this gene. Three of these patients showed CDKN2 homozygous deletions (7.1%). This frequency was similar to previous reports.30344 The remaining three of these patients showed mutations in the CDKN2 gene (7.1%), one missense mutation and two frameshifts caused by a small deletion. Published studies in hematologic malignancies have shown frequent homozygous deletions of the CDKN2 gene. However, with regard to point mutation, to our knowledge, only one missense mutation has been reported in a patient with B-precursor ALL.30In the present study, we found three mutations in B-NHL. First, we identified a missense mutation at codon 72, which is a hotspot for CDKN2 m~tation,'~.~' in patient 3. It was suggested that this nucleotide change was not a polymorphism because PCR-SSCP analysis used normal tissue samples of this patient and showed normal pattern (Fig 3A). In addition, this patient showed a possible hemizygous deletion because of the low phosphostimulated luminescence intensity of the bandreflecting the CDKN2 gene by laser image analysis (Fig l B , lane 6). These results suggested that the CDKN2 gene inactivated by not only a quantitative change, but also a qualitative change, and its inactivation contributes to tumorigenesis of B-cell malignancies. Second, we showed other mutation in patient 14. Direct sequencing of the DNA from the abnormally migrating band confirmed a frameshift due to a 13-bp deletion. The first codon of this deletion was the same codon at which a m i s sense mutation was reported in B-ALL.30 As the fragment amplified by the CDKN2-exon 2B and exon 2C primer set showed a normal mobility pattern on PCR-SSCP analysis, this frameshift may cause alteration of the normal 148 amino acid p16 protein to a 133 amino acid truncated variant. Third, From www.bloodjournal.org by guest on January 20, 2015. For personal use only. MUTATIONAL ANALYSIS OF THE CDKNZ ( I V T S I / ~ ~ ~GENE ’~‘(~~) 2729 A A T “. C G A -- G C T G A C T G C A C G G C I C C G G G d T C G G G T A I 35 bp deletion Patient 2 G B T C G T A C T C A C . .-. . .L .. C C G A C C I” C G C C C A A C C C Fig 4. Nucleotide sequencing of samples showing theCDKNZ gene mutations in B-NHL. Bold type indicates the nucleotides of mutation sites. (A) The nucleotide sequence of patient 2 shows a 35-bp deletion arising at codon 2 IGAGCCTCG CGGGGTCGG to GAGCCIGTCGG, nucleotide 27 t o 61, open arrow). (B) The nucleotide sequence of patient 3 shows a point mutation atcodon 72 (CGA t o CAA Arg t o Gln, nucleotide 233, closed a r r o q . IC) T r e nucleotide sequence of patient 14 shows a 13bp deletion arising at codon 49 IAGCGCCCGAGTGGCGGAGCT t o AGCIAGCT, nucleotide 163 t o 175, open arrow). T C G A V b. T G G Patient 3 A , T C - G A c- G C E\ C : ... although mutations in exon 1 are rare, we also found a mutation in exon 1 in patient 2. A 35-bp deletion led a frameshift, which led stop codon at codon 23, and may alter p16 protein to a small protein. We could not confirm hemizygous deletion in these two patients by Southern blot analysis (Fig 1 B, lanes 5 and 7). Two alternative explanations for the findings in these patients are possible. One is that hemizygous deletion in tumor cells ismasked by contamination with the normal component in this lymph node sample. This possibility implies CDKN2 inactivation because one allele of tumor G G T Wild-type C C C T C A G A G C Wild-type T I \: d C A G C T Patient 14 cells is deleted and the other allele has a small deletion. The other possibility is that tumor cells have an abnormal allele with a small deletion and another allele. If a small alteration exists in the other allele, which cannot be detected by Southern blotting and PCR-SSCP analysis, the latter possibility also implies that the CDKN2 gene is inactivated as a result of alterations in both alleles. As the existence of two major proliferation control pathways by p16 and p15 have been ~uggested,’.~deletions of both of these genes, rather than loss of only one gene, may From www.bloodjournal.org by guest on January 20, 2015. For personal use only. 2730 UCHIDA ET AL induce tumorigenesis. Previous reports that the majority of homozygous deletions in many kinds of cell lines removed both the CDKN2/MTSl and MTS2 gened3 confirmed this hypothesis. However, we could show no gross alterations of the MTS2 gene by Southern blotting. Recently, it was reported that two of three patients with B-cell type ALL showing CDKN2MTSI deletion did notshow MTS2 deletion, similar to our results, whereas in contrast most patients with T-cell type ALL showed homozygous deletions of both these genes.3’ These results suggest that the CDKN2/MTSl alteration frequently does not involve the MTS2 gene in B-cell lineage lymphoid malignancies, although we and previous investigators did not yet analyze the MTS2 gene to detect mutations. As we also found a small deletion in two patients in this study, the deleted region containing the CDKN2 gene in B-cell malignancies may be smaller than that in T-cell malignancies. CDKN2 alterations may be more important in the tumorigenesis of B-cell lymphomas than the MTS2 alterations. Although a relationship between p53 mutations and disease progression was reported in B-cell lymphoma,4’ we did notfind a definite relationship between the CDKN2 alterations and patients’ profiles (Table 3 ) . Patients 7 and 14 had lymphomas that were highly aggressive and resistant to chemotherapy. Patients 25 and 26 had early stage lymphomas at presentation, but soon relapsed. In contrast, patient 3 has enjoyed long survival despite advanced stage at presentation. Recently, the appearance of possible allelic loss at relapse was reported in B-ALL.22However, no significant differences in outcome were observed between patients with and without homozygous deletions of the CDKN2 gene in ALL.3oItis still unclear whether the CDKN2 alterations contribute to disease progression of hematologic malignancies. In conclusion, we detected alterations in the CDKN2 gene in some patients with B-NHL in this study and confirmed the contribution of this gene to tumorigenesis of B-NHL. However, we found no significant relationship between CDKN2 alteration and disease progression. Recently, it has been suggested that decreased CDKN2 expression may arise in nasopharyngeal carcinoma cell lines without point mutat i ~ nTo . ~clarify ~ the characteristics of the CDKN2 alterations in hematologic malignancies, in particular lymphoid malignancies, detailed investigations of the CDKN2 gene, including RNA/protein expressions, in a large number of patients and at different clinical stages in the same patient are necessary. ACKNOWLEDGMENT We thank Drs A. Ichikawa (Gifu Tajimi Prefecture Hospital) and Y. Morishita (Showa Hospital) for allowing us to examine and for providing information about their patients with NHL or CLL. We also thank Dr H. Nagai (Jefferson Cancer Institute). REFERENCES 1. Sherr CJ: Mammalian G1 cyclins. Cell 73:1059, 1993 2. Peter M, Herskowitz I: Joining the complex: Cyclin-dependent kinase inhibitory proteins and cell cycle. Cell 79:181, 1994 3. Hannon GJ, Beach D: ~ 1 5 is” a potential ~ ~ ~ effector of TGFP-induced cell cycle arrest. Nature 371:257, 1994 4. Serrano M, Hannon GJ, Beach D: A new regulatory motif in cell-cycle control causing specific inhibition of cyclin DICDK4. Nature 366:704, 1993 5. Guan KL, Jenkins CW, Li Y, Nichols MA, Wu X, O’Keefe CL, Matenv AG, Xiong Y: Growth suppression by p18, a p161NK4A/MTS1- and p141NK4B/MTS2-related CDK6 inhibitor, correlates with wild-type pRb function. Genes Dev 8:2939, 1994 6. Harper J W , Adami GR, Wei N, Keyomarsi K, Elledge SJ: The p21 Cdk-interacting protein Cipl is a potent inhibitor of G1 cyclindependent kinases. Cell 755305, 1993 7. El-Deiry WS, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM, Lin D, Mercer E, Kinzler KW, Vogelstein B: Wafl, a potential mediator of p53 tumor suppression. Cell 75:817, 1993 8. Xiong Y, Hannon GJ, Zhang H, Casso D, Kobayashi R, Beach D: p21is a universal inhibitor of cyclin kinases. Nature 366:701, I993 9. Polyak K, Lee MH, Erdjument-Bromage H, Koff A, Roberts ’ JM, Tempst P, Massague J: Cloning of ~ 2 7 “ a~ cyclin-dependent kinase inhibitor and a potential mediator of extracellular antimitogenic signals. Cell 7859, 1994 IO. Toyoshima H, Hunter T: p27, a novel inhibitor of G1 cyclinCdk protein kinase activity, is related to p21. Cell 78:67, 1994 I I . Matsushime H, Ewen ME, Strom DK, Kat0 JY, Hanks SK, Roussel MF, Sherr CJ: Identification and properties of atypical catalytic subunit (p34PSK”3/cdk4) from mammalian D type G1 cyclins. Cell 71:323, 1992 12. Meyerson M, Harlow E: Identification of G1 hnase activity for cdk6, a novel cyclin D partner. Mol Cell Bioi 14:2077, 1994 13. KambA, Gruis NA, Weaver-Feldhaus J, Liu Q, Harshman K, Tavtigian SV, Stockert E, Day RS 111, Johnson BE, Skolnick MH: A cell cycle regulator potentially involved in genesis of many tumor types. Science 264:436, 1994 14. Fountain JW, Karayiogou M, Emstoff MS, Kirkwood JM, Vlock DR, Titus-Emstoff L, Bouchard B, Vijayasaradhi S, Houghton AN, Lahti J, Kidd VJ, Housman DE, Dracopoli NC: Homozygous deletions within human chromosome band 9p21 in melanoma. Proc Natl Acad Sci USA 89:10557, 1992 15. Olopade 01, Jenkins RB, Ransom DT, Malik K, Pomykala H, Nobori T, Cowan JM, Rowley JD, Dim MO: Molecular analysis of deletion of short arm of chromosome 9 in humangliomas. Cancer Res 52:2523, 1992 16. Olopade 01, Buchhagen DL, Malik K, Sherman J, Nobori T, Bader S, Nau MM, Gazder AF, Minna JD, Dim MO: Homozygous loss of the interferon gene defines the critical region on 9p that is deleted in lung cancer. Cancer Res 53:2410, 1993 17. Chilcote RR, Brown E, Rowley JD: Lymphoblastic leukemia with lymphomatous features associated with abnormalities of the short arm of chromosome 9. N Engl J Med 313:286, 1985 18. Nobori T, Miura K, Wu DJ, Lois A, Takabayashi K, Carson DA: Deletions of the cyclin-dependent kinase-4 inhibitor gene in multiple human cancers. Nature 368:753, 1994 19. Shiohara M, El-Deiry WS, Wada M, Nakamaki T, Takeuchi S, Yang R, Chen DL, Vogelstein B, Koeffler HP: Absence of WAF1 mutations in a variety of human malignancies. Blood 84:3781, 1994 20. Mori T, Miura K, Aoki T, Nishihara T, Mori S, Nakamura Y: Frequent somatic mutation of the MTSKDK4I (multiple tumor suppressor/cyclin-dependentkinase 4 inhibitor) gene in esophageal squamous cell carcinoma. Cancer Res 54:3396, 1994 21. Caldas C, Hahn SA, Costa LT, Redston MS, Schutte M, Seymour AB, Weinstein CL, Hruban RH, Yeo CJ, Kern SE: Frequent somatic mutations and homozygous deletions of the p16 (MTSI) genein pancreatic adenocarcinoma. Nature Genet 8:27, 1994 22. Hebert J, Cayuela JM, Berkeley J, Sigaux F: Candidate tumorsuppressor genes MTSI ( ~ 1 6 ’ and ~ ~MTS2 ~ ~ )( ~ 1 5 ~ display ~ ~ ” ) From www.bloodjournal.org by guest on January 20, 2015. For personal use only. MUTATIONAL ANALYSIS OF THE CDKNZ (MTS7/p76‘NKa)GENE frequent homozygous deletions in primary cells from T- but not from B-cell lineage acute lymphoblastic leukemias. Blood 84:4038, 1994 23. Carins P, Mao L, Merlo A, Lee DJ, Schwab D, Eby Y, Tokino K,van der Riet P, Blaugrund JE, Sidransky D, Kamb A, Liu Q, Harshman K, Tavtigian S, Cordon-Cardo C, Skolnick MH: Rates of p16 (MTSI) mutations in primary tumors with 9p loss. Science 265:415, 1994 24. Ogawa S, Hirano N, Sato N, Takahashi T, Hangaishi A, TanakaK, Kurokawa M, Tanaka T, Mitani K, Yazaki Y, Hirai H: Homozygous loss of the cyclin-dependent kinase 4-inhibitor (p16) gene in human leukemias. Blood 84:2431, 1994 25. Spruck CH 111, Gonzales-Zulueta M, Shibata A, Simoneau AR, Lin MF, Gonzales F, Tsai YC, Jones PA: p16 gene in uncultured tumors. Nature 370:183, 1994 26. Zhang SY, Klein-Szanto AJP, Sauter ER, Shafarenko M, Mitsunaga S, Nobori T, Carson DA, Ridge JA, Goodrow TL: Higher frequency of alterations in the p16/CDKN2 gene in squamous cell carcinoma cell lines than in primary tumors of head andneck. Cancer Res 54:5050, 1994 27. Cheng JQ, Jhanwar SC, Klein WM, Bell DW, Lee WC, Altomare DA, Nobori T, Olopade 01, Bucker AJ, Testa JR: p16 alterations and deletion mapping of 9p21-p22 in malignant mesothelioma. Cancer Res 545547, 1994 28. Ohta M, Nagai H, Shimizu M, Rasio D, Berd D, Mastrangelo M, Singh AD, Shields JA, Shields CL, Croce CM, Huebner K: Rarity of somatic and germline mutations of the cyclin-dependent kinase 4 inhibitor gene, CDK41, in melanoma. Cancer Res 545269, 1994 29. Xu L, Sgroi D, Sterner CJ, Beauchamp RL, Pinney DM, Keel S, Ueki K, Rutter JL, Buckler AJ, Louis DN, Gusella JF, Ramesh V: Mutational analysis of CDKN2 ( M T S I / P I ~ ’in ~ ~human ~ ) breast carcinomas. Cancer Res 545262, 1994 30. Quesnel B, Preudhomme C, Philippe N, Vanrumbeke M, Dervite I, Lai JL, Bauters F, Wattel E, Fenaux P: p16 gene homozygous deletions in acute lymphoblastic leukemia. Blood 85:657, 1995 31. Cayuela JM, Hebert J, Sigaux F: Homozygous MTSl (p16INK4*) deletion in primary tumor cells of 163 leukemic patients. Blood 85354, 1995 (letter) 32. Binet JL, Catovsky D, Dighiero G, Gale RP, Montserrat E, Rai KR: Chronic lymphocytic leukemia: Recommendations for diagnosis, staging, and response criteria. Ann Intern Med 110:236, 1989 33. Binet JL, Catovsky D, Chandra P, Dighiero G, Montserrat E, Rai KR, Sawitsky A: Chronic lymphocytic leukaemia: Proposals for a revised prognostic staging system. Br J Haematol 43:365, 1981 2731 34. Nathwani BN, Winberg CD: Non-Hodgkin’s lymphomas: An appraisal of the “Working Formulation” of non-Hodgkin’s lymphomas for clinical usage, in Sommers SC, Rosen PP (eds): Malignant Lymphomas: A Pathology Annual Monograph. Norwalk, CT, Appleton-Century-Crofts, 1983, p 1 35. Ohashi H, Ichikawa A, Takagi N, Hotta T, Naoe T, Ohno R, Saito H: Remission induction of acute promyelocytic leukemia by all-trans-retinoic acid: Molecular evidence of restoration of normal hematopoesis after differentiation and subsequent extinction of leukemic clone. Leukemia 6:859, 1992 36. Majello B. Kenyon LC, Dalla-Favera R: Human c-myb protooncogene: Nucleotide sequence of cDNA and organization of the genomic locus. Proc Natl Acad Sci USA 83:9636, 1986 37. Amemiya Y, and Miyahara J: Imaging plate illuminates many fields. Nature 336239, 1988 38. Watanabe T, Hotta T, Ichikawa A, Kinishita T. Nagai H, Uchida T, Murate T, Saito H: The MDM2 oncogene overexpression in chronic lymphocytic leukemia and low-grade lymphoma of Bcell origin. Blood 84:3158, 1994 39. Saiki RK, Gelfand DH, Stoffel S, Scraf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA: Primer-directed enzymatic amplification ofDNAwith a thermostable DNA polymerase. Science 239:487, 1988 40. Orita M, Suzuki Y, Sekiya T, Hayashi K: Rapid and sensitive detection of point mutations andDNA polymorphisms using the polymerase chain reaction. Genomics 5:874, 1989 41. Suzuki Y, Sekiya T, Hayashi K: Alle-specific PCR: A method for amplification and sequence determination of a single component among a mixture of sequence variants. Anal Biochem 192:82, 1990 42. Weinberg RA: Tumor suppressor gene. Science 2S4:I 138, 1991 43. Hollstein M, Sidransky D, Vogelstein B, Hams CC: p53 mutations in human cancers. Science 253:49, 1991 44. Stranks G, Height SE, Mitchell P, Jadayel D, Yuille MAR, De Lord C, Clutterbuck RD. Treleaven JG, Powles RL, Nacheva E, Oscier DG, Karpas A, Lenoir GM, Smith SD, Millar JL, Catovsky D, Dyer MJS: Deletions and rearrangement of CDKN2 in lymphoid malignancy. Blood 85:893, 1995 45. Ichikawa A, Hotta T, Takagi N. Tsushita K, Kinoshita T, Nagai H, Murakami Y, Hayashi K, Saito H: Mutations of p53 gene and their relation to disease progression in B-cell lymphoma. Blood 79:2701, 1992 46. Sun Y, Hildesheim A, Lanier AEP, Cao Y, Yao KT, RaabTraub N, Yang CS: No point mutation but decreased expression of p 16/MTS1 tumor suppressor gene in nasopharyngeal carcinomas. Oncogene 10:785, 1995 From www.bloodjournal.org by guest on January 20, 2015. For personal use only. 1995 86: 2724-2731 Mutational analysis of the CDKN2 (MTS1/p16ink4A) gene in primary B-cell lymphomas T Uchida, T Watanabe, T Kinoshita, T Murate, H Saito and T Hotta Updated information and services can be found at: http://www.bloodjournal.org/content/86/7/2724.full.html Articles on similar topics can be found in the following Blood collections Information about reproducing this article in parts or in its entirety may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests Information about ordering reprints may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#reprints Information about subscriptions and ASH membership may be found online at: http://www.bloodjournal.org/site/subscriptions/index.xhtml Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036. Copyright 2011 by The American Society of Hematology; all rights reserved.
© Copyright 2026 ExpyDoc