Electronic Supplementary Material (ESI) for Chemical Communications. This journal is © The Royal Society of Chemistry 2014 Supporting Information Label-free, isothermal and ultrasensitive electrochemical detection of DNA and DNA 3’-phosphatase by using a cascade enzymatic cleavage strategy Shufeng liu*, Tao Liu, and Li Wang Key Laboratory of Sensor Analysis of Tumor Marker, Ministry of Education, College of Chemistry and Molecular Engineering, Qingdao University of Science and Technology, Qingdao 266042, China. E-mail: [email protected] Table of contents Experimental section----------------------------------------------------------------------S2-S3 Table S1 ------------------------------------------------------------------------------------S4 Figure S1 -----------------------------------------------------------------------------------S5 Figure S2 -----------------------------------------------------------------------------------S6 Figure S3 -----------------------------------------------------------------------------------S7 Table S2 ------------------------------------------------------------------------------------S8 Figure S4------------------------------------------------------------------------------------S9 Figure S5------------------------------------------------------------------------------------S10 Figure S6------------------------------------------------------------------------------------S11 Figure S7------------------------------------------------------------------------------------S12 Figure S8------------------------------------------------------------------------------------S13 Figure S9------------------------------------------------------------------------------------S14 Figure S10----------------------------------------------------------------------------------S15 Figure S11----------------------------------------------------------------------------------S16 References----------------------------------------------------------------------------------S17 S1 Experimental section. Chemicals and reagents. 6-Mercaptohexanol was purchased from Sigma-Aldrich (St. Louis, MO, USA). The Bst DNA polymerase, Large Fragment, Lambda Exonuclease, Nb.BbvCI nicking endonuclease, and T4 polynucleotide kinase phosphatase (PNKP) were purchased from New England Biolabs Ltd. (Ipswich, MA, USA). Human thrombin was supplied by Dingguo Biotech Co., Ltd. (Beijing, China). Lysozyme was bought from Tiangen Biotech Co, Ltd. (Beijing, China). Bovine serum albumin (BSA), human IgG, deoxyribonucleoside triphosphates (dNTPs) and fetal bovine serum were purchased from Sangon Biotech. Co., Ltd. (Shanghai, China). All other chemicals were of analytical grade and used as received. The HPLC-purified oligonucleotide sequences are purchased from Sangon Biotech. Co., Ltd. (Shanghai, China) and listed in Table S1. Apparatus. All electrochemical measurements were carried out by using a CHI 660D electrochemical workstation (CH Instruments, Shanghai, China) at room temperature. A conventional three-electrode system was used, which comprised a gold working electrode (2 mm diameter), a platinum wire auxiliary electrode, and a Ag/AgCl reference electrode. Electrode Pretreatment. The gold electrode was cleaned by immersion in a freshly prepared piranha solution (a 3:1 v/v mixture of concentrated H2SO4 and 30% H2O2) for 20 min, followed by a thoroughly rinse with ultrapure water. Then the electrode was polished on a microcloth (Shanghai Chenhua Inc., China) with 50 nm alumina slurry to obtain a mirror surface, followed by sonication in acetone and ultrapure water for 5 min each, to remove residual alumina powder. The well-polished electrode was then subjected to electrochemical pretreatment by cycling the potential between 0.2 and 1.5V in H2SO4 (0.5 M) at a scan rate of 100 mV s-1 until a stable cyclic voltammogram was obtained, and then the cleaned electrode was allowed to be dried at room temperature. Immobilization of hairpin DNA probe (HP) on Au Surface. The assembly of hairpin DNA probe (HP) on the electrode surface was carried out according to the S2 following procedures. The HP1 is used for target DNA detection and HP2 or HP3 is used for PNKP detection. The HP was firstly heated to 90 °C for 5 min and then allowed to cool to room temperature for at least 2 hours before use. Then, the cleaned gold electrode was incubated into 50 µL of 1 µM HP in 20 mM Tris-HCl buffer (0.1 M NaCl, 10 µM TCEP, pH 7.4) for 12hr at room temperature and then thoroughly rinsed with ultrapure water and dried under a stream of nitrogen gas. The electrode was subsequently immersed in 1 mM MCH solution for 1 hour to remove the nonspecific DNA adsorption. Then the electrode surface was rinsed thoroughly and dried in nitrogen. Target DNA recognition and one-pot cascade enzymatic cleavage. The DNA hybridization and enzymatic amplification experiments were performed with the incubation of HP1 assemblied electrode into 50 µL 20mM Tris-HCl buffer (140mM NaCl, 5mM MgCl2, pH 7.4) consisting 10 U nicking endonuclease, 7.5 U lambda exonuclease, 8 U Bst DNA polymerase, 1µM primer, 200 µM dNTPs and various concentration of target DNA. All reactions were performed at 37oC for 60 min (except for the time-course study). Then, the electrode was thoroughly rinsed and dried in nitrogen. Assay for PNKP activity. The HP2 immobilized electrode was incubated into 50 µL 20mM Tris-HCl buffer (140mM NaCl, 5mM MgCl2, pH 7.4) containing different concentration of PNKP at 37oC for 60 min. Then, the electrode was thoroughly rinsed and incubated into 50 µL 20mM Tris-HCl buffer (140mM NaCl, 5mM MgCl2, pH7.4) consisting 10 U nicking endonuclease, 7.5 U lambda exonuclease, 8 U Bst DNA polymerase, 200 µM dNTPs for 60 min at 37oC. After the reaction, the electrode was rinsed and dried in nitrogen. Electrochemical detection. The above treated gold electrode, as the working electrode, was immersed into the electrochemical cell containing 5 mM [Fe(CN)6]3−/4−and 1 M KNO3 for electrochemical measurement. Before measurements, the electrolyte solution should be thoroughly purged with high purity nitrogen for about 20 min. The differential pulse voltammograms (DPV) were recorded with the potential window from 0.6 V to -0.1 V. The electrochemical impedance spectra (EIS) S3 were recorded with the frequency range from 0.1 Hz to 10 kHz. Table S1. DNA sequences used in the experimentsa Name Sequence (5’ to 3’) HP1 SH-(CH2)6- AAGCTGAGGTCTTGGACTAGATCTTCCAGTGTGAT GAAGTCCAAGATTT HP2 SH-(CH2)6-GCTGAGGAGAGATACGCACCTAAAAAGGGTGCG TA-PO4 HP3 SH-(CH2)6-GCTGAGGAGAGATACGCACCTAAAAAGGGTGCG TD 1MT 2MT NC TA-OH TCATCACACTGGAAGACTC TCATCTCACTGGAAGACTC TCATCTCACGGGAAGACTC ACGTTGCATATCGACTAGC HP1 is used for target DNA detection. HP2 and HP3 are used for PNKP detection. TD, 1MT, 2MT and NC denote target DNA, single-base mismatched DNA, two-base mismatched DNA and non-complementary DNA, respectively. The underlined letters in 1MT and 2MT indicate the mismatched bases. a S4 Figure S1. Optimization of probe DNA (HP1) immobilization concentration. The used concentrations are 0.1, 0.5, 1.0, 1.5, 2.0 µM, respectively. The target DNA concentration is 0.1 nM. The peak current increase for y-axis indicates the electrochemical response difference in the presence and absence of target DNA. The error bars represent the standard deviation of three measurements. S5 Figure S2. (A) The effect of the nicking endonuclease concentration on the electrochemical response of the sensing system for target DNA detection. The studied amounts were 4, 6, 8, 10 and 12 U. (B) Optimization of lambda exonuclease amount for target DNA detection. A series of amounts including 3, 4.5, 6, 7.5 and 9 U were used. The concentration of used target DNA was 0.1 nM. The error bars represent the standard deviation of S6 three measurements. Figure S3. (A) The time response of DPV peak current toward target DNA (0.1 nM) detection in the presence of polymerase, lambda exonuclease and nicking endonuclease (square), and absence of lambda exonuclease (triangle). (B) The optimization of reaction temperature for target DNA (0.1 nM) detection. The current increase for y-axis indicates the electrochemical response difference in the presence and absence of target DNA. The error bars represent the standard deviation of three measurements. S7 Table S2. Comparison of detection performance for current fabricated DNA biosensor with the reported electrochemical methods Method Detection limit strategy Signal reporter Ref. ACV 2×10-9 M Lambda exonuclease based target Methylene blue 1 SWV 2×10−14 RuHex 2 DPV 1.67×10-13 M Ferrocence 3 EIS 4.2×10−11 M Fe(CN)63-/4- 4 DPV 1×10−15 M RuHex 5 Fe(CN)63-/4- 6 Circular strand-displacement Alkaline 7 polymerase reaction and HCR phosphatase Restriction endonuclease-aided Methylene blue 8 Methylene blue 9 Fe(CN)63-/4- This work recyling M Exonuclease III-aided target recycling Nicking endonuclease assisted signal amplification Lambda exonuclease based target recycling Exonuclease I cleavage and biobarcode amplification EIS 1×10−14 M Exo III-based target recycling and graphene/Au nanocomposites ×10−14 DPV 0.8 M DPV 1×10-9 M ACV 1.4×10−11 DPV 1×10−14 M target recycling M Restriction endonuclease-aided target recycling Cascade enzymatic cleavage amplification Alternating-current voltammogram (ACV); Square wave voltammogram (SWV); Differential pulse voltammogram (DPV); Electrochemical impedance spectroscopy (EIS) S8 Figure S4. (A) DPV responses toward the blank and four various DNA sequences including complementary target DNA (TD), single-base mismatched DNA (1MT), two-base mismatched DNA (2MT), and non-complementary DNA (NC). The concentrations of various DNA sequences were all 0.1 nM. (B) The bar chart of the DPV responses toward various DNA sequences. Error bars represent standard deviations of measurements (n=3). S9 Figure S5. (A) The schematic illustration for target DNA detection in the absence of lambda exonuclease. It could be denoted as a one-recyling amplification strategy. (B) DPV responses of the fabricated one-recycling amplification system toward the analysis of different concentrations of target DNA: (a) 0 pM, (b) 1 pM, (c) 10 pM, (d) 20 pM, (e) 50 pM, (f) 100 pM, (g) 1 nM, (h) 10 nM. (C) The linear plot of DPV peak currents vs target DNA concentration from 1 pM to 100 pM. The error bars represented the standard deviation of three repetitive measurements. S10 Figure S6. DPV peak current obtained for the fabricated DNA biosensor in buffer and 2% fetal bovine serum (50 fold diluted) spiked with two different target DNA concentrations. The error bars represent the standard deviation of three measurements. S11 Figure S7. (A) Cyclic voltammetric characterization; (B) Differential pulse voltammetric characterization; (C) Electrochemical impedance spectroscopic characterization. The curves (a), (b), (c) and (d) in A, B and C were obtained for bare gold electrode, HP2 modified electrode, PNKP treated electrode and the control electrode in the absence of PNKP, respectively. The used PNKP concentration is 1 U mL-1. S12 Figure S8. (A) The corresponding DPV responses for HP2 assembled electrode after 3’-dephosphorylation reaction (black line), and HP3 assembled electrode in the absence of PNKP (red line), respectively. The used PNKP concentration is 1 U mL-1. (B) Bar chart for DPV responses obtained at different experimental conditions toward PNKP detection. The x-axis shows the corresponding experimental conditions. The error bars represented the standard deviation of three repetitive measurements. S13 Figure S9. Time optimization of dephosphorylation reaction. The used time were 15, 30, 45, 60, 90 min, respectively. The error bars represent the standard deviation of three measurements. The inset shows the corresponding DPV responses at different time. S14 Figure S10. (A) Schematic illustration for the detection of DNA 3’-phosphatase in the absence of lambda exonuclease. (B) The bar chart of DPV responses obtained in the presence and absence of lambda exonuclease toward the detection of different concentrations of PNKP. The error bars represented the standard deviation of three repetitive measurements. S15 Figure S11. Selectivity of the fabricated sensor towards PNKP compared to other interfering proteins. The concentration of PNKP is 1 U mL-1. The concentration for other interfering proteins like BSA, thrombin, lysozyme and IgG are all 0.1 μM. The “Blank” at the X-axis indicate the electrochemical response in the absence of PNKP. S16 References [1] K. Hsieh, Y. Xiao and T. Soh, Langmuir, 2010, 26, 10392. [2] D. Wu, B. C. Yin and B. C. Ye, Biosens. Bioelectron., 2011, 28, 232. [3] Z. Liu, W. Zhang, S. Zhu, L. Zhang, L. Hu, S. Parveen and G. Xu, Biosens. Bioelectron., 2011, 29, 215. [4] H. Xu, L. Wang, H. Ye, L. Yu, X. Zhu, Z. Lin, G. Wu, X. Li, X. Liu and G. Chen, Chem. Commun., 2012, 48, 6390. [5] J. Xu, B. Jiang, J. Su, Y. Xiang, R. Yuan and Y. Chai, Chem. Commun., 2012, 48, 3309. [6] Y. Chen, B. Jiang, Y. Xiang, Y. Chai and R. Yuan, Chem. Commun., 2011, 47, 12798. [7] C. Wang, H. Zhou, W. Zhu, H. Li, J. Jiang, G. Shen and R. Yu, Biosens. Bioelectron., 2013, 47, 324. [8] Z. Shen, S. Nakayama, S. Semancik and H. O. Sintim, Chem. Commun., 2012, 48, 7580. [9] Q. Wang, L. Yang, X. Yang, K. Wang, L. He, J. Zhu and T. Su, Chem. Commun., 2012, 48, 2982. S17
© Copyright 2026 ExpyDoc