Journal of Experimental Botany Sixteen cytosolic glutamine synthetase genes identified in Brassica napus L. genome are differentially regulated depending on nitrogen regimes and leaf senescence Mathilde Orsel, Michaël Moison, Vanessa Clouet, Justine Thomas, Françoise Leprince, Anne-Sophie Canoy, Jérémy Just, Boulos Chalhoub, Céline MasclauxDaubresse. 5 Supplementary Tables 5 Supplementary Figures 5 supplementary Data Files Supplementary Table S1: Clones from Genoplante and ADIS-MPIZ oilseedrape cDNA libraries used for BnaGLN1 mRNA sequencing. A. thaliana Gene AtGLN1.1 AtGLN1.2 AtGLN1.3 AtGLN1.4 B. napus Gene BnaA.GLN1.1.a BnaC.GLN1.1.a BnaA.GLN1.2.a BnaC.GLN1.2.a BnaC.GLN1.3.a BnaA.GLN1.3.a BnaA.GLN1.3.c BnaA.GLN1.4.a BnaC.GLN1.4.b BnaA.GLN1.4.b AtGLN1.5 a b BnaC.GLN1.4.a BnaC.GLN1.5.a Accession (mRNA name) X82997 (BnGSR2.2) b Y12460 (BnGSR2.2) X76736 (BnGSR1.1) Y12459 (BnGSR1.2) JX306690 JX306693 JX306694 a JX306696 JX306697 a JX306692 b JX306698 b JX306699 b JX306700 b JX306701 JX306695 b JX306691 Clone Library (NCBI ID) MPIZp1022G0813Q BN20.052B22 BN40.043K19 ADIS-MPIZ 021 (Lib.16807) Genoplante BN20 (Lib.13978) Genoplante BN40 (Lib.13980) MPIZp1022C0924Q ADIS-MPIZ 021 (Lib.16807) BN15.001A07 MPIZp1022A1123Q Genoplante BN15 (Lib.13977) ADIS-MPIZ 021 (Lib.16807) Genotype Arabella Arabella Arabella Arabella Express 617 JetNeuf JetNeuf Express Tenor Express 617 Express Tenor Express Tenor JetNeuf Express 617 cDNA clone with SNP insertion disrupting the ORF when compared to A. thaliana cds reference sequence and BnaGLN1 contig. Incomplete cds when compared to A. thaliana cds reference sequence. Supplementary Table S2: Primers used for cloning and genetic mapping of BnaGLN1 gene. A. thaliana B. napus Gene Gene AtGLN1.1 BnaA.GLN1.1.a BnaC.GLN1.1.a BnaA.GLN1.2.a BnaC.GLN1.2.a BnaC.GLN1.2.a BnaC.GLN1.3.a AtGLN1.2 AtGLN1.3 AtGLN1.4 Forward primer sequence Reverse primer sequence Usage BnGS1.81 U / L BnGS1.1 U / L TCTTGGTTGGCCTATTGGC TGGTATCTTTTGACCCAAAACCT GAAGTGTGGATTGCTCGTTTT CTACAAGGCTTGTTTGTATGCC ATGAAGTGTGGATTGCTCGTTAC GTGACATCGTGGATGCG GCGTATAAGCAGGCCTTGTAG CGGATTGATGCTCCACGA ACCCCATTTGAAAGTGTTGATA CGAGCAATCCACACTTCATC GTGTGAGCACCAGCTCCA CAAGAGAACGTGTTGATGTCC BnaA.GLN1.3.a BnGS1.2 U / L GGGAGCTGACAAGGCAA GCCTTCTTTCTCAGTGTCTCTC BnaC.GLN1.3.b BnaA.GLN1.3.b BnaA.GLN1.3.c BnGS1.31 UP2 / RP2 BnGS1.32 U / L BnGS1.41 U / L AGCTTCGACCCAAAACC TTGAAGGGATTAGTGCC ACGTTGCCAAGGAGGTG GCTTTCTTTATCACCGCTAGT TACTGTAGTTGCAGTGCG CGGAACTGGTTTAGGGTCG BnaC.GLN1.3.c BnGS1.42 U / L TTGCCAAAGAAGTGCCTT AGGGAAGCCACCAACAG BnaA.GLN1.4.a BnaC.GLN1.4.a BnGS1.61 5U / 5L BnGS1.7 2U / 2L BnGS1.7 4U / 5L BnGS1.64 5U / 5L BnGS1.64 2U / 2L BnGS1.63 4U / 5L BnGS1.63 2U / 3L BnGS1.51 U / L BnGS1.52 U / L TTCAGATTCCTAGAAAAATGTCG TGTCGGCTCTTGCAGATTTAAT CTCCCGGCGATGATAGTG ATCCCGGCAAACAAAAGG TCTCGATCTCTCCGATTCCA GTGAACCGATTCCGACGAAC GATCAATCTCGATCTCTCCGATTA AGGGAAGCCACCAACAG CAGAAAAAATGTCTCCACTCTCC TCAAGGTTTCTTCCTTCATGG ATCATCGCCGGGAGCTTGC TTCCTCATTCATGGTTTCCAG TTTTGTTTGCCGGGATCG CCGGCCATTTAATATCCTTTT TTCTTCATTCATGGCTTCCA CCTACCGGCCACTTAATATCC TCATGCTTCCCAGTGAGG CCATCCACAATGTCACGC Panel , add a b Panel , add a Panel a b Panel , add c SD a b Panel , add d a DS , Panel , b add a b Panel , add a Panel d a DS , Panel c a SD ,Panel , b add a Panel , cloning a Panel , cloning Cloning a Panel , cloning Cloning a Panel Cloning a Panel e a DY , Panel BnaA.GLN1.4.b BnaC.GLN1.4.b AtGLN1.5 a Primer couple F / R primer name BnGSR2.1 U / L BnGS1.9 U / L BnGS1.82 U / L BnaC.GLN1.5.a BnaA.GLN1.5.a BnGSR1-2_Y12459_cDNA-M1-F / R Panel of B. napus, B. oleracea and B. rapa genotypes. Monnosomic and polysomic addition lines obtained from a cross Darmor-bzh x C1.3. c Mapping population Stellar x Drakar. d Mapping population Darmor x Smouraï. e Mapping population Darmor-bzh x Yudal. b a b Supplementary Table S3: Specific primers used for sequencing BnaGLN1 cDNAs. A. thaliana Gene AtGLN1.3 AtGLN1.4 B. napus Gene BnaC.GLN1.3.a Accession JX306690 BnaA.GLN1.3.a JX306693 BnaA.GLN1.3.c JX306694 BnaA.GLN1.4.a JX306692 BnaC.GLN1.4.a JX306696 JX306697 JX306695 BnaC.GLN1.4.b BnaA.GLN1.4.b AtGLN1.5 BnaC.GLN1.5.a JX306698 JX306699 JX306700 JX306701 JX306691 Primer name GS1-1-13G8-1 GS1.1-rev-1 GS1.1-rev-2 BnGS_ContigEST2_1 GS1.2-52B22-1 GS1.2_EST_1 GS1.2-rev-1 GS1.2-rev-2 BnGS_ContigEST4_1 GS1.41_EST_1 GS1-41-rev-1 GS1-41-rev-2 BnGS_ContigEST6_1 GS1-61-24C9-1 GS1.61-rev-1 GS1.61-rev-2 GS1-61-6U GS1-61-3L BnGS_ContigEST7_1 GS1.7_EST_1 GS1-7-rev-1 GS1-7-rev-2 GS1-63-2U GS1-63-L GS1-64-2U GS1-64-2L GS1-51-23A11-1 GS1.51-rev-1 GS1.51-rev-2 Primer sequence CGATGAGGAACGACGGAG GAAACTAGGAAGAAAAAAAA CCAGTTCACACCCTTTTG GCTAGATACCTTCTCGAGAG CGGTGAGAGTGGGGAGAGAC TCAGCTTCGACCCTAAACCA TTATTGAAACCGAAATAGAC TTGTGCCTCTTGTTGGTC AACCAGTTCCGGGTGATTGG GTGATTGGAACGGAGCTGGA CATCATGAAAATCCTTTATTT CGTTAGGATGGCTAAAGA GTAGATGCTCATTACAAAGC TGGAAGACACGAGACTGCTG TTATTTCTTGGAAAGAGTTT GTAGTATGGTCCCTGAGGA CACCAAGTCGATGAGGGAAG CTTCCCTCATCGACTTGGTG GTTGTTTTATCTCTTGACCC CGATGAGAGAAGATGGAGGG GACCGAGACTTGAATCTTGT ATACCATGTTTCTTCGGC GATCAATCTCGATCTCTCCGATTA CCAACCTACCGGCCATTTA TCTCGATCTCTCCGATTCCA CCGGCCATTTAATATCCTTTT GGAGCATCGGTGAGAGTGG CAAACTGAAATTAAACCG ACCAGGAAAGCCACCAAG Supplementary Table S4: qPCR Primers used for BnaGLN1 gene expression analysis. A. thaliana B. napus Reference gene Target gene(s) At3g01150 (AtPTB) At1g13320 (AtPP2A) At1g07920 (AtEF1α) At2g28390 (AtSAND) At5g25760 (AtUBC21) At5g37600 (AtGLN1.1) BnaX.PTB.a BnaX.PP2A.a BnaX.EF1.a BnaX.SAND.a BnaX.UBC21.a BnaA.GLN1.1.a BnaC.GLN1.1.a BnaA.GLN1.2.a BnaC.GLN1.2.a BnaC.GLN1.3.a BnaA.GLN1.3.a BnaC.GLN1.3.b BnaA.GLN1.3.b Bna.GLN1.3.c a BnaA.GLN1.4.a BnaC.GLN1.4.a BnaC.GLN1.4.b BnaA.GLN1.4.b Bna.GLN1.5.a a BnGSL1 BnGSL2 At1g66200 (AtGLN1.2) At3g17820 (AtGLN1.3) At5g16570 (AtGLN1.4) At1g48470 (AtGLN1.5) At5g35630 (AtGLN2) a Reference sequence or accession EV058089 EE464526 CD827228 EV384210 EE493452 BnaGLN1.1_C1 BnaGLN1.1_C2 BnaGLN1.2_C1 BnaGLN1.2_C2 BnaGLN1.3_C1 BnaGLN1.3_C2 BnaGLN1.3_C3 BnaGLN1.3_C4 BnaGLN1.3_C5 BnaGLN1.4_C1 BnaGLN1.4_C2 BnaGLN1.4_C3 BnaGLN1.4_C4 BnaGLN1.5_C1 X72751 Y12458 Primer names forward / reverse Forward primer sequence Reverse primer sequence BnPTB-UP / RP BnPP2A-UP1 /RP1 Q-BnEF1-1-UP6 /RP6 BnSAND-UP / RP UBC21-UP1 /RP1 BnGSR2-1_X82997_cDNA-M1-F / R BnGSR2-2_Y12460_cDNA-M2-F / R BnGSR1-1_X76736_cDNA-M1-F / R BnGSR1-2_Y12459_cDNA-M1-F / R BnGS_contigEST_1-M3-F / R BnGS_contigEST_2-M1-F / R BnGS1_31_UP2 / RP2 BnGS1_32_UP2 / RP2 BnGS_contigEST_4-M2-F / R BnGS_contigEST_6-M1-F / R BnGS_contigEST_7-M2-F / R BnGS1_63_UP2 / RP2 BnGS1_64_UP2 / RP2 BnGS_contigEST_5-M2-F / R BnGSL1_X72751_cDNA-M3-F / R BnGSL2_Y12458_cDNA-M1-F / R AGCGAAAGAAGCATTGGAAG GCTTCAATCCCTCAATCCCTCATTCCAA CGGTGTCATCAAGAGCGTTG CTGCTATGCTGGGTCACTCC GTCCTCTCAACTGCGACTCA TCTTGGTTGGCCTATTGGC CCTGTTGGTTGGCCTATTG AAAGATGTGAATTGGCCTGTC CTACAAGGCTTGTTTGTATGCC GTGACATCGTGGATGCG GAGCGATCCATCAAAGCTG AGCTTCGACCCAAAACC CTGTTGAAGGGATTAGTGCC ATGCATACACACCGGCC GAACCGATCCCAACCAAC GCTGGAATCAATGTCAGTGG GACATAGTAGATTCTCATTACAAAGCC AGCTGGGAAAGGGTACTTC TCGATCATCCCAATGTGAAG GGAGCGTATCCTGGTCCC ATTCCAAGTTGGCCCGA CAGGAGTAGGCTCAGATCAGG ATCCTCGCTTAGCTCCACAA GGACTTTGATTCATCTGCGGAT TGATTGCATATCTTTATCGCCATC GTGTGTACATGCGTGCCATT GCGTATAAGCAGGCCTTGTAG TCCATTGATGCCACTAATGG GCATCAACAATGTCTCTTCCA CGAGCAATCCACACTTCATC AACAGGACCGACTTGGAAC TGAACGGATCACGGAATATC GCTTTCTTTATCACCGCTAGT GGACTGGTTTTGGGTCG TCTTGCTCAATCCCATACCA GGCCACTTAGTATCCTTTTGG CGACCCAGACCTGATCG CGAGCGACCCAGACTTG ATGGCTTCCAGAGGATTGT CAATAGTACGGTCCCTGAGG GTCCTGGCATAACTTCACCA AACCAGCACCGTTCCAGT Primers are not specific to one target gene but towards both BnaA.GLN1 and BnaC.GLN1 genes. Supplementary Table S5: Induction of BnaGLN1 genes expression under low N fertilisation in field grown plants. BnaGLN1 genes expression level were monitored in limbs and stems from plants grown in field, supplemented (HN) or not (LN) with nitrogen, in young and old tissues harvested at early flowering and seed filling stages (60 and 71 to 73 on BBCH scale). Data are presented as Log Ratio defined as log2(LN/HN). * indicate significant differences (Student Test, p<0.05), mean of four plants repeat. BnaA.GLN1.1.a BnaC.GLN1.1.a BnaA.GLN1.2.a BnaC.GLN1.2.a BnaA.GLN1.3.a BnaC.GLN1.3.a BnaA.GLN1.3.b BnaC.GLN1.3.b BnaGLN1.3.c BnaA.GLN1.4.a BnaC.GLN1.4.a BnaA.GLN1.4.b BnaC.GLN1.4.b BnGSL1 BnGSL2 Early flowering Limb Stem Old Young Old Young 0.06 0.44* 0.18 1.71* -0.12 0.23 0.46 1.22* -0.06 -0.43* -0.09 -0.06 -0.21 -0.49* 0.11 0.00 0.20 -0.29 -0.33 -0.18 0.27* -0.05 -0.37 -0.07 1.00* -0.51* -0.19 -0.01 0.90 -0.38 -0.32 -0.12 -0.18 -0.05 0.01 -0.01 0.27 0.20 0.47 0.96* 0.28 -0.03 0.65* 0.70* -0.52 0.22 0.95 0.84* -0.48 -0.48* 1.97* 0.72* 0.29 -0.13 0.92 0.23 0.14 -0.14 0.86 0.10 Seed filling Limb Stem Old Young Old Young -0.01 -0.03 -0.83 -0.26 -0.25 0.00 -0.84 -0.38 -0.50 -0.26 -1.53 -0.33 -0.40 0.04 -1.22* 0.12 0.26 0.16 -0.76* -0.33 0.43* 0.26 -0.74* 0.02 -0.07 0.09 -1.38 -0.21 0.14 0.25 -0.35 0.19 0.37 -0.14 -0.86 -0.17 0.44 0.13 -0.88 -0.41 0.21 0.05 -0.40 -0.23 0.20 -0.45 -0.01 -0.06 0.47 -0.02 0.39* 0.07 0.26 0.34 0.40* -0.01 0.25 0.17 0.04* -0.24 * Statistically significant induction under LN (bilateral t test, p-value < 0.05). Supplementary Figure legends Supplementary Figure S1: BnaGLN1 genes localisation on A or C genome using a panel of various Brassica genotypes. Amplification of DNA fragments for each BnaGLN1 gene on Brassica napus (1, Darmor-bzh; 2, Yudal; 3, Stellar; 4, Drakkar; 5, Samouraï; 6, Aburamasari; 7, Aviso; 8, Tenor; 9, Express; 10, Montego), Brassica rapa (11, Z1; 12, C1.3; 13, Chiifu) and Brassica oleracea (14, HDEM; 15, C102) were performed using specific primers designed for each gene (Supplementary Table S1) in order to reveal a presence / absence polymorphism between B. rapa (A) and B. oleracea (C) genomes. Water control is presented (lane 16). Genes in bold letters are also mapped on the genetic map (Supplementary Figure S3). Stars indicate genes for which there is no agreement with the genetic mapping performed on segregating populations or for which some results remain uncertain. Supplementary Figure S2: BnaGLN1 genes localisation on LG using mono- and polysomic additional lines. Amplification of specific DNA fragment for each BnaGLN1 gene was performed on mono- and polysomic additional lines selected among the descendants from a cross between Brassica napus Darmor-bzh and Brassica rapa C1.3. Each line is carrying the full A genome (mixture from B. napus and B. rapa) and one or several C chromosomes originating from Brassica napus Darmor-bzh. Specific primers designed for each gene (Supplementary Table S1) were used in order to reveal the presence or absence of specific amplicon on additional C chromosomes carried by the plant lines (indicated above each lane, Auger et al., 2009). Supplementary Figure S3: Positions of BnaGLN1 genes on B. napus genetic map. Markers corresponding to BnaGLN1 genes mapping positions are indicated with stars. Cumulative distances between each marker are given in cM on left side of the chromosome representation. DS, SD and DY are referring to Darmor x Samouraï, Stellar x Drakkar and Darmor-bzh x Yudal double haploid mapping populations and reference maps (Lombard and Delourme, 2001; Delourme et al., 2006). Markers are coloured according to the localisation of their homologous region identified in A. thaliana (chromosome C1 to C5). Supplementary Figure S4: Alignments of genomic sequence, deduced mRNA sequence and contigs’ sequence are reported for each BnaGLN1 gene. Supplementary Figure S5: Expression of BnaGLN1 genes is modified depending on nitrate availability and ageing in primary veins of vegetative B. napus plants. BnaGLN1 genes relative expression level was monitored in primary veins of six leaf ranks harvested on vegetative plants grown under low (white bars) or high (black bars) nitrate conditions. Leaf ranks represented as number 1 (bottom and older leaf) to 6 (top and younger leaf) showed differential senescence symptoms. Mean and standard deviation of four plant repeats are shown. B. napus 1 2 3 B. rapa 4 5 6 7 8 B. oleracea 9 10 11 12 13 14 15 16 BnaA.GLN1.1.a BnaA.GLN1.2.a BnaA.GLN1.3.a BnaA.GLN1.3.b BnaA.GLN1.3.c BnaA.GLN1.4.a BnaA.GLN1.4.b BnaA.GLN1.5.a BnaC.GLN1.1.a BnaC.GLN1.2.a BnaC.GLN1.3.a BnaC.GLN1.3.b BnaC.GLN1.3.c BnaC.GLN1.4.a BnaC.GLN1.4.b BnaC.GLN1.5.a Supplementary Figure S1: BnaGLN1 genes localisation on A or C genome using a panel of various Brassica genotypes: Amplification of DNA fragments for each BnaGLN1 gene on Brassica napus (1, Darmor-bzh; 2, Yudal; 3, Stellar; 4, Drakkar; 5, Samouraï; 6, Aburamasari; 7, Aviso; 8, Tenor; 9, Express; 10, Montego), Brassica rapa (11, Z1; 12, C1.3; 13, Chiifu) and Brassica oleracea (14, HDEM; 15, C102) were performed using specific primers designed for each gene (Table S1) in order to reveal a presence / absence polymorphism between B. rapa (A) and B. oleracea (C) genomes. Water control is presented (lane 16). Genes in bold letters are also mapped on the genetic map (supplemental figure S1). Stars indicate genes for which there is no agreement with the genetic mapping performed on segregating populations or for which some results remain uncertain. Water C4 C5 C1 C2 C2 C6 C4 C3 C8 C1 C2 C3 C9 C5 C7 C8 C1 C5 C7 C8 C8 C9 C9 BnaA.GLN1.3.a A BnaC.GLN1.3.c C03 BnaC.GLN1.3.a C05 BnaC.GLN1.1.a C06 Water C1.3 C4 C5 C2 C2 C1 C6 C8 C3 C4 C8 C7 C5 C9 C2 C3 C1 C9 C9 C8 C8 C7 C1 C5 BnaA.GLN1.1.a A BnaC.GLN1.3.b C01 Supplementary Figure S2: BnaGLN1 genes localisation on linkage group using mono- and polysomic additional lines. Amplification of specific DNA fragment for each BnaGLN1 gene was performed on mono- and polysomic additional lines selected among the descendants from a cross between Brassica napus Darmor-bzh and Brassica rapa C1.3. Each line is carrying the full A genome (mixture from B. napus and B. rapa) and one or several C chromosomes originating from Brassica napus Darmor-bzh. Specific primers designed for each gene (Table S1) were used in order to reveal the presence or absence of specific amplicon on additional C chromosomes carried by the plant lines (indicated above each lane, Auger et al. 2009). A03_DS 0 4 6 12 14 17 27 31 43 46 50 53 61 67 74 75 76 78 83 87 92 94 103 117 128 129 135 146 W05.1800 E3M3.03 E1M7.08 PFM228 T11.1250 a4NF5c E4M4.F E1M7.18 W08.2360 Y02.CD1 PFM193 BnaA.GLN1.3.c BN466 BN594 O20.1300 BN358b E1M4.D C04.1500 A16.3250 E3M6.11 W05.630 E2M4.J E2M4.I J04.1295 E2M7.08 E1M3.10 Y04.830 T17.CD1 BN711a IGF5272c A05_DS A06_DY 0 0 26 31 45 52 53 57 58 62 65 68 70 84 94 109 a4NF4b O19.480 Y01.1640 Y05.1300 At3g22500 At3g22490 P05.2500 BN248 X12.1200 K10.800 BN396b E1M7.22 E1M3.B E3M3.06 E1M4.21 BnaA.GLN1.3.a BN614 E1M5.03 W03.500 PFM175 22 26 29 40 43 51 53 55 60 68 70 71 74 75 76 80 88 99 108 111 112 115 121 134 141 146 149 157 BnaA.GLN1.5.a BN52344a BN57463 PFM576 PFM581 sN2837a Na12D08 sR9411 Bras052 BN51296 sN12750c Ra1F06b Ra2D04 BRMS252b BN57360 CB10065 sN2189b Na12H06 BN60657 BN50801X Na10B04b Na12A08c Na12G11 sN1939Fb sN1939Rb BN50903 BN51495 Bras028 BRMS309b ChiA.2 PFM191a Na12G05b Na12B08 Na10E02b sS1949a sNRB93a Bras115 PFM023 sR12156a Gai Bzh C02_SD C03_SD 0 0 16 41 50 59 64 68 71 75 80 85 88 93 99 106 110 119 134 136 140 Supplementary Figure S3: Positions of BnaGLN1 genes on B. napus genetic map. Markers corresponding to BnaGLN1 genes mapping positions are indicated with stars. Cumulative distances between each marker are given in cM on left side of the chromosome representation. DS, SD and DY are referring to Darmor x Samouraï, Stellar x Drakkar and Darmor-bzh x Yudal double haploid mapping populations and reference maps (Lombard and Delourme, 2001; Delourme et al. 2006). Markers are coloured according to the localisation of their homologous region identified in A. thaliana (chromosome C1 to C5). W19.1450 C18.1250 PFM504 BnaC.GLN1.2.a J15.1200 T11.1000 A01.1000 S13.450 E3M1.C E1M5.D E1M5.E P14.1720 Y01.2100 P08.1200 L12.800 I11.510 S18.1300 PFM408 N01.1300 E2M7.14 E2M4.E J04.1400 PFM293 PFM257 12 23 33 39 43 57 58 64 102 119 120 122 125 139 153 158 165 178 204 212 219 221 222 228 246 252 264 288 305 313 320 323 326 327 332 340 354 370 Lap.1C H07.1700 Bn40C1 E4M4.02 FAE1.C B15.1130 E3M1.02 E2M6.16 E2M6.17 S4No0233 IGF3222b PFM92 PFM491 BN04C At3g21260 BnaC.GLN1.3.c S2No0522 At3g19920 IGF0193c C04.1040 IGF5376b E2M7.E B07.1200 E2M4.06 E1M1.M E4M6.05 PFM309 E3M1.05 E1M7.21 E2M6.08 E2M7.10 E1M5.H E4M4.L E4M4.16 W09.1500 C09.1500 PFM436 X01.600 B15.900 At3g15690 R06.1360 Y04.870 E1M5.08 E2M4.02 E2M1.05a R16.1500 Y15.850 PFM243 C18.900 R12.2000 F14.2200 PFM431a PFM431b At C1 At C2 At C3 At C4 At C5 Supplementary Figure S4: Alignments of genomic sequence, deduced mRNA sequence and contig of ESTs sequence are reported for each BnaGLN1 gene. file:///C:/Users/Camille/Desktop/1380102297.gif[25/09/2013 11:45:38] file:///C:/Users/Camille/Desktop/1380102297.gif[25/09/2013 11:45:38] file:///C:/Users/Camille/Desktop/C1a.gif[25/09/2013 11:48:14] file:///C:/Users/Camille/Desktop/C1a.gif[25/09/2013 11:48:14] file:///C:/Users/Camille/Desktop/C1a.gif[25/09/2013 11:48:14] file:///C:/Users/Camille/Desktop/A2a.gif[25/09/2013 11:51:24] file:///C:/Users/Camille/Desktop/A2a.gif[25/09/2013 11:51:24] file:///C:/Users/Camille/Desktop/A2a.gif[25/09/2013 11:51:24] file:///C:/Users/Camille/Desktop/C2a.gif[25/09/2013 11:54:20] file:///C:/Users/Camille/Desktop/C2a.gif[25/09/2013 11:54:20] file:///C:/Users/Camille/Desktop/C2a.gif[25/09/2013 11:54:20] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/A3a.gif[25/09/2013 13:26:32] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/A3a.gif[25/09/2013 13:26:32] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/C3a.gif[25/09/2013 13:29:05] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/C3a.gif[25/09/2013 13:29:05] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/A3b.gif[25/09/2013 13:27:18] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/A3b.gif[25/09/2013 13:27:18] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/A3b.gif[25/09/2013 13:27:18] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/C3b.gif[25/09/2013 13:29:18] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/C3b.gif[25/09/2013 13:29:18] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/A3c.gif[25/09/2013 13:27:46] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/A3c.gif[25/09/2013 13:27:46] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/C3c.gif[25/09/2013 13:29:32] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/C3c.gif[25/09/2013 13:29:32] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/A4a.gif[25/09/2013 13:28:12] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/A4a.gif[25/09/2013 13:28:12] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/C4a.gif[25/09/2013 13:29:57] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/C4a.gif[25/09/2013 13:29:57] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/A4b.gif[25/09/2013 13:28:26] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/A4b.gif[25/09/2013 13:28:26] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/A4b.gif[25/09/2013 13:28:26] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/C4b.gif[25/09/2013 13:30:10] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/C4b.gif[25/09/2013 13:30:10] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/A5a.gif[25/09/2013 13:28:44] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/A5a.gif[25/09/2013 13:28:44] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/C5a.gif[25/09/2013 13:30:22] file:///C:/Users/Camille/Desktop/Supp%20Figure%20alignements/C5a.gif[25/09/2013 13:30:22] A Relative expression units E B C D F G H I J K M N O Primary vein ranks Primary vein ranks Primary vein ranks L P Primary vein ranks Supplementary Figure S5: Expression of BnaGLN1 genes is modified depending on nitrate availability and ageing in primary veins of vegetative B. napus plants. BnaGLN1 genes relative expression level was monitored in primary veins of six leaf ranks harvested on vegetative plants grown under low (white bars) or high (black bars) nitrate conditions. Leaf ranks represented as number 1 (bottom and older leaf) to 6 (top and younger leaf) showed differential senescence symptoms. Mean and standard deviation of four plant repeats are shown.
© Copyright 2026 ExpyDoc