Reverse Dot-Blot Detection of the African-American P-Thalassemia Mutations By P. Sutcharitchan, R. Saiki, T.H.J. Huisrnan, A. Kutlar, V. McKie, H. Erlich, and S.H. Ernbury DNA-based diagnosis of the P thalassemias provides accuracy to newborn screening, genetic counseling, and prenatal diagnosis. However, the use of polymerase chain reaction (PCRI-based methods is challenged by the great number of different P-thalassemia mutations thatexist even within defined ethnic groups. In this regard, the reverse dot-blot method offers a means of screening for several mutations with a single hybridization reaction. We have applied the reverse dot-blot method to the detection of the P-thalassemia mutations of African-Americans. We used two biotinlabeled primer pairs in a duplex reaction to amplify and label two P-globin targetDNA fragments that encompass all known African-American P-thalassemia mutations. The PCR products were denatured and hybridized to polyT-tailed, membrane-fixed, allele-specific probe pairs for the hemoglobin (Hb) S, Hb C, and 14 @-thalassemiamutations and their corresponding wild-type sequences. Seven common mutations plus Hb S and Hb C were included on one diagnostic strip, and seven lesscommon P-thalassemia mutations were included on another strip. Carefully controlled, high stringency hybridization allowed accurate distinction of these alleles. Reverse dot-blot diagnosis of the less common Pthalassemia mutations precludes the need for alternative, more technically challenging methods. This method provides a rapid, accurate method fordiagnosisof P thalassemia among African-Americans and other ethnic groups in which p thalassemia occurs. 0 1995 by The American Society of Hematology. HE P THALASSEMIAS AND@-globin hemoglobinopathies constitute majorhealth problems forpopulations in which these disorders are prevalent."* The impact of p thalassemia, hemoglobin(Hb) S, and Hb Calleles in the African-American populationrelates to their frequencies and the clinical severity of resultant syndromes. Gene frequencies in this ethnic group are 0.004 for P thalassemia, 0.045 for Hb S, and 0.015 for Hb C.' Homozygosity for P thalassemia and its coinheritance with a sickle cell gene result in symptomatic clinical ' One theof determinants of clinical severity is the extent of impairment of Hb A production; ,F-thalassemia genes donot direct the production of Hb A and often have greater clinicalimpact than P'-thalassemia genes, whichdirectproductionofreduced amounts."~l' Compound inheritanceof Hb S and Hb C genes results in Hb SC disease, avariant of sickle cell disease having a distinct clinical nature.15.'h.'x.'" Proper management of these disorders involves newborn screening, genetic counseling, and prenatal diagnosis; each of which depends on accurate diagnosis.8 Neonatal andprenatal diagnosis by traditional electrophoretic methods may be confounded by highlevelsof Hbanobstacleobviated by direct detection of mutant genes using DNA-based methods.'" Polymerase chain reaction (PCR)-based methods convey to DNA diagnosis the further advantages of convenience, sensitivity, and rapidity."~21~22 However, most PCRbased methods addresssingle, known mutations," which is a 160 different particular disadvantage for diagnosing the over mutationsthat cause /3 thalassemia.27Although P-thalassemia genes are distributed selectively anlong different ethnic groups, mostpopulations have several of these mutations.7.?3 Reverse dot blotting is a PCR-based method with T Frvm the Department vf Medicine, Chulalongkorn Hospitul, ChulalongkornUniversity,Bangkok,Thailand; the C.P. Li Biomedical Reseurch Corporation, Arlington, VA; the Hematology Division oj rhe Department of Medicine, Universiry of California-Sun Fruncisco and The San Francisco General Hospital, San Francisco, and The Northern California Comprehensive Sickle Cell Center, San Francisco,CA; the Department of Human Genetics, Roche Molecular Systems, Alameda, CA; and the Departments (fBiochemist~yand Molecular Biology, Medicine, and Pediatrics, und The Sickle Cell Center, Medical College of Georgia, Augusta, GA. Submitted Januay 6, 199.5; accepted April 5, 1995. Supported in part by grants fromthe National Institutes of Health (HL-2098.5 toS.E. and HLB-05168 t(J T.H.J.H.) andthe Chinu Medical Board of the Fuculty of Medicine. Chulalongkorn Universit.y (to PS.). Portions of the workwerepresentedpreviously in ahstrucr f o r d " and referred to in a book chapter.' Addressreprintrequeststo Stephen H . Embuty, MI), Building 100, Room 263, San FranciscoGeneralHospital, San Francisco, CA 94110. The publication costsof this article were defrayedin part by page chargepayment. This article must thereforebeherebymarked "advertisement" in accordance with 18 U.S.C. seclion 1734 solely lo indicute this fact. 0 199.5 by The American Society of Hematology. 0006-4971/95/8604-0042$3.00/0 1580 the capacity to screen several known mutations in a single hybridization However, mutanumber of the tions that can be included on one hybridization strip is finite," and alternative means for detecting new and unknown mutations must be available in molecular diagnostic laboratories. In this report, we describe the development of reverse dot blotscontainingprobes for the 7 most common AfricanAmerican 0-thalassemia and for the Hb S and Hb C mutations. Moreover, we havedeveloped second a reverse dot-blot strip for the detection of 7 less common AfricanAmerican P-thalassemia genes. These twostrips canbe hybridized separately or simultaneously with duplex PCRamplified, labeled target DNA to screen for all 14 AfricanAmerican P-thalassemia mutations. This diagnosticapproach has utility for routine clinical, neonatal, and prenatal diagnosis in the African-American population. MATERIALS AND METHODS African-American ~-thala.ssemiamutations. Segregatingamong African-Americans are p"- and /?'-thalassemia gene^'^^*'.^^; 0' thalassemia genes are further subdivided into those that, when coinheror severe ited with thesicklecellgene,producemild,moderate, reductions in Hb A production.".'" Most African-American P-thalassemia genes areof the mild P+-thalassemia variety."'." Known point mutations responsible for P thalassemia among African-Americans are listed in Table and their resultant thalassemic phenotypes7."'.'1.'~~z7 I . The mutations at -88 and -29 decrease the efficiency of tranBlood, Vol 86, NO 4 (August 151, 1995: pp 1580.1585 REVERSE DOT-BLOTOF 1581 AFRICAN-AMERICAN P THAL Table 1. The African-American p-ThalssPemia Mutations No. Position Mutation Type 1 2 -88 -29 C-T P’ A+G 3 Codon 6 Codon 24 Codon 30 -A T+A P‘ 8” P’ ?P+ 4 5 6 7 8 9 10 11 12 13 14 IVS 1-2 IVS 1-5 G+C T-C p” G+T P‘ Codon 61 A-T IVS 11-1 IVS 11-848 IVS 11-849 IVS 11-849 Codon 106/107 G-A p” p” C-A A-G A+C +G p” p” Poly A signal T-C P’ P’ p” Published positions and mutations responsible for P thalassemia among African-Ameri~ans.’~’~~’’~~~~” scription; those at codons 6 and 106/107 create frameshifts and premature termination of translation; that at codon 61 creates a nonsense mutation; those at IVS 1-2, IVS II-l, and IVS 11-849 ablate RNA processing; and those at codons 24, IVS 1-5, IVS 11-848, and at the poly A signal impair RNA processing? It is assumed that the codon 30 mutation affects RNA splicing, but its mechanism and phenotype are unknown? The mutations at -29 and -88 account for 80% ofthe P thalassemia among African-Americans””. We have not included in our assessment an -87 C ”+ A Yugoslavian mutationz8 that has also been observed in one African-American ~ubject?~ Design and synthesis of probe pairs. Careful design of probe sequence and application of optimal quantities of probes to hybridization membranes are essential to developing reverse dot-blot methodology. Thermodynamic consideration^'^^'^ were the basis for the design of the probe pairs shown in Table 2 that were used to discriminate between variant and wild-type sequences for Hb S, Hb C, and 14 African-American P-thalassemia mutations. Oligonucleotides were synthesized using phosphoramidite chemistry.’* For closely adjacent mutations, a single normal probe was used; ie, one normal probe was used for the Hb S, Hb C, and codon 6 -A frameshift mutation; one normal probe was used for the IVS I1 and IVS 1-5 mutations; and one normal probe was used for the two IVS 11-848 and the IVS 11-849 mutations. Poly-T tailing of oligonucleotide probes. Oligonucleotide probes (200 pmol) were tailed overnight at 37°C in a 100-pL reaction mixture of 100 mmol/L K cacodylate, 25 mmoVLTris-HC1, 1 mmoU L CoC12, and 0.2 mmol/L dithiothreitol (pH 7.6) with 160 nmol deoxythymidine triphosphate and 60 U of terminal deoxyribonucleotidy1 transferase (Ratliff Biochemicals, Los Alamos, NM). Reactions were stopped by the addition of 100 pL of IO mmoVL EDTA. The length of poly-T tails was monitored by agarose gel electrophoresis to insure that tails of approximately 400 residues were obtained. Tailed oligonucleotides were diluted into 100 pL TE (10 mmoll L Tris-HC1, 0.1 mmol/L EDTA [pH 8.01 ) for application to a nylon membrane (Biodyne-B; Pall, Glen Cove, NY) using a spotting manifold (The Convertible; GIBCO-BRL, Gaithersburg, MD). Damp filters were placed on TE-soaked paper within a UV light box (Stratalinker 1800; Stratagene, La Jolla, CA) and were irradiated at 254 nm, 600 mJ/cm2 to a dose controlled by the internal metering unit of the light box. Filters were rinsed to remove unbound oligonucleotides using 5X SSPE (1 X SSPE: 180 mmoVL NaC1, 10 mmoVL NaH2P0,, l mmoVL EDTA [pH 7.21)with 0.5% sodium dodecyl sulfate (SDS) for 30 minutes at 55°C and were then used immediately for hybridization or were air dried and stored at room temperature. The quantities of probes necessary to distinguish series of mutant and normal alleles were tested and adjusted by trial and error by hybridizing with control DNA samples that were amplified and labeled as described below. The quantities of each applied to filters in picomoles is shown in Table 2. Amplifcation and labeling of rarget DNA. Initially, we amplified the entire &globin gene as a 1780-bp fragment using a single PCR primer pair.” However, the use of this fragment in reverse dot blotting did not allow us to distinguish between mutant and normal sequences, apparently because of the effect of secondary structure on hybridization. Hence, we devised two pair of PCR primers that directed simultaneous amplification of two P-globin DNA fragments (duplex PCR) that encompass all the known P-thalassemia mutations, as shown in Fig 1. The leftward primer pair consisted of: upstream primer, 5‘ BiotinAACTCCTAAGCCAGTGCCAGAAGA 3’; and downstream primer 5’ Biotin-TCA’ITCGTCTGTCCCATTCTAAAC 3‘. The rightward primer pair consisted of upstream primer, 5’ Biotin-TATCATGCCTCTGCACCA’ITCT 3‘; and downstream primer, 5’ Biotin-CACTGACCTCCCACATTCCCm 3’. Phosphoramidite biochemistry3*was used to synthesize these four primers, and the 5’ terminal base of each was converted during DNA deprotection to a primary amine-containing base that was subsequently biotinylated, as described.24These four primers were used simultaneously in the same test tube for duplex PCRinwhich the leftward pair directed amplification of a 774-bp fragment and the rightward pair, a 574-bp fragment, as shown in Fig 2. In the amplification reaction, target DNA (0.5 pg) wasamplified in a 100-pL reaction mixture [8.3 mmol/L (NH,),SO,; 33.5 mmoVL Tris HCI; 3.3 mmolL MgCI2; 2.5 mmol/L P-mercaptoethanol; 3.4 pnoVL Na2EDTA; 400 mmoll L each deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, and deoxythymidine triphosphate; 0.2 mmoln of each biotinylated primer; and 4.0 U of Taq DNA polymerase (Perkin Elmer-Cetus, Norwalk, CT)]. Reactions wereperformed in a programmable thermal cycler (Perkin Elmer-Cetus) at 95°C for 30 seconds, at 60°C for 3 seconds, and at 72°Cfor 3 seconds by the Step-Cycle program for 35 cycles. Samples were incubated at 72°C for an additional 5 minutes. Hybridization ofjilter-bound probeswith amplified, labeled DNA. Each filter with bound oligonucleotide probes was placed in 3 mL hybridization solution of 4X SSPE and 0.5% SDS. Amplified DNA in 20 pL was denatured with an equal volume of 400 mmom NaOH with 10 mmoVL EDTA for 1 to 5 minutes, added immediately to the 3 mL hybridization solution, and incubated at 55°C for 30 minutes. The stringency and temperature of the reaction are critical to the success of this method. The filters were briefly rinsed once in 1X SSPE and 0.2% SDS at room temperature and once in 2 x SSPE and 0.2% SDS at 55°C for 10 minutes. They were then incubated in 3 mL of 1 X SSPE and 0.2% SDS solution with 0.3 pL of streptavidin-horseradish peroxidase conjugate (1 mg/mL; Vector Laboratories, Burlingame, CA) for 10 minutes at room temperature, after which they were briefly washed 3 times in 1 X SSPE and 0.2% SDS at room temperature. Finally, the filters were washed 3 times in 100 rnmol/L sodium citrate, pH 5.0. Color development was performed by incubating the filters atroom temperature in thedark for 30 minutes in freshly prepared solution containing 0.1 mg/mL of 3.3’3.5’ tetramethylbenzidine, 0.003% H2O2in 100 mmol/L sodium citrate (pH 5.0). The filters were washed twice for 5 minutes by shaking in distilled water. RESULTS Results of reverse dot-blot tests are dictated by the target DNA that hybridizes only to probes complementary to se- 1582 SUTCHARITCHAN ET AL Table 2. The Oligonucleotide Probes and Quantity (pmol) of Each Applied t o the Filters PositionSequence -88 Probe Mutation C-T 29 A-G Codon 6 (Hb C) G-A Codon 6 (Hb S ) A-T 1 6 CodonNormal -A 1 Codon 24 T-A Codon 30 G-C IVS 1-2 T-C IVS 1-5 G-T Codon A-T IVS 11-1 G-A IVS 11-848 C-A IVS 11-849 A-G IVS 11-849 A-C Codon 1061107 Normal +G Poly A T-C Quantity Normal Mutant Normal Mutant Normal Mutant Normal Mutant C C Mutant Normal Mutant Normal Mutant Normal Mutant Normal Mutant Normal Mutant Normal Mutant Normal Mutant Normal Mutant Normal Mutant Mutant Normal Mutant quences therein. In the normal pattern, normal DNA hyhridizes only to probes complementary tonormal sequences. For the homozygous pattern, DNA homozygous for a particular mutation hybridizes to the probe complementary to that mutation but not itsnormal analog and to all othernormal probes but not their mutant analogs. In the simple heterozygous pattern, DNA with a single copy of a particular mutation hybridizes to the mutant probe and its normal analog and to all other normal probes but not their mutant analogs. For the compound heterozygouspattern, DNA containing one copy each of two different mutations hybridizes to both mutant probes and both their normal analogs and to all other normal probes but not their mutant analogs. Amore complex 6 30 2 -29 -88 61 5' AACCCTAGGGTGTGGCTC 3' 5' CAACCCTAGGATGTGGCTC 3' 5' GGCTGGGCATAAAAGTCAGG 3' 5' TGACTTTCATGCCCAGCC 3' 5' CTCCTGAGGAGAAGTCTG 3' 5' CTCCTAAGGAGAAGTCTGC 3' Same as Hb 5' CTCCTGTGGAGAAGTCTG 3' Same as Hb 5' AGACTTCTCCCAGGAGTC 3' 5' AGGGCCTCACCACCAACCC 3' 5' CTCACCTCCAACTTCATC 3' 5' CTGGGCAGGTTGGTATCA 3' 5' CTGGGCACGTTGGTATCA 3' 5' CCTTGATACCAACCTGCCCAG 3' 5' GGGCAGGCTGGTATCAAG 3' Same as IVS 1-2 5' TGGGCAGGTTGTTATCAA 3' 5' CTAAGGTGAAGGCTCATGG 3' 5' CCTAAGGTGTAGGCTCATG 3' 5' AGGGTGAGTCTATGGGAC 3' 5' GAACTTCAGGATGAGTCTATG 3' 5' ATCTTCCTCCCACAGCTC 3' 5' ATCTTCCTCCCAAAGCTC 3' Same as IVS 11-848 5' ATCTTCCTCCCACGGCTC 3' Same as IVS 11-848 5' ATCTTCCTCCCACCGCTC 3' 5' ACAGCTCCTGGGCAACG 3' 5' GCACGTTGCCCCAGGAG 3' 5' CATCTGGATTCTGCCTAATAAAAAA 3' 5' TCTGGATTCTGCCTAACAAAAAA 3' 848 106/107 849 849 ~. -. 1 6 IVS 2 774 bp -+""""""""""""""""" 4- 4 4 4 4 4 4 1 4 1 4 4 4 4 4 4 4 4 4 4 4 4 4 2 1 pattern is observed with closely adjacent mutations in which the sameoligonucleotideserves as probeforthe normal sequence; with either homozygosity for oneof the mutations or compound heterozygosity for both, there will he no hybridization to the shared normal probe. Results from the reverse dot-blot tests for the seven most common African-American P-thalassemia mutations and the structural mutations Hb S and Hb C are shown in Fig 3. On each filter strip the normal probes are located above, and the mutant probes are below. The mutations represented by each probe pair are listed above the panel, and the DNA samples tested are shown on the right. The predicted hybridization pattern of normal DNA is shown in the top strip. Homozy- 24 56 5' FLANKING 1 4 2 4 1 4 @ & .@3'"T <$$..&**g% ~"""""""""""- 574 bp POLY A '\ AAAAA 43' -FLANKING Fig 1. A diagram of the p-globin gene. This diagram shows the three exons (EX), t w o introns IIVSI, polyadenylation (poly A) site, and 5' and 3' untranslated (UT) and flanking sequences of the p-globin gene. The positions of the t w o amplification primer pairsare shown as t w o pairs of opposing arrows below the gene. Their PCR products are indicated as dotted lines, and their sizes are indicated as base pairs (bp). The positions of the mutations responsible for p thalassemia are shown above the gene. 1583 REVERSE DOT-BLOT OF AFRICAN-AMERICAN 4 THAL M 1 3 2 4 5 Fig 2. The /.?-globin DNA products of duplex PCR. A UVilluminated photograph of an ethidium bromide-permeated, 2% agarosegel on which the 774-bp products of the leftward primer pair andthe 574-bp products of the rightward primer pair amplified byduplex PCR were electrophoretically separated. Size markers are shown in lane M, and PCR products synthesized from 15 different DNA samples are shown lanes in 1 through 15. 6 7 8 9 1 0 1 1 1 2 1 3 1 4 1 5 tn4bp t !34 bp gous hybridization patterns are observed withDNAfrom subjects that are homozygous for the -88 C T and the -29 A + G &thalassemia alleles. DNA homozygous for the Hb S gene bound to the PSprobe but not to its normal analog nor to other mutant probes but did bind to all other normal analogs (except for Hb C which is the same as the Hb S normal probe). The simple heterozygous pattern is seen with the heterozygous codon 24 T + A P-thalassemia sample. The compound heterozygous pattern was seen with DNA containing the PSgene and a &thalassemia gene (ie, IVS 1-5 G + T, IVS 11-849 A + G , IVS 11-849 A -t C, codon 106-107 +G).The filter strip shown in Fig 3 with its 7 0thalassemia alleles detects approximately 90% of AfricanAmerican &thalassemia mutations“’.” and the Hb S and Hb C genes. We developed a second reverse dot-blot strip for 7 less common African-American &thalassemia mutations and included p5and pc (Fig 4). Again, on each filter strip the normal probes are located above and the mutant probes are below. The normal DNA patternis seen in the top strip. DNA from a subject with Hb SC disease hybridized to the p” and p’ probes, but not to their common normal analog, and hybridized to no other mutant probe, but to all other normal probes except for the codon 6 -Anormal probe, which was also the probe common to Hb S and Hb C. The pattern of hybridization for simple heterozygosity was seen for the codon 6 -A, codon 30 G -t C, codon 61 A T, and IVS 11-848 C + A samples. The compound heterozygous pattern was seen with DNA containing the Hb S and IVS I2 T + C mutation, the Hb S and IVS 11-1 G A mutation, and the Hb C and poly A T + C mutation. The data shown in Figs 3 and 4 demonstrate that the filterswe have developed will detect the 14 African-American P-thalassemia mutations, the Hb S and Hb C mutations, and their combinations. + + + DISCUSSION We report a reverse dot-blot method for detecting the known African-American &thalassemia mutations and the Hb S and Hb C genes using either two or a single hybridization reaction. The basis of this method is to detect which of several known mutations exists in target DNA by determin- ing whether mutant or normal membrane-fixed probes capture PCR-amplified and labeled target DNA.” Primers were developed for simultaneous amplification of two P-globin gene fragments (duplex PCR) that encompass all the known &thalassemia mutations of African-Americans. The number of mutations screened in one hybridization is limited by the reaction conditions required to distinguish numerous allelic pairs. Notwithstanding the large number of mutations that can be screened with a single reverse dot-blot rea~tion,’~.’~.” alternative diagnostic methods such as denaturing gradient gel ele~trophoresis“~ andDNA sequence analysis”’ should be used for detecting the mutations not represented on the initial reverse dot-blot. Our alternative approach was a second reverse dot-blot strip that included the 7 less common African-American &thalassemia mutations and Hb S and Hb C. The two strips can be hybridized simultaneously or separately. The ability to distinguish normal from mutant alleles and to accurately identify the P-thalassemia mutations present are requisites for reverse dot-blot diagnosis of 0 thalassemia. The first challenge in developing this test is to design the sequence and sense of both oligonucleotides3”“ and apply the two probes to filters in amounts that allow accurate allelespecific hybridization. The quantitative ratio of the two probes that consistently discriminates normalandmutant alleles is determined by trial and error. The next task is to determine, again by trial and error, the relative amounts of probe pairs thatwill establish whichnormalandmutant alleles are present. We have shown in Table 2 the amount of each probe that we applied to the filtersto accurately distinguish these P-thalassemia mutations. The accuracy and reliability of the method is dependent on the stringency and temperature of the hybridization step, which we optimized at 55°C. A potential confounding influence relates to the quantitatively unequal amplification of the two P-globin DNA fragments (see Fig 2) that could generate signals of different intensity from equal alleles. This vagary is redressed by the initial emprical quantifications of probe ratios required for accurate diagnosis at each locus. A related pitfall could result from sequence variations in target DNA that interfere with PCR primers in directing optimal amplification SUTCHAAITCHAN ET AL of the two fragments. Quantitative amplification of the two fragments is monitored by visual inspection of PCR products in ethidium bromide gels after electrophoresis, as in Fig 2. Accurate diagnosis is essential for genetic counseling and prenatal diagnosis, which are mainstays of sickle cell disease management.' Traditional electrophoretic methods for the diagnosis of p thalassemia and hemoglobinopathies may be complicated by complex inheritance patterns or by the presence of large amounts of Hb F. These obstacles canbe circumvented by using DNA-based diagnostic methods..'"~." Multi-allele screening with the reverse dot-blot method" is 6 8 n n 3 3 HbCIHbS Codon61HbA Codon 30 I Hb A HbSINSI-2 Normal Codon 61I Hb A Homozygous-88 IVSII-1 lHbS Homozygous -29 IVSII-8481HbA Homozygous HbS PolyAIHbC Codon 24I Hb A IVS 1-5 / Hb S Fig 4. Reverse dot-blot strips after hybridization and color development. These strips contain hybridization probes complementary t o seven less common African-American /%thalassemia mutations and the HbS and Hb C alleles. For further details see the legend t o Fig 3. IVS 11-849 I Hb S A+G IVS 11-849 / Hb S A+C Codon 106-107 I Hb S Fig 3. Reverse dot-blot strips after hybridization and color development. Hybridization probes complementary t o t h e seven most common African-American p-thalassemia mutations and the structural mutations Hb S and Hb C are fixed t o these reverse dot-blot strips. On each filter strip, the normalprobes are at the top and the mutant probes are at the bottom. The mutations represented by each probe are listed above, and the DNA samples tested are shown on the right. The presence of a color signal at each position indicates the presence in amplified target DNA of sequences complementary to thatspecific probe. particularly useful for diagnosing p thalassemia because of the vast diversity of P-thalassemia mutation^.^.^^ The 14 pthalassemia genotypes we have t e ~ t e d ~ . ' " .account ' ' . ~ ~ for the several P-thalassemia phenotypes".'4.'7 present among African-Americans. The reverse dot-blot method described here will facilitate the accurate diagnosis, genetic counseling, and prenatal diagnosis of individuals bearing these genes. In addition, this method will provide an excellent means of confirmatory testing for newborn screening programs. ACKNOWLEDGMENT We acknowledge the generous support of Dr N.Mohandas (Lawrence Berkeley Laboratories), the provision of oligonucleotides by Dr C. Levinson (Roche Molecular Systems), and the technical advice of Mr G . Kropp (C.P. Li Biomedical Research Corp). REVERSE DOT-BLOT OF AFRICAN-AMERICAN THAL REFERENCES 1. Embury SH, Saiki R, Erlich H, Sutcharitchan P: Detecting African-American &thalassemia mutations with a single, rapid reverse dot blot hybridization. Proceedings of the XXV Congress of the International Society of Hematology, Cancun, Mexico, April 17-21, 1994, abstr no. 217 2. Sutcharitchan P, Saiki R, Erlich H, Embury SH: Detecting African-American P-thalassemia mutations with a single, rapid reverse dot blot hybridization. Program of the Ninth Conference on Hemoglobin Switching, &cas Island, WA, June 10-14, 1994 3. Sutcharitchan P, Saiki R, Huisman THJ, Kutlar A, McKie V, Erlich H, Embury SH: Detecting the African-American P-thalassemia mutations with a single, rapid reverse dot blot hybridization. Program of a Symposium on New Approaches to Therapy for Thalassemias and the Hemoglobinopathies, Paris, France, September 1922, 1994, abstr no. 1-10 4. Embury SH: Prenatal diagnosis, in Embury SH, Hebbel RP, Mohandas N, Steinberg MH (eds): Sickle Cell Disease: Basic Principles and Clinical Practice, New York, NY, Raven, 1994, p 485 5. Bunn HF, Forget BG: Hemoglobin: Molecular, Genetic and Clinical Aspects. Philadelphia, PA, Saunders, 1986 6. Weatherall DJ, Clegg JB: The Thalassemia Syndromes. Liverpool, UK, Blackwell, 1981 7. Kazazian HH Jr, Boehm CD: Molecular basis and prenatal diagnosis of &thalassemia. Blood 72:1107, 1988 8. Embury SH, Hebbel RP, Mohandas N, Steinberg MH (eds): Sickle Cell Disease: Basic Principles and Clinical Practice. New York, NY, Raven, 1994 9. Livingstone F%: Abnormal Hemoglobins in Human Populations. Chicago, L,Aldine, 1967 10. Gonzalez-Redondo JM, Kutlar A, Kutlar F, McKie KM, Baysal E, Huisman THJ: Molecular characterization ofHb S(C) pthalassemia in American Blacks. Am J Hematol 38:9, 1991 11. Gonzalez-Redondo JM, Stoming TA, Lanclos KD, Gu YC, Kutlar A, Kutlar F, Nakatsuji T Clinical genetic heterogeneity in black patients with homozygous @-thalassemiafrom the southeastern United States. Blood 72:1007, 1988 12. Serjeant GR, Sommereux AM, Stevenson M, Mason K, Serjeant BE: Comparison of sickle cell-Fthalassemia and homozygous sickle cell disease. Br J Haematol 41933, 1979 13. Serjeant GR, Serjeant BE: Comparison of sickle cell-p' thalassemia and sickle cell-@+thalassemia in black populations, in Cao A, Carcassi U, Rowley PT (eds): Thalassemia: Advances in Detection and Treatment, Birth Defects Original Article Series. New York, N Y , Liss, 1982, p 233 14. Christakis J, Vavatsi N, Hassapopoulou H, Angeloudi M, Papadopoulou M, Loukopoulos D, Moms JS: A comparison of sickle cell syndromes in northern Greece. Br J Haematol 77:386, 1991 15. Kinney TR, Ware. RE: Compound heterozygous states, in Embury SH, Hebbel RP, Mohandas N, Steinberg MH (eds): Sickle Cell Disease: Basic Principles and Clinical Practice. New York, NY, Raven, 1994, p 437 16. Embury SH: Sickle cell disease, in Hoffman R, Benz ET Jr, Shattil SJ, Furie B, Cohen HJ, Silberstein LE (eds): Hematology: Basic Principles and Practice. New York, NY, Churchill Livingstone, 1995, p 61 1 17. Weatherall DJ: Biochemical phenotypes of thalassemia in the American Negro population. Ann NY Acad Sci 119:450, 1964 18. River CL, Robbins AB, Schwartz SO: SC hemoglobin: A clinical study. Blood 18:385, 1961 19. Ballas SK, Lewis CN, Noone AM, Krasnow SH, Kamurulzaman E, Burka ER: Clinical, hematological and biochemical features of Hb SC disease. Am J Hematol 13:37, 1982 1585 20. Embury SH: Advances in the prenatal and molecular diagnosis of hemoglobinopathies and thalassemias. Hemoglobin 1995 (in press) 21. Mullis KB, Faloona FA: Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol 155:335,1987 22. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB, Erlich HA: Primer-directed enzymatic amplification ofDNAwith a thermostable DNA polymerase. Science 239:487, 1988 23. Huisman THJ: p- and &thalassemia repository. Hemoglobin 17:479, 1993 24. Saiki RK, Walsh PS, Levenson CH, Erlich HA: Genetic analysis of amplified DNA withimmobilized sequence-specific oligonucleotide probes. Proc Natl Acad Sci USA 86:6230, 1989 25. Kawasaki E, Saiki R, Erlich H: Genetic analysis using polymerase chain reaction-amplified DNA and immobilized oligonucleotide probes: Reverse dotblot typing. Methods Enzymol 218:369, 1993 26. Cai S-P, Wall J, KanYW, Chehab FF: Reverse dot blot probes for the screening of @-thalassemiain Asians and American Blacks. Hum Mutat 359, 1994 27. Kazazian HH Jr: The thalassemia syndromes: Molecular basis prenatal diagnosis in 1990. Semin Hematol 27:209, 1990 28. Efremov DG, Dimovski AJ, Efremov CD: Detection of Pthalassemia mutations by AS0 hybridization of PCR amplified DNA with digoxigenin ddUTP labeled oligonucleotides. Hemoglobin 15525, 1991 29. Coleman MB, Steinberg MH, Harrell AH, Plonczynski MW, Walker AM, Adams JGIII: The -87 (C +A) P'-thalassemia mutation in a black family. Hemoglobin 16:399, 1992 30. About-ela F,KohD, Tinoco I Jr, Martin FH: Base-base mismatches Thermodynamics of double helix formation for dCA3XA3G+dCT3YT3G (X,Y = A,C,G,T). Nucleic Acids Res 13:4811, 1985 31. Kwok S, Kellogg DE, McKinney N, Spasic D, Goda L, Levenson C, Sninsky JJ: Effects of primer-template mismatches on the polymerase chain reaction: Human immunodeficiency virus type 1 model studies. Nucleic Acids Res 18:999, 1990 32. Sinha ND, Biernat J, McManus J, Koster H: Polymer support oligonucleotide synthesis XVIII: Use of P-cyanoethyl-N N-dialkylamino-/N-morpholino phosphoramidite of deoxynucleosides for the synthesis of DNA fragments simplyfying deprotection isolation of the final product. Nucleic Acids Res 12:4539, 1984 33. Maggio A, Giambona A, Cai S-P, Wall J, Kan YW, Chehab C: Rapid and simultaneous typing of hemoglobin S, hemoglobin C, and seven Mediterranean &thalassemia mutations by covalent reverse dot-blot analysis: Application to prenatal diagnosis in Sicily. Blood 81:239, 1993 34. Cai S-P, Kan YW: Identification of the multiple P-thalassemia mutations by denaturing gradient gel electrophoresis. J Clin Invest 85:550, 1990 35. Wong C, Dowling CE, Saiki RK,Higuchi RC, Erlich HA, Kazazian HH: Characterization of P-thalassaemia mutations using direct genomic sequencing of amplified single copy DNA. Nature 330:384, 1987 36. Conner BJ, Reyes AA, Morin C, Itakura K, Teplitz RL, Wallace RB: Detection of sickle cell Ps-globin allele by hybridization with synthetic oligonucleotides. Proc Natl Acad Sci USA 80:278, 1983 37. Geever RF, Wilson LB, Nallaseth FS, Milner PF, Bittner M, Wilson JT: Direct identification of sickle cell anemia by blot hybridization. Proc Natl Acad Sci USA 78:5081, 1981
© Copyright 2026 ExpyDoc