Multiplex CRISPR/Cas9 Assembly System Kit protocol (Yamamoto lab) Ver. 1.1 July 2014 Tetsushi Sakuma, Ph. D. E-mail: [email protected] Takashi Yamamoto Lab. Department of Mathematical and Life Sciences Graduate School of Science Hiroshima University 1-3-1 Kagamiyama, Higashi-Hiroshima, 739-8526 Hiroshima, Japan TEL: +81-82-424-7446 E-mail: [email protected] This is a protocol for the construction of all-in-one CRISPR/Cas9 vector expressing multiple (2-7) gRNAs and a Cas9 nuclease or nickase described in Sakuma et al., Sci Rep, 2014 (http://dx.doi.org/10.1038/srep05400). ■Table of Contents Materials ・・・・・・ 2 1. Multiplex CRISPR/Cas9 assembly -STEP 1- ・・・・・・ 3 2. Multiplex CRISPR/Cas9 assembly -STEP 2- ・・・・・・ 4 ・・・・・・ 5 Methods Appendix 1 ■Materials ○Plasmids Multiplex CRISPR/Cas9 Assembly System Kit (Addgene) Insert plasmids: pX330S-2, 3, 4, 5, 6, 7 (6 plasmids, Spectinomycin resistant) Vector plasmids for Cas9 nuclease expression: pX330A-1x2, 1x3, 1x4, 1x5, 1x6, 1x7 (6 plasmids, Ampicillin resistant) Vector plasmids for Cas9 nickase expression: pX330A_D10A-1x2, 1x3, 1x4, 1x5, 1x6, 1x7 (6 plasmids, Ampicillin resistant) ○Reagents (excluding standard PCR enzymes and reagents for bacterial culture) Maker Product name Cat. No. Size/Unit NEB Quick Ligation Kit M2200S 30 reactions M2200L 150 reactions ER0291 1000 units ER0292 5000 units Thermo Scientific Eco31I* NEB 10×T4 DNA Ligase Reaction Buffer B0202S 6 ml Life Technologies ChargeSwitch-Pro Plasmid Mini Kit CS30250 250 reactions *BsaI (NEB, R0535S or R0535L) and BsaI-HF (NEB, R3535S or R3535L) can also be used. ○Primers CRISPR-step2-F: GCCTTTTGCTGGCCTTTTGCTC CRISPR-step2-R: CGGGCCATTTACCGTAAGTTATGTAACG 2 ■Methods 1. Multiplex CRISPR/Cas9 assembly -STEP 1Insert the annealed oligonucleotides for gRNA templates. Since our vectors are derivatives of the Feng Zhang lab’s pX330 plasmid (Addgene, Plasmid 42230), oligonucleotides should be designed according to their previous report (http://dx.doi.org/10.1038/nprot.2013.143). Using our system, you can make CRISPR/Cas9 vectors coexpressing 2-7 gRNAs and Cas9 nuclease/nickase. It is necessary that you choose appropriate combinations of vectors for the desired applications. DOI: 10.1038/srep05400 To perform STEP1 reactions, you can conduct conventional BpiI (BbsI) digestion and ligation procedures. Alternatively, you can also conduct Golden Gate assembly-like method (see Appendix for detailed reaction conditions). Transform 0.5-1 µl of the reaction product directly to chemical competent E. coli such as XL1-Blue and streak the transformant on Spectinomycin/Ampicillin-LB plate as described in Appendix. 3 Culture O/N at 37°C. Pick two clones for each sample and culture them with 100 ng/µl Spectinomycin/Ampicillin-LB media. Purify the plasmids using Miniprep kit. To check the insert, BpiI digestion should be performed. If the oligonucleotides are correctly inserted, the plasmids are no longer cut by BpiI. 2. Multiplex CRISPR/Cas9 assembly -STEP 2Perform 2nd-step assembly using the plasmids constructed in the section 1, following protocols described in Appendix. Transform the reaction product to XL1-Blue and streak the transformant on Ampicillin/X-gal/IPTG-LB plate. Culture O/N at 37°C. Pick white colonies and screen for correctly assembled clones by colony PCR. You can use CRISPR-step2-F and CRISPR-step2-R primers both for pX330A and pX330A_D10A vectors. The detailed reaction condition is described in Appendix. DOI: 10.1038/srep05400 Culture the desired clones and purify the plasmids using Miniprep kit. 4 Multiplex CRISPR/Cas9 Assembly System Kit protocol -AppendixBench protocol for STEP1 & 2 (Yamamoto lab) STEP1 ■Golden Gate reaction (µl) 25 ng/µl vector 0.3 10 µM annealed oligos 0.5 10×T4 DNA ligase buf. 0.2 BpiI 0.1 Quick ligase 0.1 SDW 0.8 Total 2 37℃ 16℃ 4℃ premix → 1.2 µl each → Additional digestion: 5min. 10min. ∞ add 10×G buf. 0.2 µl, BpiI 0.1 µl. premix → 0.3 µl each 37℃, 1 hr / 80℃, 5min. / 4℃, ∞ ×3 ■Transformation Product 0.5 XL1-Blue (homemade) 10 on ice >5min. → 42℃, 30 sec. → on ice → plating (100 µg/ml Spec or Amp plate) 5 STEP2 Number of gRNA cassettes ■Golden Gate reaction 2 100 ng/µl pX330S vector 1.5 3 4 5 6 7 1.5×2 1.5×3 1.5×4 1.5×5 1.5×6 50 ng/µl pX330A vector 1.5 10×T4 DNA ligase buf. 2 Eco31I 1 Quick ligase 1 SDW 13 Total 20 premix → 4 µl each 37℃ 16℃ 4℃ 5min. 10min. ∞ 11.5 10 8.5 7 5.5 ×25 → Additional digestion: add 10×G buf. 2 µl, Eco31I 1 µl. premix → 3 µl each 37℃, 30min. / 80℃, 5min. / 4℃, ∞ ■Transformation Product 2 XL1-Blue (homemade) 20 on ice >5min. → 42℃, 30 sec. → on ice → plating (100 µg/ml Amp plate w/ X-gal+IPTG) ■Colony PCR 10X buf. for Hybripol 0.8 dNTPs 0.64 10 µM primer 0.16+0.16 (CRISPR-step2-F/R) Hybripol DNA polymerase (BIOLINE)* 0.04 MgCl2 0.24 95℃ 95℃ 62℃ 72℃ 72℃ 4℃ SDW 5.96 30s. 15s. 15s. 90s. 50s. ∞ Total 8 ×27 *Any other standard Taq polymerase can be used. 6
© Copyright 2026 ExpyDoc