BOR Papers in Press. Published on December 29, 2014 as DOI:10.1095/biolreprod.114.124487 The expression of cysteine‐rich secretory protein 2 (CRISP2) and its specific regulator miR‐27b in the spermatozoa of patients with asthenozoospermia1 Jun‐Hao Zhou,4,5 Qi‐Zhao Zhou,4,5 Xiao‐Ming Lyu,4,6,7 Ting Zhu,7 Zi‐Jian Chen,5 Ming‐Kun Chen,5 Hui Xia,5 Chun‐Yan Wang,8 Tao Qi,8 Xin Li,3,5,7 and Cun‐Dong Liu2,5 5 Department of Urology, The Third Affiliated Hospital of Southern Medical University, Guangzhou, Guangdong, China 6 Medical Laboratory Centre, The Third Affiliated Hospital of Southern Medical University, Guangzhou, Guangdong, China 7 Cancer Research Institute, Southern Medical University, Guangzhou, Guangdong, China 8 Department of Laboratory Medicine, Nanfang Hospital, Southern Medical University, Guangzhou, Guangdong, China 1 Supported by the Guangdong Provincial Natural Science Foundation of China (No. S2012010009126), and Guangdong Provincial Science and Technology Program (No. 2013B021800317). 2 Correspondence: Cundong Liu, Department of Urology, The Third Affiliated Hospital of Southern Medical University, Guangzhou, 510630. E‐mail: [email protected] 3 Correspondence:Xin Li, Department of Urology, The Third Affiliated Hospital of Southern Medical University, Guangzhou, 510630, China or Cancer Research Institute, Southern Medical University, Guangzhou, 510515, Guangdong, China. E‐mail: [email protected] 4 These authors contributed equally to this work. Running head: MiR‐27b & CRISP2 in asthenozoospermia Summary: MiR‐27b contributes to the reduction of CRISP2 protein in asthenozoospermia. Both high miR‐27b expression and low CRISP2 protein expression were significantly associated with low sperm progressive motility, abnormal morphology, and infertility. ABSTRACT Cysteine‐rich secretory protein 2 (CRISP2) is an important sperm protein and plays roles in spermatogenesis, modulating the flagellar motility, acrosome reaction and gamete fusion. Clinical evidence shows a reduced CRISP2 expression in spermatozoa from asthenozoospermic patients, but the molecular mechanism underlying its reduction remains unknown. Herein, we carried out a study focusing on the CRISP2 reduction and its roles in asthenozoospermia. Initially, through analyzing CRISP2 expression and methylation on CRISP2 promoter activity in sperm, we observed a decreased expression of CRISP2 protein rather than its mRNA in the ejaculated spermatozoa from asthenozoospermic patients and no methylation in CRISP2 promoter, suggesting CRISP2 expression may be regulated in sperm at the post‐transcriptional level. Subsequently, we found that microRNA 27b (miR‐27b), predicted as a candidate regulator of CRISP2 using bioinformatics, was highly expressed in the ejaculated spermatozoa from asthenozoospermic patients. Luciferase reporter assay and transfection experiments disclosed Copyright 2014 by The Society for the Study of Reproduction. that this miRNA could target CRISP2 by specifically binding its 3’‐UTR and suppressed CRISP2 expression. The extended clinical observation further confirmed a highly expressed miR‐27b and its obviously negative correlation with CRISP2 protein expression in ejaculated spermatozoa samples from asthenozoospermic patients. Finally, we conducted a retrospective follow‐up study to support that either high miR‐27b expression or low CRISP2 protein expression was significantly associated with low sperm progressive motility, abnormal morphology and infertility. Thus, this study provide the first preliminary insight into the mechanism leading to the reduced CRISP2 expression in asthenozoospermia, offering a potential therapeutic target for treating male infertility or for male contraception. Keywords: Cysteine‐rich secretory protein 2 (CRISP2), asthenozoospermia, miR‐27b, male infertility INTRODUCTION Infertility is becoming a global health problem affecting 15% of couples worldwide [1, 2]. Male infertility is responsible for 50% of these couples’ inability to conceive. Acquired and congenital sperm abnormalities are a critical factor in male infertility [3]. Asthenozoospermia is the most common sperm quality abnormality [3] and one of major causes of male infertility [4]. It is defined as less than 32% of progressive motility (PR) spermatozoa according to the World Health Organization (WHO) guidelines (5th Ed.) [5]. The etiology and pathophysiology of asthenozoospermia seem complicated and multifactorial. Many hypothetical etiologies have been put forward, such as congenital or acquired urogenital abnormalities, endocrine disturbances, increased scrotal temperature (varicocele), urogenital infection, testicular injury or pathology, and antisperm antibodies or genetic abnormalities [6‐10], but the exact causal factors underlying asthenozoospermia still remain largely unknown [11]. Recently, several studies have paid attention to the molecular mechanism of asthenozoospermia. Some differentially expressed genes including Tekt2 (tektin‐t) [12], DNAI1, DNAH5, DNAH11 [13], Akap4 [14], Sept4 [15] and CRISP2 (cysteine‐rich secretory protein 2, previously known as TPX1) are supposedly related to asthenozoospermia. CRISP2, as a member of the CAP cysteine‐rich secretory proteins (CRISPS), antigen 5 (Ag5), and pathogenesis‐related 1 (Pr‐1) super‐family of proteins [16], arouses broader interests because it is the only CRISP family member expressed within the testis [17, 18] in an androgen‐independent manner [19], and eventually located at sperm acrosome and the outer dense fibres of sperm tail [20‐24]. Functionally, this protein has been reported to be a regulator of calcium influx through ryanodine receptors [25], which modulates the abilities of sperm flagellar motility [26, 27]. It can be also released from the acrosomal vesicle for the subsequent acrosome reaction or the re‐association with the equatorial segment of acrosome‐reacted human sperm [28], involving in sperm‐egg fusion [29]. In particular, a recent gene expression profiling study discloses a close association between CRISP2 and human spermatogenesis and infertility [30]. This protein is evidently down‐expressed in the ejaculated spermatozoa of patients with asthenozoospermia [31, 32]. Decreased CRISP2 expression in the ejaculated spermatozoa is correlated with low pregnancy rate in cattle [33]. These previous results suggest that CRISP2 plays roles in asthenozoospermia. Therefore, the molecular mechanism underlying CRISP2 down‐expression in asthenozoospermia deserves investigation. Gene expression is often regulated by either genetic or epigenetic mechanisms [34]. DNA methylation and microRNA (miRNA) regulation are two major epigenetic regulatory mechanisms involved in multiple biological processes [35, 36]. Some studies reveal that abnormal sperm DNA methylation patterns are able to be associated with the reduced sperm count and function [37‐41] and others report that miRNA‐mediated gene control plays a role in the maintenance of undifferentiated state or the induction of differentiation of spermatogonia [42‐45]. Expression profiling studies have identified a number of miRNAs that are enriched in the mammalian testis [46, 47], mouse male germ cells (including spermatogonia, pachytene spermatocytes, spermatids, and spermatozoa) [48], and human ejaculated spermatozoa [49], suggesting that miRNAs are more likely involved in modulating various stages of spermatogenesis [50, 51]. However, it is still unclear whether these two epigenetic mechanisms are involved in the down‐expression of CRISP2 in asthenozoospermia. In the present study, we analyzed CRISP2 expression, methylation status of CRISP2 promoter, and microRNA 27b (miR‐27b) expression in the ejaculated spermatozoa from patients with asthenozoospermia, and further investigated the regulatory effects of miR‐27b on the CRISP2 down‐expression in asthenozoospermia. This may provide a novel insight into a portion of mechanism underling asthenozoospermia. MATERIALS AND METHODS Ethics Statement The present study was approved by the bioethics committees of Nanfang Hospital and The Third Affiliated Hospital of Southern Medical University, Guangzhou, China. The written informed consent was signed by study subjects. The experimental protocol was established according to the associated national guidelines from Ministry of Science and Technology of China. Subjects and semen samples Totally 90 study subjects including 48 asthenozoospermic patients and 42 normozoospermic volunteers were enrolled in the study in Department of Laboratory Medicine of Nanfang Hospital, Southern Medical University from January 2013 to June 2013, after excluding those with varicocele, teratozoospermia and leukocytospermia. Additional exclusion criterions included abnormal semen liquefaction, reproduction tract infection, testicular injury or pathology, history of cryptorchidism, orchitis or epididymitis and some systemic diseases (diabetes mellitus, hypertension, hypercholesterolaemia and hypoandrogenism). Each patient with asthenozoospermia was confirmed by the routine semen analysis of his three ejaculated semen samples collected at different time points. All volunteers were also proven to have normal semen parameters. The routine semen analysis conducted on SCA (Sperm Class Analyzer, MicroPtic, Spain) covered such factors as the liquefaction time, volume, pH, viscosity, agglutination, motility, viability, density, and morphology of sperm. Then semen samples were stained using Diff‐Quik staining for evaluating sperm morphology. All semen samples were collected from study subjects by masturbation after 3 days of sexual abstinence, and then allowed to liquefy at 37°C for 30 minutes. Liquefied semen samples were loaded on to 50% discontinuous Percoll gradient (Pharmacia, USA) and centrifuged at 2000g for 15 minutes at room temperature [52, 53]. The spermatozoa pellet was washed twice with phosphate buffered saline (PBS), and stored at ‐80°C for use. From 90 semen samples, 48 semen samples (derived from 24 asthenozoospermic patients and 24 normal volunteers) were randomly selected for preliminarily detecting the expression levels of six candidate miRNAs. Additionally, 24 semen samples (from 12 asthenozoospermic patients and 12 normal volunteers) were randomly selected for detecting both miR‐27b and CRISP2 protein expression levels, which were further used for evaluating the correlation of miR‐27b with CRISP2 protein expression, and the clinical correlations of their expression levels with sperm progressive motility, normal morphology and infertility. Prediction of CpG islands CpG islands in CRISP2 promoter region were predicted by Methyl Primer Express software (version 1.0). A CpG island was defined as a DNA fragment with a length of at least 300 base pairs (bp), a GC content of more than 55 %, and a ratio of more than 0.65 between the observed and the expected CpGs. DNA extraction and sodium bisulfite modification of genomic DNA Genome DNA was extracted from semen samples using Sperm DNA Purification Kit (Simgen, Hangzhou, China), and then treated with sodium bisulfite modification by DNA Modification Kit (CWBio, Beijing, China) to transform unmethylated cytosines into uridines and keep methylated cytosines unchanged. The modified DNA samples were stored at −20°C for further use. All procedures were performed according to the manufacturer’s recommendations. Methylation‐specific PCR The methylation of CpG islands in CRISP2 promoter region was detected by methylation‐specific polymerase chain reaction (MSP) as in previous studies[54]. The PCR conditions and procedures included predenaturation at 95°C for 1 minute, denaturtion for 35 cycles, (each cycle including denatution at 95°C for 10 seconds, 60 °C for 30 seconds and 72°C for 30 seconds), and an extension at 72 °C for 10 minutes. The expected PCR product at the size of 139 bp was separated on 2% agarose gels with ethidium bromide, and then visualized under ultraviolet light. When a sample was amplified only by M‐primers or U‐primers, it was defined as full methylation or full unmethylation and if a sample was amplified by both M‐primers and U‐primers, it was considered as partial methylation [55]. Bisulfite‐sequencing PCR The methylation status of CpG island of CRISP2 in spermatozoa samples was also detected by bisulfite‐sequencing polymerase chain reaction (BSP) as described previously [56]. The PCR conditions and procedures were consistent with those in our previous descriptions. The expected PCR product size was 262 bp. The PCR products were electrophoresed on 2% agarose gels visualized under ultraviolet light, and then sent to Life Technologies Company for sequencing. The primers used for detecting DNA methylation and CRISP2 gene were shown in Supplemental Table S1 (Supplemental Data are available online at www.biolreprod.org). Extraction of total RNA from semen samples Total RNA, including miRNAs, was extracted from each spermatozoa pellet using TRIzol reagent (Invitrogen, Carlsbad, USA) in line with the manufacture’s instruction. The quantity and quality of extracted RNA were measured by E‐Spect (Malcon, Japan). Reverse Transcription and Quantitative Real‐Time PCR 200 ng of total RNA was reverse‐transcribed respectively by PrimerScriptTM RT Kit (TaKaRa) for mRNA and by SYBR PrimeScript miRNA RT‐PCR Kit (TaKaRa) for miRNA. The quantitative Real‐Time PCR for mRNA was performed in a 96‐well plate format using SYBR Premix Ex Taq Real Time PCR Kit (TaKaRa). Amplification reactions were carried out in a final volume of 20 µl and were performed on an Mx3005P Stratagene on the thermal cycling conditions (denaturation at 95°C for 30 seconds [1×], followed by 40 cycles of denaturation [95°C, 30s], annealing [60°C, 10s] and extension [72°C, 15s]). Human actin beta (ACTB) was used as an endogenous reference. The expression of miRNAs was quantified by SYBR PrimeScript miRNA RT‐PCR Kit (TaKaRa) on Mx3005P Stratagene. Amplification reaction was performed in a final volume of 20 µl for 40 cycles (95°C, 10s; 60°C, 10s, 72°C, 15s). The primers used for detecting the expression of miRNAs were showed in Supplemental Table S2. U6b small nuclear RNA was used as the endogenous reference for normalization. The comparative cycle threshold method was performed for relative quantification. Prediction of miRNAs targeting CRISP2 gene The miRNA binding sites in the 3’ untranslated region (3’‐UTR) of CRISP2 were predicted using a miRWalk database (http://www.umm.uni‐heidelberg.de/apps/zmf/ mirwalk/predictedmirnagene.html), a comprehensive database on miRNAs, which hosts predicted or validated miRNA binding sites as well as the information of all known genes of human, rat and mouse [57]. Plasmid construction, Cell culture and Transfection The 732 bp ORF (open reading frame) sequence of CRISP2 was cloned into an EX‐G0250‐M02 plasmid (GeneCopoeia, Guangzhou, China) with CMV promoter for transfection experiment. HEK 293T cells were cultured in DMEM supplemented with 10% fetal bovine serum in 5% CO2 at 37°C, and then plated into 6‐well plates until 80% confluence. The cells were transfected respectively with 100 nM of miR‐27b mimic, inhibitor, negative control (GeneCopoeia, Guangzhou, China) or miR‐27b mimic+CRISP2 plasmid using Lipofectamine 2000 (Invitrogen), and finally harvested 72h after transfection for protein extraction and Western Blot. Western blotting Spermatozoa pellets were purified by Percoll gradient centrifugation and washed with cold PBS. About 2×109 spermatozoa were lysed with 100μl of lysis buffer and 1μl of protease inhibitors on ice for 30 minutes. HEK 293T cells were transfected with mimic or inhibitor and lysed as well. Subsequently, proteins were extracted from them by using Total Protein Extraction Kit (BestBio, Shanghai, China). 30 µg of the total protein was electrophoresed on 12% SDS‐PAGE gels and transferred to PVDF membranes (BioTrace, Mexico). The blots were probed respectively with antibodies against CRISP2 (19066‐1‐AP, Proteintech, USA) [58] (Supplemental Figure S2) or ACTB (60008‐1‐Ig, Proteintech, USA) at 4°C overnight. The horseradish peroxidase‐conjugated secondary antibodies were added respectively. The signals were detected by enhanced chemiluminescence (Pierce, Rockford, IL). The gray value of each protein band was analyzed by Image Lab software. Dual luciferase reporter assay The target sequence of CRISP2 3’‐UTR was cloned into a luciferase reporter vector containing Gaussia Luciferase (GLuc) and Secreted Alkaline Phosphatase (SeAP) dual‐luciferase reporter genes (GeneCopoeia, Guangzhou, China). HEK 293T cells were plated into 24‐well plates until 80% confluence before transfection. 350ng of CRISP2 3’‐UTR pEZX‐MT05 plasmid (3’‐UTR vector, GeneCopoeia, Guangzhou, China) or negative control pEZX‐MT05 plasmid (NC vector, GeneCopoeia, Guangzhou, China) was transiently cotransfected with 50 nM miR‐27b mimic (GenePharma, Shanghai, China) or negative control mimic (NC mimic) into HEK 293T cells. Cells culture mediums were harvested 72h after transfection, and then the activities of Gluc and SeAP were measured using Secrete‐Pair Dual Luminescence Assay Kit (GeneCopoeia, Guangzhou, China) on a Berthold AutoLumat LB9507 rack luminometer. Gluc activities were normalized to SeAP luciferase activities to control for transfection efficiency. Each experiment was performed in duplicated and repeated at least three times. Follow‐up study of reproductive history A retrospective follow‐up study of reproductive history was carried out in 90 study subjects. According to their miR‐27b expression levels relatively separated by a broken line in Fig. 4A and B, the qualified study subjects (Supplemental Table S3B) were divided into the relatively high and low expression groups, which were followed up for the reproductive history. In addition, randomly selected 24 study subjects (12 asthenozoospermic patients and 12 normal volunteers, Supplemental Table S3C) were also divided according to their CRISP2 protein expression levels relatively separated by a broken line in Fig. 4C and D, and then followed up. Male infertility is defined as the inability of a couple to conceive a child due to male factors after one year of unprotected sexual intercourse with a normal female partner or spouse [11]. The percentage was used to describe the infertility rate in each group and the high infertility rate was a relative rate. For example, when comparing the infertility rate between two groups, if the number of subjects with infertility in the group A is significantly more than that of the group B, we can determine that group A has a high infertility rate relative to group B. Statistical analysis Continuous variables were expressed as the mean values ± standard deviation (SD). A two‐tailed Student’s t test was performed to determine the differences of CRISP2 mRNA and miR‐27b expression in the ejaculated spermatozoa between asthenozoospermic and normozoospermic males. One‐way ANOVA and Bonferroni’s test were used to determine significant differences in luciferase activity. A Spearman correlation coefficient (r) was calculated to assess the significance of association between clinical features of semen samples and the expression level of miR‐27b. Chi‐square or Fisher's exact test based on fourfold table was performed to determine significant differences of infertility rate between different groups. All statistical analyses were performed using SPSS13.0 for Windows. P<0.05 was considered to be statistically significant. RESULTS Low expression of CRISP2 protein rather than its mRNA in the ejaculated spermatozoa from patients with asthenozoospermia We initially compared the baseline sperm characteristics between 48 asthenozoospermic patients and 42 normozoospermic volunteers. As a result, no significant differences in age, ejaculate volume, pH‐value and sperm concentration were observed between the two groups except sperm morphology and progressive motility (Table 1). Subsequently, the mRNA and protein expression levels of CRISP2 gene were examined by qRT‐PCR and western blot respectively in the ejaculated spermatozoa samples from the two groups. Notably, no significant difference of CRISP2 mRNA expression was found between two groups (P=0.3854, Fig. 1A), but CRISP2 protein expression was obviously reduced in the semen samples from asthenozoospermic patients relative to normozoospermic controls (Fig. 1B). This suggested that there was no transcriptional regulation of CRISP2 in sperm and the reduced expression of CRISP2 protein rather than its mRNA was associated with asthenozoospermia. No methylation in the promoter of CRISP2 CpG islands The ejaculated spermatozoa can maintain the epigenetic signature of previous spermatogenic stages and it is feasible to using ejaculated spermatozoa to assess the germline DNA methylation profile of spermatogenesis genes [40]. To support that CRISP2 was not transcriptionally down‐regulated in asthenozoospermia, we also carried out an analysis of methylation status of CRISP2 gene. A CpG island, containing 35 CpG sites, was identified in the 5’‐flanking of CRISP2 gene, covering the region from −301 to +383, relative to the transcription start site. The methylation of these CpG sites was examined by both MSP and BSP in the semen samples from 42 normozoospermic and 48 asthenozoospermic males, and then confirmed by DNA sequencing. Notably, no methylation appeared in the CpG islands of CRISP2 promoter in all samples (Fig. 2A, B and C). These data further reflected that CRISP2 reduction was not attributed to DNA methylation and might be regulated at a post‐transcriptionally level in asthenozoospermia. MiR‐27b, a candidate regulator of CRISP2, was highly expressed in the ejaculated spermatozoa from patients with asthenozoospermia MiRNAs are usually required for post‐transcriptionally silencing of gene expression, so we next determined the possible regulatory roles of some miRNAs in CRISP2 down‐expression. A comprehensive database miRWalk, including miRDR, miRWalk and Targetscan, was applied to predict miRNAs potentially regulating CRISP2 gene. As a result, several candidate miRNAs (miR‐27a, miR‐27b, miR‐502‐3p, miR‐510, miR‐640 and miR‐767‐5p) were extracted (Fig. 3A). Interestingly, of these miRNAs, miR‐27b was uniquely confirmed by qRT‐PCR to be highly expressed in the ejaculated spermatozoa from patients with asthenozoospermia relative to normal controls (Supplemental Fig. S1), which was further validated in a larger set of clinical samples (P=0.0013, Fig. 3B), suggesting a potential association of miR‐27b with CRISP2 gene in asthenozoospermia. MiR‐27b directly regulated CRISP2 by binding to its 3’‐UTR To determine whether miR‐27b could specifically regulate CRISP2 expression, we generated a CRISP2 3’‐UTR pEZX‐MT05 plasmid that contained 414‐nucleotide 3’‐UTR of CRISP2 downstream of the luciferase gene (Fig. 3C), and then performed luciferase reporter assay by the co‐transfection of this plasmid with miR‐27b mimic into HEK 293T cells. Notably, our results revealed that miR‐27b significantly suppressed the luciferase activity of reporter genes containing 3’‐UTR of CRISP2 compared with the controls (Fig. 3C), indicating that CRISP2 was a miR‐27b target and miR‐27b might involve in asthenozoospermia by directly suppressing CRISP2. To validate our results, we next transfected miR‐27b mimic, inhibitor, negative control or miR‐27b mimic+CRISP2 plasmid into 293T cells, respectively. As shown in Fig. 3D, CRISP2 protein expression was indeed decreased upon the transfection with miR‐27b mimic, whereas it was increased after treatment with miR‐27b inhibitor. Moreover, CRISP2 protein level was increased upon the re‐expression of CRISP2 in 293T cells treated with miR‐27b mimic. Furthermore, we evaluated the relationship of miR‐27b with CRISP2 protein expression in clinical samples by Spearman’s correlation analysis, which revealed that the expression levels of miR‐27b and CRISP2 protein were negatively correlated in the ejaculated spermatozoa (r= ‐0.5039, P=0.0121; Fig. 3E). However, no evidence was still found that miR‐27b expression was correlated with CRISP2 mRNA expression (P>0.05, Fig. 3F), consistent with the findings of no difference in CRISP2 mRNA expression in the ejaculated spermatozoa between asthenozoospermic and normozoospermic males. Collectively, these results suggested that miR‐27b could directly regulate CRISP2 expression. Clinical correlations of miR‐27b and CRISP2 protein expression with sperm progressive motility and normal morphology To explore the clinical relevance of miR‐27b and CRISP2 protein expression to asthenozoospermia, we further conducted a correlation analysis of miR‐27b or CRISP2 protein expression with low sperm progressive motility and normal morphology in clinical samples. Notably, miR‐27b expression level was negatively correlated with sperm progressive motility (r= ‐0.2745, P=0.0088; Fig. 4A) and normal morphology (r= ‐0.3397, P=0.0012; Fig. 4B) in 90 semen samples (from 48 asthenozoospermic patients and 42 normozoospermic volunteers), but not associated with other clinical features such as age, sperm concentration and semen volume (P>0.05; Supplemental Table S4). In addition, as shown in Fig. 4C and D, the study subjects with relatively low CRISP2 protein expression tended to have lower sperm progressive motility and normal morphology. These data suggested that miR‐27b and CRISP2 protein were clinically involved in asthenozoospermia probably via influencing sperm morphology and progressive motility, although this deserves to be replicated in a larger set of clinical samples. Clinical correlation of miR‐27b and CRISP2 protein expression with infertility Finally, we carried out a retrospective follow‐up study of the reproductive history in all study subjects. Of 90 subjects, 27 were excluded for individual reasons (Table 2). All included subjects were divided into relatively high and low expression groups based on their expression levels of miR‐27b or CRISP2 protein. The infertility rate was calculated for each group respectively and the significant differences of infertility rate between different groups were determined by Chi‐square or Fisher's exact test (Supplemental Table S3). As expected, we observed a higher infertility rate (69%) in asthenozoospermic group than in normal group (32%, P=0.0038, Fig. 4E, Supplemental Table S3A). Of note, a higher infertility rate appeared in the group with relatively high miR‐27b expression (P=0.0376, Supplemental Table S3B) or in the group with relatively low CRISP2 protein expression (P=0.0335, Supplemental Table S3C). These data further supported the assumption that low CRISP2 protein and high miR‐27b expression were associated with infertility. DISCUSSION MiRNAs, as a family of short (20‐23 nucleotides), single‐stranded noncoding RNA molecules, are generally required for post‐transcriptionally silencing of multiple target genes by base‐pair binding to their 3’‐UTR, thereby inducing mRNA degradation or translational repression [59, 60]. Sperm miRNAs have been shown to modulate various stages of spermatogenesis [50, 51, 61]. Some altered sperm miRNAs have been identified by microarray‐based approaches in the ejaculated spermatozoa of patients with different spermatogenic impairments [62‐64]. Impressively, the expression of miR‐15a and its target gene HSPA1B has been recently reported in the ejaculated spermatozoa from patients with varicocele [65]. These miRNAs identified in the ejaculated spermatozoa could be remnants of untranslated stores during spermatogenesis [66], presenting a window into molecular events in spermatogenesis or a record of the requirement of haploid gene expression and post‐meiotic equilibration [67]. Alternatively, these spermatozoal miRNAs could be delivered into the oocyte following fertilization for further functions [68, 69]. In the present study, we discovered that miR‐27b might be a putative miRNA regulating CRISP2 expression. To explore its putative mechanism, we firstly confirmed that miR‐27b was highly expressed in the ejaculated spermatozoa from patients with asthenozoospermia, and then carried out a serial of experiments. Our results revealed that miR‐27b indeed directly regulated CRISP2 protein expression, based on several lines of evidence. First, bioinformatics prediction and luciferase reporter assays indicated that miR‐27b could directly suppress CRISP2. Second, CRISP2 protein expression was decreased in 293T cells after transfection with miR‐27b mimic, whereas CRISP2 protein expression was increased upon the transfection with miR‐27b inhibitor. Third, CRISP2 protein expression was obviously decreased while miR‐27b was highly expressed in the ejaculated spermatozoa of patients with asthenozoospermia. The expression level of CRISP2 protein was negatively correlated with miR‐27b expression. MiR‐27b has been identified as a tumor suppressor in several cancers [70‐72]. It also inhibits the inflammatory response [73, 74], angiogenesis [75] as well as impairs adipogenesis [76] and mitochondrial function [77]. Interestingly, miR‐27b has been observed to be expressed in testis, ovary and zygote [78]. In particular, it was highly expressed in the ejaculated spermatozoa from asthenozoospermic patients relative to normozoospermic men [63]. These findings suggest that miR‐27b may be an important regulator in multiple processes including different stages of spermatogenesis. Of note, within mammals, male germ cells also encounter CRISPs at virtually every phase of development and maturation [79]. CRISP2 displays a stage‐specific expression pattern during spermatogenesis, playing essential roles in various stages of spermatogenesis and the post‐testicular maturation of spermatozoa. Broad research indicates that CRISP2 is involved in germ cell‐Sertoli cell adhesion within the testis [80, 81], expressed in germ cells, and then incorporated into the growing acrosome and sperm tail [20] and even implicated in fertilization [29, 82] via the acrosome reaction or the re‐association with the equatorial segment of acrosome‐reacted human sperm [28]. Particularly, its aberrant expression has been reported to be closely associated with spermatogenesis arrested and defects in sperm function [83]. More interestingly, although it is widely accepted that spermatozoa are translationally silent, some studies (eg. by Dr. Yael Gur and Haim Breitbart [84‐86] ) showed that in fact protein translation does take place in mammalian spermatozoa prior to fertilization. Consistently, the present study observed a reduced CRISP2 protein rather than its mRNA expression in the ejaculated spermatozoa from patients with asthenozoospermia. All these findings make it suggestive that CRISP2 and its regulator miR‐27b may play roles in the whole processes of spermatogenesis prior to fertilization though further studies using other human experimental models are encouraged to provide supporting evidence in the future. Asthenozoospermia is frequently characterized by low sperm progressive motility, clinically accompanied by a low total sperm count or increased numbers of spermatozoa with abnormal morphology [3]. Low sperm motility is considered to be more likely reason for male infertility [87] and sperm motility pattern is closely related with natural pregnancy rate [88, 89]. Low pregnancy rate has been reported to be due to low CRISP2 expression level in the ejaculated spermatozoa in cattle [33]. To further support the roles of miR‐27b and CRISP2 in asthenozoospermia and even infertility, we carried out a clinical correlation analysis and a retrospective follow‐up study of the reproductive history in all study subjects. Consistently, our clinical data revealed that either high miR‐27b or low CRISP2 protein expression tended to be correlated with lower sperm progressive motility and normal morphology. The follow‐up study further observed a higher infertility rate in asthenozoospermic patients and a close relationship between high infertility rate and low CRISP2 protein expression or high miR‐27b expression. Although there may be more unidentified miR‐27b targets that likely contribute to asthenozoospermia and infertility, these data first demonstrates that miR‐27b suppresses CRISP2 protein expression during spermatogenesis prior to fertilization, clinically involving in asthenozoospermia and male infertility probably via influencing sperm motility and morphology. Conclusively, this study provide a novel insight into a portion of mechanism leading to the reduced CRISP2 expression in asthenozoospermia, offering a potential therapeutic target for treating male infertility or for male contraception. ACKNOWLEDGMENT The authors thank Prof. Rangke Wu for his contributions to the manuscript revision. REFERENCES 1. Jungwirth A, Giwercman A, Tournaye H, Diemer T, Kopa Z, Dohle G, Krausz C. European Association of Urology guidelines on Male Infertility: the 2012 update. Eur Urol 2012; 62: 324-332. 2. Hellani A, Al-Hassan S, Iqbal MA, Coskun S. Y chromosome microdeletions in infertile men with idiopathic oligo- or azoospermia. J Exp Clin Assist Reprod 2006; 3: 1. 3. Adeniji RA, Olayemi O, Okunlola MA, Aimakhu CO. Pattern of semen analysis of male partners of infertile couples at the University College Hospital, Ibadan. West Afr J Med 2003; 22: 243-245. 4. Chemes HE, Olmedo SB, Carrere C, Oses R, Carizza C, Leisner M, Blaquier J. Ultrastructural pathology of the sperm flagellum: association between flagellar pathology and fertility prognosis in severely asthenozoospermic men. Hum Reprod 1998; 13: 2521-2526. 5. Organization WH. WHO laboratory manual for the examination and processing of human semen World Health Organization. Geneva (Switzerland) 2010. 6. Marchini M, Losa G, Falcone L, Piffaretti-Yanez A, Zeeb M, Balerna M. Etiology of severe asthenozoospermia and fertility prognosis. A screening of 5216 semen analyses. Andrologia 1991; 23: 115-120. 7. Baccetti B, Bruni E, Gambera L, Moretti E, Piomboni P. An ultrastructural and immunocytochemical study of a rare genetic sperm tail defect that causes infertility in humans. Fertil Steril 2004; 82: 463-468. 8. Stanwell-Smith RE, Hendry WF. The prognosis of male subfertility: a survey of 1025 men referred to a fertility clinic. Br J Urol 1984; 56: 422-428. 9. Chemes HE. Phenotypes of sperm pathology: genetic and acquired forms in infertile men. J Androl 2000; 21: 799-808. 10. Rowe PJ, Comhaire FH. WHO manual for the standardized investigation, diagnosis and management of the infertile male.: Cambridge University Press; 2000. 11. Dohle GR, Colpi GM, Hargreave TB, Papp GK, Jungwirth A, Weidner W. EAU guidelines on male infertility. Eur Urol 2005; 48: 703-711. 12. Tanaka H, Iguchi N, Toyama Y, Kitamura K, Takahashi T, Kaseda K, Maekawa M, Nishimune Y. Mice deficient in the axonemal protein Tektin-t exhibit male infertility and immotile-cilium syndrome due to impaired inner arm dynein function. Mol Cell Biol 2004; 24: 7958-7964. 13. Zuccarello D, Ferlin A, Cazzadore C, Pepe A, Garolla A, Moretti A, Cordeschi G, Francavilla S, Foresta C. Mutations in dynein genes in patients affected by isolated non-syndromic asthenozoospermia. Hum Reprod 2008; 23: 1957-1962. 14. Brown PR, Miki K, Harper DB, Eddy EM. A-kinase anchoring protein 4 binding proteins in the fibrous sheath of the sperm flagellum. Biol Reprod 2003; 68: 2241-2248. 15. Ihara M, Kinoshita A, Yamada S, Tanaka H, Tanigaki A, Kitano A, Goto M, Okubo K, Nishiyama H, Ogawa O, Takahashi C, Itohara S, Nishimune Y, Noda M, Kinoshita M. Cortical organization by the septin cytoskeleton is essential for structural and mechanical integrity of mammalian spermatozoa. Dev Cell 2005; 8: 343-352. 16. Gibbs GM, Roelants K, O'Bryan MK. The CAP superfamily: cysteine-rich secretory proteins, antigen 5, and pathogenesis-related 1 proteins--roles in reproduction, cancer, and immune defense. Endocr Rev 2008; 29: 865-897. 17. Mizuki N, Sarapata DE, Garcia-Sanz JA, Kasahara M. The mouse male germ cell-specific gene Tpx-1: molecular structure, mode of expression in spermatogenesis, and sequence similarity to two non-mammalian genes. Mamm Genome 1992; 3: 274-280. 18. Kratzschmar J, Haendler B, Eberspaecher U, Roosterman D, Donner P, Schleuning WD. The human cysteine-rich secretory protein (CRISP) family. Primary structure and tissue distribution of CRISP-1, CRISP-2 and CRISP-3. Eur J Biochem 1996; 236: 827-836. 19. Haendler B, Habenicht UF, Schwidetzky U, Schuttke I, Schleuning WD. Differential androgen regulation of the murine genes for cysteine-rich secretory proteins (CRISP). Eur J Biochem 1997; 250: 440-446. 20. O'Bryan MK, Sebire K, Meinhardt A, Edgar K, Keah HH, Hearn MT, De Kretser DM. Tpx-1 is a component of the outer dense fibers and acrosome of rat spermatozoa. Mol Reprod Dev 2001; 58: 116-125. 21. Busso D, Cohen DJ, Hayashi M, Kasahara M, Cuasnicu PS. Human testicular protein TPX1/CRISP-2: localization in spermatozoa, fate after capacitation and relevance for gamete interaction. Mol Hum Reprod 2005; 11: 299-305. 22. Gibbs GM, Bianco DM, Jamsai D, Herlihy A, Ristevski S, Aitken RJ, Kretser DM, O'Bryan MK. Cysteine-rich secretory protein 2 binds to mitogen-activated protein kinase kinase kinase 11 in mouse sperm. Biol Reprod 2007; 77: 108-114. 23. Jamsai D, Bianco DM, Smith SJ, Merriner DJ, Ly-Huynh JD, Herlihy A, Niranjan B, Gibbs GM, O'Bryan MK. Characterization of gametogenetin 1 (GGN1) and its potential role in male fertility through the interaction with the ion channel regulator, cysteine-rich secretory protein 2 (CRISP2) in the sperm tail. Reproduction 2008; 135: 751-759. 24. Jamsai D, Rijal S, Bianco DM, O'Connor AE, Merriner DJ, Smith SJ, Gibbs GM, O'Bryan MK. A novel protein, sperm head and tail associated protein (SHTAP), interacts with cysteine-rich secretory protein 2 (CRISP2) during spermatogenesis in the mouse. Biol Cell 2010; 102: 93-106. 25. Gibbs GM, Scanlon MJ, Swarbrick J, Curtis S, Gallant E, Dulhunty AF, O'Bryan MK. The cysteine-rich secretory protein domain of Tpx-1 is related to ion channel toxins and regulates ryanodine receptor Ca2+ signaling. J Biol Chem 2006; 281: 4156-4163. 26. Harper CV, Barratt CL, Publicover SJ. Stimulation of human spermatozoa with progesterone gradients to simulate approach to the oocyte. Induction of [Ca(2+)](i) oscillations and cyclical transitions in flagellar beating. J Biol Chem 2004; 279: 46315-46325. 27. Publicover S, Harper CV, Barratt C. [Ca2+]i signalling in sperm--making the most of what you've got. Nat Cell Biol 2007; 9: 235-242. 28. Nimlamool W, Bean BS, Lowe-Krentz LJ. Human sperm CRISP2 is released from the acrosome during the acrosome reaction and re-associates at the equatorial segment. Mol Reprod Dev 2013; 80: 488-502. 29. Busso D, Goldweic NM, Hayashi M, Kasahara M, Cuasnicu PS. Evidence for the involvement of testicular protein CRISP2 in mouse sperm-egg fusion. Biol Reprod 2007; 76: 701-708. 30. Wang H, Zhou Z, Xu M, Li J, Xiao J, Xu ZY, Sha J. A spermatogenesis-related gene expression profile in human spermatozoa and its potential clinical applications. J Mol Med (Berl) 2004; 82: 317-324. 31. Mao XM, Xing RW, Jing XW, Zhou QZ, Yu QF, Guo WB, Wu XQ, Chu QJ, Feng CQ. [Differentially expressed genes in asthenospermia: a bioinformatics-based study]. Zhonghua Nan Ke Xue 2011; 17: 694-698. 32. Jing XW, Xing RW, Zhou QZ, Yu QF, Guo WB, Chen SM, Chu QJ, Feng CQ, Mao XM. [Expressions of cysteine-rich secretory protein 2 in asthenospermia]. Zhonghua Nan Ke Xue 2011; 17: 203-207. 33. Arangasamy A, Kasimanickam VR, DeJarnette JM, Kasimanickam RK. Association of CRISP2, CCT8, PEBP1 mRNA abundance in sperm and sire conception rate in Holstein bulls. Theriogenology 2011; 76: 570-577. 34. Girardot M, Feil R, Lleres D. Epigenetic deregulation of genomic imprinting in humans: causal mechanisms and clinical implications. Epigenomics 2013; 5: 715-728. 35. Esteller M. Non-coding RNAs in human disease. Nat Rev Genet 2011; 12: 861-874. 36. Yan B, Yao J, Tao ZF, Jiang Q. Epigenetics and ocular diseases: from basic biology to clinical study. J Cell Physiol 2014; 229: 825-833. 37. Marques CJ, Costa P, Vaz B, Carvalho F, Fernandes S, Barros A, Sousa M. Abnormal methylation of imprinted genes in human sperm is associated with oligozoospermia. Mol Hum Reprod 2008; 14: 67-74. 38. Kobayashi H, Hiura H, John RM, Sato A, Otsu E, Kobayashi N, Suzuki R, Suzuki F, Hayashi C, Utsunomiya T, Yaegashi N, Arima T. DNA methylation errors at imprinted loci after assisted conception originate in the parental sperm. Eur J Hum Genet 2009; 17: 1582-1591. 39. Poplinski A, Tuttelmann F, Kanber D, Horsthemke B, Gromoll J. Idiopathic male infertility is strongly associated with aberrant methylation of MEST and IGF2/H19 ICR1. Int J Androl 2010; 33: 642-649. 40. Navarro-Costa P, Nogueira P, Carvalho M, Leal F, Cordeiro I, Calhaz-Jorge C, Goncalves J, Plancha CE. Incorrect DNA methylation of the DAZL promoter CpG island associates with defective human sperm. Hum Reprod 2010; 25: 2647-2654. 41. Hammoud SS, Purwar J, Pflueger C, Cairns BR, Carrell DT. Alterations in sperm DNA methylation patterns at imprinted loci in two classes of infertility. Fertil Steril 2010; 94: 1728-1733. 42. Huszar JM, Payne CJ. MicroRNA 146 (Mir146) modulates spermatogonial differentiation by retinoic acid in mice. Biol Reprod 2013; 88: 15. 43. Yang QE, Racicot KE, Kaucher AV, Oatley MJ, Oatley JM. MicroRNAs 221 and 222 regulate the undifferentiated state in mammalian male germ cells. Development 2013; 140: 280-290. 44. Tong MH, Mitchell DA, McGowan SD, Evanoff R, Griswold MD. Two miRNA clusters, Mir-17-92 (Mirc1) and Mir-106b-25 (Mirc3), are involved in the regulation of spermatogonial differentiation in mice. Biol Reprod 2012; 86: 72. 45. Niu Z, Goodyear SM, Rao S, Wu X, Tobias JW, Avarbock MR, Brinster RL. MicroRNA-21 regulates the self-renewal of mouse spermatogonial stem cells. Proc Natl Acad Sci U S A 2011; 108: 12740-12745. 46. Yu Z, Raabe T, Hecht NB. MicroRNA Mirn122a reduces expression of the posttranscriptionally regulated germ cell transition protein 2 (Tnp2) messenger RNA (mRNA) by mRNA cleavage. Biol Reprod 2005; 73: 427-433. 47. Yan N, Lu Y, Sun H, Tao D, Zhang S, Liu W, Ma Y. A microarray for microRNA profiling in mouse testis tissues. Reproduction 2007; 134: 73-79. 48. Ro S, Park C, Sanders KM, McCarrey JR, Yan W. Cloning and expression profiling of testis-expressed microRNAs. Dev Biol 2007; 311: 592-602. 49. Ostermeier GC, Goodrich RJ, Moldenhauer JS, Diamond MP, Krawetz SA. A suite of novel human spermatozoal RNAs. J Androl 2005; 26: 70-74. 50. Grivna ST, Beyret E, Wang Z, Lin H. A novel class of small RNAs in mouse spermatogenic cells. Genes Dev 2006; 20: 1709-1714. 51. He Z, Kokkinaki M, Pant D, Gallicano GI, Dym M. Small RNA molecules in the regulation of spermatogenesis. Reproduction 2009; 137: 901-911. 52. Mengual L, Ballesca JL, Ascaso C, Oliva R. Marked differences in protamine content and P1/P2 ratios in sperm cells from percoll fractions between patients and controls. J Androl 2003; 24: 438-447. 53. Zhou QZ, Feng CQ, Zou YG, Shu W, Li TQ, Li F, Liu CD, Mao XM. [Single- and two-layer gradient centrifugation in sperm separation: comparison and appraisal]. Zhonghua Nan Ke Xue 2010; 16: 217-219. 54. Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A 1996; 93: 9821-9826. 55. Derks S, Lentjes MH, Hellebrekers DM, de Bruine AP, Herman JG, van Engeland M. Methylation-specific PCR unraveled. Cell Oncol 2004; 26: 291-299. 56. Espada J, Carrasco E, Calvo MI. Standard DNA methylation analysis in mouse epidermis: bisulfite sequencing, methylation-specific PCR, and 5-methyl-cytosine (5mC) immunological detection. Methods Mol Biol 2014; 1094: 221-231. 57. Dweep H, Sticht C, Pandey P, Gretz N. miRWalk--database: prediction of possible miRNA binding sites by "walking" the genes of three genomes. J Biomed Inform 2011; 44: 839-847. 58. Chen HY, Yu YH, Yen PH. DAZAP1 regulates the splicing of Crem, Crisp2 and Pot1a transcripts. Nucleic Acids Res 2013. 59. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004; 116: 281-297. 60. Stark A, Bushati N, Jan CH, Kheradpour P, Hodges E, Brennecke J, Bartel DP, Cohen SM, Kellis M. A single Hox locus in Drosophila produces functional microRNAs from opposite DNA strands. Genes Dev 2008; 22: 8-13. 61. Jodar M, Selvaraju S, Sendler E, Diamond MP, Krawetz SA. The presence, role and clinical use of spermatozoal RNAs. Hum Reprod Update 2013; 19: 604-624. 62. Lian J, Zhang X, Tian H, Liang N, Wang Y, Liang C, Li X, Sun F. Altered microRNA expression in patients with non-obstructive azoospermia. Reprod Biol Endocrinol 2009; 7: 13. 63. Abu-Halima M, Hammadeh M, Schmitt J, Leidinger P, Keller A, Meese E, Backes C. Altered microRNA expression profiles of human spermatozoa in patients with different spermatogenic impairments. Fertil Steril 2013; 99: 1249-1255. 64. Li Y, Li M, Liu Y, Song G, Liu N. A microarray for microRNA profiling in spermatozoa from adult men living in an environmentally polluted site. Bull Environ Contam Toxicol 2012; 89: 1111-1114. 65. Ji Z, Lu R, Mou L, Duan YG, Zhang Q, Wang Y, Gui Y, Cai Z. Expressions of miR-15a and its target gene HSPA1B in the spermatozoa of patients with varicocele. Reproduction 2014; 147: 693-701. 66. Miller D, Briggs D, Snowden H, Hamlington J, Rollinson S, Lilford R, Krawetz SA. A complex population of RNAs exists in human ejaculate spermatozoa: implications for understanding molecular aspects of spermiogenesis. Gene 1999; 237: 385-392. 67. Miller D. RNA in the ejaculate spermatozoon: a window into molecular events in spermatogenesis and a record of the unusual requirements of haploid gene expression and post-meiotic equilibration. Mol Hum Reprod 1997; 3: 669-676. 68. Miller D, Ostermeier GC. Towards a better understanding of RNA carriage by ejaculate spermatozoa. Hum Reprod Update 2006; 12: 757-767. 69. Sendler E, Johnson GD, Mao S, Goodrich RJ, Diamond MP, Hauser R, Krawetz SA. Stability, delivery and functions of human sperm RNAs at fertilization. Nucleic Acids Res 2013; 41: 4104-4117. 70. Ishteiwy RA, Ward TM, Dykxhoorn DM, Burnstein KL. The microRNA -23b/-27b cluster suppresses the metastatic phenotype of castration-resistant prostate cancer cells. PLoS One 2012; 7: e52106. 71. Wan L, Zhang L, Fan K, Wang J. MiR-27b targets LIMK1 to inhibit growth and invasion of NSCLC cells. Mol Cell Biochem 2014; 390: 85-91. 72. Ye J, Wu X, Wu D, Wu P, Ni C, Zhang Z, Chen Z, Qiu F, Xu J, Huang J. miRNA-27b targets vascular endothelial growth factor C to inhibit tumor progression and angiogenesis in colorectal cancer. PLoS One 2013; 8: e60687. 73. Lee JJ, Drakaki A, Iliopoulos D, Struhl K. MiR-27b targets PPARgamma to inhibit growth, tumor progression and the inflammatory response in neuroblastoma cells. Oncogene 2012; 31: 3818-3825. 74. Jennewein C, von Knethen A, Schmid T, Brune B. MicroRNA-27b contributes to lipopolysaccharide-mediated peroxisome proliferator-activated receptor gamma (PPARgamma) mRNA destabilization. J Biol Chem 2010; 285: 11846-11853. 75. Urbich C, Kaluza D, Fromel T, Knau A, Bennewitz K, Boon RA, Bonauer A, Doebele C, Boeckel JN, Hergenreider E, Zeiher AM, Kroll J, Fleming I, Dimmeler S. MicroRNA-27a/b controls endothelial cell repulsion and angiogenesis by targeting semaphorin 6A. Blood 2012; 119: 1607-1616. 76. Lin Q, Gao Z, Alarcon RM, Ye J, Yun Z. A role of miR-27 in the regulation of adipogenesis. FEBS J 2009; 276: 2348-2358. 77. Kang T, Lu W, Xu W, Anderson L, Bacanamwo M, Thompson W, Chen YE, Liu D. MicroRNA-27 (miR-27) Targets Prohibitin and Impairs Adipocyte Differentiation and Mitochondrial Function in Human Adipose-derived Stem Cells. J Biol Chem 2013; 288: 34394-34402. 78. Krawetz SA, Kruger A, Lalancette C, Tagett R, Anton E, Draghici S, Diamond MP. A survey of small RNAs in human sperm. Hum Reprod 2011; 26: 3401-3412. 79. Koppers AJ, Reddy T, O'Bryan MK. The role of cysteine-rich secretory proteins in male fertility. Asian J Androl 2011; 13: 111-117. 80. Maeda T, Sakashita M, Ohba Y, Nakanishi Y. Molecular cloning of the rat Tpx-1 responsible for the interaction between spermatogenic and Sertoli cells. Biochem Biophys Res Commun 1998; 248: 140-146. 81. Maeda T, Nishida J, Nakanishi Y. Expression pattern, subcellular localization and structure--function relationship of rat Tpx-1, a spermatogenic cell adhesion molecule responsible for association with Sertoli cells. Dev Growth Differ 1999; 41: 715-722. 82. Da RV, Busso D, Cohen DJ, Maldera J, Goldweic N, Cuasnicu PS. Molecular mechanisms involved in gamete interaction: evidence for the participation of cysteine-rich secretory proteins (CRISP) in sperm-egg fusion. Soc Reprod Fertil Suppl 2007; 65: 353-356. 83. Du Y, Huang X, Li J, Hu Y, Zhou Z, Sha J. Human testis specific protein 1 expression in human spermatogenesis and involvement in the pathogenesis of male infertility. Fertil Steril 2006; 85: 1852-1854. 84. Gur Y, Breitbart H. Mammalian sperm translate nuclear-encoded proteins by mitochondrial-type ribosomes. Genes Dev 2006; 20: 411-416. 85. Gur Y, Breitbart H. Protein translation in mammalian sperm. Soc Reprod Fertil Suppl 2007; 65: 391-397. 86. Gur Y, Breitbart H. Protein synthesis in sperm: dialog between mitochondria and cytoplasm. Mol Cell Endocrinol 2008; 282: 45-55. 87. Cai XQ, Marik JJ. Improving penetrating capacity of spermatozoa with poor motility by addition of caffeine at coincubation with zona-free hamster ova. Fertil Steril 1989; 51: 719-721. 88. Beauchamp PJ, Galle PC, Blasco L. Human sperm velocity and postinsemination cervical mucus test in the evaluation of the infertile couple. Arch Androl 1984; 13: 107-112. 89. Ayala C, Steinberger E, Smith DP. The influence of semen analysis parameters on the fertility potential of infertile couples. J Androl 1996; 17: 718-725. FIGURE LEGENDS FIG. 1. Low expression of CRISP2 protein rather than its mRNA in the ejaculated spermatozoa of patients with asthenozoospermia. A) The expression level of CRISP2 mRNA was detected by qRT‐PCR in the ejaculated spermatozoa between asthenozoospermic patients and normozoospermic volunteers. B) The CRISP2 protein expression was detected by Western Blot in the ejaculated spermatozoa, and then the relative gray value of each protein band was analyzed by Image Lab software. Data were shown as mean ± SEM, ***P<0.001. Norm, normozoospermic volunteers group; Asth, asthenozoospermic patients group. FIG. 2. No methylation in the promoter of CRISP2 CpG islands in the ejaculated spermatozoa of patients with asthenozoospermia. A) Methylation status of CRISP2 promoter by MSP. B) Methylation status of CRISP2 promoter by BSP. C) DNA sequencing of bisulfite‐sequencing PCR results. M, methylated products; U, unmethylated products; Norm, normozoospermic volunteers group; Asth, asthenozoospermic patients group; NC; negative control of PCR system. FIG. 3. miR‐27b directly regulated CRISP2 by binding to its 3’‐UTR. A) A Venn diagram showed the overlap of candidate miRNAs that were predicted by miRWalk, and the CRISP2 3’‐UTR with a potential binding‐site for miR‐27b was displayed. B) miR‐27b was detected by qRT‐PCR to be highly expressed in the ejaculated spermatozoa of patients with asthenozoospermia relative to normal controls. Data were shown as mean ± SEM, **P<0.01. C) Schematic diagram of luciferase reporter construct, and results of luciferase reporter assay in HEK 293T cells with co‐transfection of 3’‐UTR vector or negative control vector. The bar graph showed the mean ± SD in the three independent experiments. *P<0.05, ***P<0.001. D) The expression of CRISP2 protein was detected by Western Blot in 293T cells transfected with miR‐27b mimic, inhibitor, negative control and miR‐27b mimic+CRISP2 plasmid, respectively. E) Spearman correlation coefficient (r) was calculated to assess the significance of association between miR‐27b and CRISP2 protein expression levels. F) Spearman correlation coefficient was calculated to assess the significance of association between miR‐27b and CRISP2 mRNA expression levels. Norm, normozoospermic volunteers group; Asth, asthenozoospermic patients group; NC, negative control. FIG. 4. miR‐27b expression level was negatively correlated with sperm progressive motility and normal morphology. The study subjects with relatively low CRISP2 protein expression tended to have lower sperm progressive motility and normal morphology. Low CRISP2 protein and high miR‐27b expression were associated with infertility. A) Spearman correlation analysis showed the significance of association between miR‐27b expression level and sperm progressive motility in 90 samples. B) Spearman correlation analysis showed the significance of association between miR‐27b expression level and sperm normal morphology in 90 samples. C) Spearman correlation analysis showed the significance of association between CRISP2 protein expression level and sperm progressive motility in 24 samples. D) Spearman correlation analysis showed the significance of association between CRISP2 protein expression level and sperm normal morphology in 24 samples. E) The infertility rates were displayed in the indicated groups. Chi‐square or Fisher's exact test was performed to determine significant differences of infertility rate between different groups. *P<0.05, ** P<0.01. Abbreviations: Norm: normozoospermic volunteers group. Asth: asthenozoospermic patients group. TABLE 1. Demographic and semen characteristics. a Characteristics Norm (n = 42)a,b Asth (n = 48)a,c Age (yr) 29.00 ± 4.804 30.13 ± 5.841 Volume (ml) 3.32 ± 1.520 3.18 ± 1.345 pH 7.53 ± 0.113 7.51 ± 0.130 Count (106/ml) 74.53 ± 60.193 85.80 ± 80.298 Motility (% motile) 61.51 ± 11.665* 17.98 ± 9.124 Morphology (%) 22.90 ± 6.630* 6.721 ± 1.567 Data presented as mean±SD. Norm, normozoospermia control group. c Asth, asthenozoospermia group. *Student t‐test, P < 0.05 versus the asthenozoospermia group. b TABLE 2. The 63 study subjects included and 27 study subjects excluded. Participants Status Descriptions 19 Excluded Lost contact or refused to cooperate 4 Excluded Female partner infertility 4 Excluded Unmarried 31 Included The included normozoospermic volunteers 32 Included The included asthenozoospermic patients 90 ‐ Total study subjects Figure 1 B 2.5 Asth Norm CRISP2 P=0.3854 2.0 ACTB 1.5 1.0 0.5 0.0 Norm Asth (n=42) (n=48) Relative gray values (CRISP2 protein / ACTB) Relative expression (CRISP2 mRNA / ACTB) A *** 2.0 1.5 1.0 0.5 0.0 Norm Asth (n=12) (n=12) Figure 2 M A Norm Maker U Asth Norm Asth NC Maker MSP B Maker NC Norm Maker Asth Maker BSP C U: GTGGTGATGAAAGTATAAAGT T TAGTGATGT TGT TTATATGTGGTGT T TGGTAAGTGAATAATTGTGGTGAGAGGGGTGTG TTGTAG T T T TTTAATG TTGTAA TGTGTT M: GCGGCGATGAAAGTATAAAGTT TAGTGACGTCGT TTATACGTGGCGT TTGGTAAGTGAATAATCGCGGTGAGAGGGGCGCG TCGTAGT T T TTTAACGTCGTAA CGCGTC Figure 3 miRDB A miRWalk Has-miR-27b-3p 0 6 0 miR-27b position 266 miR-27a CRISP2 3’-UTR 5' -… A G AG C …-3' miR-502-3p UAGGAUUUA GUCACU GA miR-510 GUCUUGAAU CGGUGA CU miR-640 miR-27b 3' - C CA U -5' Targetscan ** 1.0 miR-27b 0.8 0.6 0.4 CRISP2 3’-UTR 0.2 Norm CRISP2 ACTB * *** 1.0 0.8 0.6 0.4 0.2 0.0 3’-UTR vector NC vector miR-27b miR-NC Asth (n=48) E F 2.0 Relative expression (CRISP2 mRNA / ACTB) 0.0 (n=42) D C Relative gray values (CRISP2 protein / ACTB) Relative expression (miR-27b / U6b) B R e la t iv e lu c if e ra s e ra t io miR-767-5p P = 0.0121 1.5 r = -0.5039 1.0 0.5 0.0 0.0 0.2 0.4 0.6 miR-27b / U6b (n=24) 0.8 + - + - 2.5 + - - + - + + - P > 0.05 2.0 1.5 1.0 0.5 0.0 0.0 0.2 0.4 0.6 miR-27b / U6b (n=90) 0.8 1.0 Figure 4 A P = 0.0088 r = -0.2745 100 50 0 0.0 0.2 0.4 0.6 0.8 1.0 50 P = 0.0012 r = -0.3397 40 30 20 10 0 0.0 0.2 0.4 20 P = 0.0024 r = 0.5911 10 5 1.0 1.5 Relativ e gray values (CRISP2 protein / ACTB) (n=24) 2.0 P = 0.0003 r = 0.6697 40 20 0 0.0 0.5 40 Fertility Infertility ** n=31 n=32 30 69% 20 42% 10 0 32% * n=20 70% 1.0 1.5 Relative gray values (CRISP2 protein / ACTB) (n=24) n=43 Numbers of study subjects Normal morphology (%) 25 60 * E 0.5 1.0 (n=90) D 0 0.0 0.8 0.6 Re lativ e expre ssion (miR-27b / U6b) Relative expression (miR-27b / U6b) (n=90) 15 Progressive motility(%) 150 C Normal morphology (%) Progressive motility(%) B n=16 63% n=8 13% 2.0
© Copyright 2026 ExpyDoc