Aust et al. (2013) GCB Bioenergy, online INVESTOR COUNTRIES TARGET COUNTRIES Süddeutsche Zeitung 25./26.06-11 Jörg-Peter Schnitzler Forstliche Versuchsund Forschungsanstalt Baden-Württemberg Research Unit Environemntal Simulation Frank Brodbeck Udo Sauter Klaus ButterbachBahl / Hans Papen Inst. for Meteorology and Climate Research (IMKIFU) GarmischPartenkirchen Gero Becker Klaus Palme Heinz Rennenberg Albert-Ludwigs-Universität Freiburg, Institutes of Forstbotanik & Baumphysiologie; Botanik II; Forstbenutzung und Forstliche Arbeitswissenschaft From Maurel et al. (2008) PIPs support lateral root development Peret et al (2012) Nat. Cell Biol. From Maurel et al. (2008) PIPs XIPs TIPs NIPs SIPs From Gupta & Sankararamakrishnan, 2009, BMC Plant Biol 0. 05 rt pa 2-4 pip Pc an p ip 2P c 3 an cd pip s 2 Pca -2 n cd p i p2Pca s 1cd npip s 2 7 par tialc ds partialc ds ial Pcanpip 2-6 ds ip2-5c Pcanp alcds ti 1-3par s PIPs ip Pcanp cds rtial cd ial cd s Pc a 1-5p s cd Pc npip Pca rt pa 1-4 pip an Pc 2 1pip an Pc ds an pip 1-1 c an pip 210 Pc pa anp rtia ip2 -9p lcd art ialc s ds Type II Type I 1.20 relative expression [log2(pip/act2)] 1.00 0.80 0.60 young leaf mature leaf 0.40 0.20 0.00 old leaf 2.00 1.80 relative expression [log2(pip/act2)] 1.60 1.40 1.20 1.00 0.80 0.60 0.40 0.20 0.00 root phloem xylem PcanPIP type 1-RNAi construct Pcanpip1-2cds PIP1RNAisingle Pcanpip1-1cds Pcanpip1-3cds Pcanpip1-4cds Pcanpip1-5cds GCTCGGAGTCTGGGGGCTGCAATCATCTTCAACAAGGACAGCGCCTGGGATGATCACTGG GCTCGGAGTCTGGGGGCTGCAATCATCTTCAACAAGGACAGCGCCTGGGATGATCACTGG GCTCGTAGTCTTGGTGCAGCCATCATCTTCAACAAGGACAAGGCCTGGGATGATCACTGG GCAAGGAGTCTTGGAGCCGCCATCATCTTCAACAAAGACCATGCATGGGATGACCACTGG GCCAGAAGTCTTGGTGCAGCCCTCATCTACAACAAGGACGAAGCTTGGGATGATCATTGG GCCAGAAGTCTTGGTGCAGCCCTCATCTACAACAAAGACCAAGCTTGGGATGACCACTGG ** * ***** ** ** ** ****** ****** *** ** ******** ** *** PcanPIP type 2-RNAi construct Pcanpip2-1cds Pcanpip2-2cds Pcanpip2-5cds Pcanpip2-6cds Pcanpip2-7cds PIP2RNAisingle Pcanpip2-3cds Pcanpip2-4cds Pcanpip2-8cds Pcanpip2-9cds Pcanpip2-10cds ATCCCTATTACTGGTACTGGCATCAACCCTGCTAGGAGCTTTGGTGCTGCTGTCATCATC ATCCCTATAACTGGAACTGGCATCAACCCTGCCAGGAGCTTTGGCGCTGCTGTCATCTTC ATCCCAATCACCGGAACTGGTATCAACCCGGCTAGGAGCTTTGGAGCTGCTGTGATATAC ATCCCAATCACCGGAACTGGTATCAACCCGGCTAGGAGCTTTGGAGCTGCTGTGATATAC ATTCCAATCACCGGTACTGGTATCAACCCTGCTAGGAGCTTCGGAGCTGCTGTGATCTAC ATCCCCATCACTGGAACTGGCATCAACCCTGCTAGGAGCTTTGGAGCTGCTGTGATCTAC ATCCCCATCACTGGAACTGGCATCAACCCTGCTAGGAGTCTGGGAGCCGCTGTTATCTAC ATCCCAATCACAGGAACTGGCATCAACCCTGCTAGGAGTCTTGGAGCTGCTGTTATCTAC ATCCCAATTACTGGCACTGGCATCAACCCTGCTAGGAGCTTCGGAGCTGCTGTCATCTTT ATTCCCATCACTGCCACGGGCATCAATCCTGCTAGGAGTCTTGGTGCTGCTGTGGTTAAG ATTCCCATCACCGGAACTGGCATCAATCCTGCTAGAAGCCTTGCTACTAATTTGATTTAT ** ** ** ** * ** ** ***** ** ** ** ** * * * * * * High gene homology makes it difficult to develop gene-specific constructs several members as RNAi target – Aquaporins – a way to improve water use efficiency in poplar? Screening of lines PIPs I PIPs II * * * * * * * * * * * * Significant difference between the lines are indicated by * (Student’s t-tests, n=6±SE, P<0,05) Vcmax, maximum carboxylation rate allowed by RubisCO J, electron transport rate TPU, triose phosphate use Rd, day respiration gm, mesophyll conductance for CO2 “Fitting photosynthetic CO2 response curves for C3 leaves“ (Sharkey et al., 2007, PC&E) * * * * * * * * * Significant difference between the transgenic line and WT is indicated by * (student t-test, n=3-6±SE, P<0,05) Vcmax: maximum carboxylation rate allowed by RubisCO J: electron transport rate (based on NADPH requirement) TPU: triose phosphate use Rd: day respiration gm: mesophyll conductance of CO2 “Fitting photosynthetic CO2 response curves for C3 leaves“ (Sharkey et al., 2007, PC&E) * * * Significant difference between the transgenic line and WT is indicated by * (student t-test, n=3-6±SE, P<0,05) Vcmax: maximum carboxylation rate allowed by RubisCO J: electron transport rate (based on NADPH requirement) TPU: triose phosphate use Rd: day respiration gm: mesophyll conductance of CO2 HPTS HPTS acetate (8-hydroxypyrene-1,3,6-trisulphonic acid) (acetoxypyrene-1,3,6-trisulphonic acid trisodium salt) tracer for apoplastic pathway tracer for symplastic pathway WT HPTS (apoplastic pathway) 2 hrs uptake of HPTS/ HPTS-A under ambient conditions; WT HPTS-acetate (symplastic pathway) abaxial adaxial abaxial adaxial fluorescence intensity per fluorescence dye ( g ) fluorescence intensity (mean grey value) fluorescence dye per leaf area [mg ml-1 ] WT 25 images/leaf areas analyzed for stomal density 50 stomata analyzed for stomata length stomata length [ m] Stomatal density [no. m-2] * The PcanPIP-RNAi caused reduction of PIP content of 50% Effects on H2O Knock down of PIPs in poplar resulted in higher transpiration rates Weak positive effect on WUE at high rel. Humidity Effects on CO2 Knock down of PIPs resulted in higher net CO2 assimilation rates, higher RubisCO carboxylation rate, and higher Electron transport rates Effects are light dependent
© Copyright 2024 ExpyDoc
