Without children is required for Stat-mediated zfh1

Development ePress. Posted online 5 June 2014
© 2014. Published by The Company of Biologists Ltd | Development (2014) 141, 1-9 doi:10.1242/dev.109611
RESEARCH ARTICLE
STEM CELLS AND REGENERATION
Without children is required for Stat-mediated zfh1 transcription
and for germline stem cell differentiation
ABSTRACT
Tissue homeostasis is maintained by balancing stem cell self-renewal
and differentiation. How surrounding cells support this process has not
been entirely resolved. Here we show that the chromatin and telomerebinding factor Without children (Woc) is required for maintaining
the association of escort cells (ECs) with germ cells in adult ovaries.
This tight association is essential for germline stem cell (GSC)
differentiation into cysts. Woc is also required in larval ovaries for the
association of intermingled cells (ICs) with primordial germ cells.
Reduction in the levels of two other proteins, Stat92E and its target
Zfh1, produce phenotypes similar to woc in both larval and adult
ovaries, suggesting a molecular connection between these three
proteins. Antibody staining and RT-qPCR demonstrate that Zfh1 levels
are increased in somatic cells that contact germ cells, and that Woc is
required for a Stat92E-mediated upregulation of zfh1 transcription. Our
results further demonstrate that overexpression of Zfh1 in ECs can
rescue GSC differentiation in woc-deficient ovaries. Thus, Zfh1 is a
major Woc target in ECs. Stat signalling in niche cells has been
previously shown to maintain GSCs non-autonomously. We now show
that Stat92E also promotes GSC differentiation. Our results highlight
the Woc-Stat-Zfh1 module as promoting somatic encapsulation of
germ cells throughout their development. Each somatic cell type can
then provide the germline with the support it requires at that particular
stage. Stat is thus a permissive factor, which explains its apparently
opposite roles in GSC maintenance and differentiation.
KEY WORDS: Stat92E, Zfh1, Woc, ZMYM, GSC, Niche, Drosophila
INTRODUCTION
Adult stem cells maintain tissue homeostasis by balancing selfrenewal and differentiation. This balance depends on extensive
communication between stem cells and their environment (niche).
In many cases, the cues required for self-renewal differ from those
directing differentiation. Whether the same signal might serve both
is unclear.
Drosophila germline stem cells (GSCs) and their somatic niche
cells are a convenient model for understanding the interactions
between stem cells and their environment. The somatic niche for
GSCs is composed of terminal filament (TF), cap cells and the
anterior escort cells (ECs) (Fig. 1A), which produce the BMP2/4
homologue Decapentaplegic (Dpp) (Harris and Ashe, 2011; LopezOnieva et al., 2008; Wang et al., 2008; Xie and Spradling, 2000).
Dpp signalling within GSCs results in phosphorylation of Mothers
against Dpp ( pMad), and in repression of the major differentiation
gene bag of marbles (bam) (Chen and McKearin, 2003a,b; Xie and
Department of Biological regulation, Weizmann Institute of Science, Rehovot
76100, Israel.
Spradling, 1998). Both GSCs and their first differentiating daughter
cells (cystoblasts, CBs) contain a spherical organelle (fusome) that
elongates and branches as differentiating CBs form germline cysts.
Dividing cysts maintain tight contact with a group of somatic ECs,
which are important for their differentiation (Fig. 1A) (Kirilly et al.,
2011; Lim and Fuller, 2012; Schulz et al., 2002).
Many signalling pathways collectively control GSC biology (Fuller
and Spradling, 2007; Gancz and Gilboa, 2013; Kirilly and Xie, 2007;
Spradling et al., 2011). Among those, the Stat (signal transducer and
activator of transcription) pathway functions in both males and
females. In males, the activated Jak kinase (Hopscotch, Hop) and its
target Stat (Stat92E) promote GSC and cyst stem cell (CySC) selfrenewal cell-autonomously. In addition, Stat signalling within CySCs
is required for GSC self-renewal (Kiger et al., 2001; Leatherman and
Dinardo, 2008; Tulina and Matunis, 2001). In females, Stat is also
required non-autonomously for GSC maintenance (Decotto and
Spradling, 2005; Lopez-Onieva et al., 2008; Wang et al., 2008). Stat
target genes, such as Suppressor of cytokine signalling 36E (Socs36E),
Chronologically inappropriate morphogenesis (chinmo) and zfh1,
were found to function in male GSCs and CySCs (Flaherty et al., 2010;
Issigonis et al., 2009; Leatherman and Dinardo, 2008; Singh et al.,
2010). zfh1 encodes a transcriptional repressor with multiple zinc
fingers and a homeodomain (Fortini et al., 1991). It is expressed in
CySCs and their early daughter cells, and is required for their
maintenance and for GSC self-renewal (Leatherman and Dinardo,
2008, 2010).
Although many effectors are known to control GSC biology, the
list is by no means complete. In a screen designed to find new players
in soma-germline communication (Gancz et al., 2011), we identified
without children (woc) as a potential candidate. Woc was first isolated
due to a sterility phenotype, and was shown to contain zinc fingers
and an AT-hook domain, which suggest a function in transcription
(Warren et al., 2001; Wismar et al., 2000). Indeed, Woc binds active
chromatin domains and colocalises with initiating forms of RNA
polymerase II (Raffa et al., 2005). Woc was further shown to recruit
and regulate the binding of heterochromatin protein 1c (HP1c) to
active sites of transcription (Font-Burgada et al., 2008). In addition,
Woc binds telomeres and prevents telomere fusion, independently of
other known telomere-capping proteins (Raffa et al., 2005).
Here, we report that Woc is a novel player in ovarian biology that,
together with Stat and Zfh1, is required for GSC/CB differentiation. We
further show that Zfh1 is haplo-insufficient for its function in ECs and
that Woc is required for a Stat-mediated elevation in its transcription.
The root of the seemingly opposing functions of Stat in GSC selfrenewal and differentiation is a common role in promoting contacts
between somatic cells and germ cells throughout development.
*Author for correspondence ([email protected])
RESULTS
Woc is required for GSC and CB differentiation
Received 27 February 2014; Accepted 25 April 2014
To find novel regulators of GSC maintenance and differentiation,
we expressed various RNAi lines in the somatic cells of the ovary,
1
DEVELOPMENT
Iris Maimon, Malka Popliker and Lilach Gilboa*
Fig. 1. Somatic woc function is required for GSC/CB differentiation.
(A) Wild-type germarium. Terminal filament (TF) and cap cells (CC) are at the
anterior (left). Germline stem cells (GSCs) and their daughters (cystoblasts,
CBs) carry spherical fusomes (yellow). Germline cysts contain branched
fusomes and contact escort cells (ECs). (B,C) Germ cells labelled by anti-Vasa
(green). Anti-Hts antibody (magenta) labels somatic cell membranes and
fusomes. (B) Wild-type germarium: fusomes are spherical in GSCs/CBs
(arrowheads) and branched in dividing cysts (arrows). (C) A compression of
several z-sections of a woc-RNAi germarium filled with germ cells carrying
spherical fusomes (arrowheads). (D,E) Anti-SMAD3 marks pMAD (magenta).
(D0 ,E0 ) Anti-GFP (detects bamP-GFP, green). (D00 ,E00 ) Merged images of
D,D0 and E,E0 , respectively, including anti-Hts (white). (D-D00 ) A wild-type
germarium, pMAD staining is strong in GSCs (arrowheads). bamP-GFP is
undetected in GSCs, low in CBs (outlined) and strong in dividing cysts.
(E-E00 ) A woc-RNAi germarium. pMAD is expressed in GSCs (arrowheads),
and is weaker further away from the niche. Cells express low levels of bamPGFP, similar to wild-type CBs. (F) Comparison of cells with spherical fusomes
between wild-type and woc-RNAi germaria. The different categories and t-test
P-values are as follows: GSCs ( pMAD+ inside the niche, P=0.37, not
significant), pMAD+ outside the niche (P=6.98E-6), pre-cystoblasts (double
negative, P=1.98E-16) and CBs (bam+, P=5.15E-14). (G,H) Ovaries are
labelled using anti-Hts (magenta). (G) hs-bam ovaries following heat shock.
Branched fusome close to the niche (arrow) indicates a differentiated GSC.
(H) hs-bam expression in woc-RNAi ovaries. Spherical fusomes are observed
(arrowheads). Scale bars: 10 μm (bar in B applies to B,C; bar in D applies
to D,E; bar in G applies to G,H).
using the driver traffic jam-Gal4 (tj-Gal4) (Gancz et al., 2011;
Li et al., 2003). Expression of two different lines directed
against the putative transcription factor Without children (Woc,
henceforth termed woc-RNAi ovaries, supplementary material
Fig. S1) resulted in a significant increase in the number of single
cells carrying a spherical fusome when compared with wild type
(WT) (Fig. 1B,C,F).
2
Development (2014) 141, 1-9 doi:10.1242/dev.109611
To determine the stage at which germ cell differentiation was
blocked, we stained wild-type and woc-RNAi ovarioles using an antiSMAD3 antibody, which cross-reacts with pMAD and labels GSCs
(Ables and Drummond-Barbosa, 2010). The ovaries were also
stained using anti-GFP to detect bamP-GFP, which recapitulates
endogenous bam RNA expression in CBs and dividing cysts (Chen
and McKearin, 2003b). The developmental state of all cells carrying a
spherical fusome was scored. As expected for wild-type germaria, 2-3
GSCs were exclusively labelled with pMAD (GSC in Fig. 1D,D00 ,F).
On average, less than one pMAD+ cell was observed outside the
niche (Fig. 1F), and an average of less than one cell was labelled
neither by pMAD antibody nor by GFP (Fig. 1F). The latter may
represent the pre-CB, a GSC daughter cell that has lost pMAD but has
not yet upregulated bam expression (Gilboa et al., 2003; Ohlstein and
McKearin, 1997; Rangan et al., 2011). An additional single cell, the
cystoblast, was labelled by GFP (Fig. 1D0 ,D00 , outlined, 1F). In most
woc-RNAi germaria, pMAD staining was strong in GSCs located in
the niche (Fig. 1E,E00 , arrowheads, 1F). A few pMAD-positive cells
were located away from the niche (Fig. 1F). However, the majority of
single cells that were not located at the niche were either pre-CBs or
CBs (Fig. 1E0 -F). In total, woc-RNAi ovaries contained 16 single
cells (n=60) compared with 4.7 in wild-type cells (n=61, Fig. 1F).
Significantly, in strongly affected woc-RNAi ovaries, bampositive cells did not form cysts, suggesting that Bam expression is
insufficient to drive cyst development without somatic Woc input.
To test this more rigorously, we forced germ cells to differentiate
by overexpressing bam using a heat-shock promoter (Ohlstein
and McKearin, 1997). Following heat shock, wild-type GSCs
differentiated (Fig. 1G, arrow, n=73). However, whereas increased
Bam levels were detected in woc-RNAi ovaries (not shown), no
rescue of the woc-phenotype was observed (Fig. 1H, arrowheads,
n=123). In conclusion, the mixed nature of the single cells in
woc-RNAi tumours suggests that somatic Woc is required for
efficient GSC differentiation and for cyst formation following
Bam expression.
Woc is required in escort cells (ECs) for their association with
germ cells
To determine which cells express Woc, we stained wild-type
germaria using anti-Woc antibody (Raffa et al., 2005). Woc was
expressed in all ovarian cells (Fig. 2A-C), raising the possibility that
woc may affect germ cells autonomously, as well as through the soma.
To test which cells in the germarium require Woc function to allow
GSC/CB differentiation, we generated large somatic woc-mutant
clones of wocrgl, woc251 or woc468 using the Minute technique
(Newsome et al., 2000). Whereas GSCs in control germaria produced
differentiated progeny (Fig. 2D), 93% of germaria in which the entire
EC population was woc mutant accumulated single germ cells with
round fusomes (n=40, Fig. 2E-G). This phenotype occurred even in
germaria with wild-type TF and cap cells (arrowheads), suggesting
that Woc is required specifically within ECs.
Reducing Woc in germ cells by either germline clones or by
expression of woc-RNAi with the germline driver nos-Gal4 did not
result in differentiation defects (Fig. 2H-J). However, fewer germline
clones were retrieved when compared with WT, suggesting Woc may
be required cell-autonomously for germ cell viability and non-cell
autonomously within ECs for GSC/CB differentiation.
To better understand the requirement for Woc in ECs, we
examined their morphology using a GFP trap in the protein Failed
axon connections (Fax-GFP), which labels their membranes
(Buszczak et al., 2007). Normal ECs extend fine cytoplasmic
processes that wrap and support dividing cysts (Fig. 2K) (Decotto
DEVELOPMENT
RESEARCH ARTICLE
RESEARCH ARTICLE
Development (2014) 141, 1-9 doi:10.1242/dev.109611
Fig. 2. Woc is required in ECs to maintain cell protrusions and to allow
GSC differentiation. (A-C) A wild-type germarium. Anti-Woc (green in A,B)
stains somatic and germ cell nuclei (DAPI, blue in A, greyscale in C).
(D-L) Anti-Hts is in magenta. (D-I) GFP marks wild-type cells. (D) Control ovary
FRT82B with GFP-deficient somatic cells. GSCs differentiate into normal cysts
(arrows). (E-G) When niche cells are WT (arrowheads) and somatic ECs
are mutant (no GFP, arrows) for woc251 (E), woc468 (F) or wocrgl (G), germ cells
fail to differentiate and carry spherical fusomes. (H-I) Germ cells mutant for
wocrgl (H, arrows), or woc251 (I, arrow) can develop into cysts. (J) woc-deficient
germ cells (anti-Vasa, green) differentiate normally into cysts (arrows).
(K,L) Somatic cell membranes are marked by Fax-GFP (anti-GFP, green).
Arrows mark somatic cells. Several compressed z-sections are shown. In WT
(K), somatic cell protrusions extend between cysts. (L) In woc-RNAi ovaries,
ECs fail to send protrusions and GSCs fail to differentiate. Scale bar: 10 μm.
and Spradling, 2005; Kirilly et al., 2011; Morris and Spradling,
2011; Schulz et al., 2002). In contrast, whereas woc-deficient EC
nuclei were observed in woc-RNAi ovaries, ECs failed to send
cellular extensions into the germarium, and to wrap germ cells
(Fig. 2L, n=69). In addition, fewer ECs were present in woc-RNAi
ovaries. Staining with the vital dye propidium iodide (PI) revealed
that 25% (n=80) of all woc-RNAi germaria contained a dying EC, as
compared with only 3.7% (n=54) of wild-type germaria. Combined,
these data suggest that Woc is required in ECs for viability, for
proper soma-germline contact and for GSC/CB differentiation.
cells (PGCs) occupied the medial part of the ovary, and the somatic
intermingled cells (ICs) were interspersed between them (Fig. 3A)
(Gilboa and Lehmann, 2006; Li et al., 2003). PGCs in woc-RNAi
ovaries were still medially localised. However, the majority of ICs
remained outside of the germ cell region (Fig. 3B, outlined, 73% of
ovaries, n=49). Similar phenotypes were observed in ovaries
containing large mutant clones of wocB111 and wocrgl (compare
Fig. 3C with 3D,E). In addition, fewer ICs were observed in wocRNAi larval ovaries (supplementary material Table S1). This
reduction could partly be the result of cell death, as PI staining
identified more dead ICs [an average of 0.48±0.13 (±s.e.m.) dead
cells in controls (n=25) compared with 2.5 dead cells in woc-RNAi
ovaries, Student’s t-test P=2.5E-6].
To determine whether Woc may have additional effects on IC
biology, we overexpressed it using a line carrying a UAS insertion
into the woc locus. Woc overexpression resulted in a significant
increase in IC numbers (compare Fig. 3A with 3F, supplementary
material Table S1). Collectively, these data suggest that Woc is
essential for proper contact of somatic cells with germ cells, and can
affect IC survival and specification or proliferation.
As Woc is already required for soma-germline interactions at
larval stages, we wondered whether the woc adult phenotypes might
result from the earlier, larval, defects. We therefore used the Gal80ts
system to remove Woc function in adult ovaries only. Defective EC
extensions, coupled to a lack of germ cell differentiation, were also
observed under these experimental settings (supplementary material
Fig. S2), demonstrating that Woc is required both in larval and adult
somatic cells for correct ovarian morphology and function.
Similar ovarian phenotypes of woc, stat and zfh1
Woc is already required in the forming ovary for somagermline association
Intercellular contact is a major driving force of cell behaviour not
only in adult organ function, but also during organ formation. We
therefore asked whether Woc affects the formation of the GSC unit.
In wild-type late larval third-instar (LL3) ovaries, primordial germ
It has been previously shown that Stat activation in adult germaria
increases EC numbers (Decotto and Spradling, 2005; Lopez-Onieva
et al., 2008). Considering the similarity in gene expression between
adult ECs and larval ICs, and the possible origin of ECs from ICs,
we tested whether Stat activation may also increase IC numbers.
Indeed, similar to Woc overexpression, somatic overexpression of
3
DEVELOPMENT
Fig. 3. Woc is required for soma-germline association during
gonadogenesis. Anti-Tj (magenta) stains IC nuclei. (A,B) PGCs are labelled
by anti-Vasa (green). (A) Wild-type ovary. ICs are interspersed between PGCs.
(B) In woc-RNAi ovaries, ICs are located around the PGC region (solid line),
and only a few intermingle. (C-E) GFP labels wild-type cells. (C) Wild-type
clones still intermingle with PGCs (outlined). (D,E) Large somatic clones
of wocB11 (D) or wocrgl (E) mutant ICs (GFP-negative) organise outside
the germ cell region (outlined) and very few cells intermingle with PGCs.
(F) Overexpression of Woc results in increased IC numbers (compare F
with A). Scale bars: 10 μm.
either the ligand Upd or the constitutively active Jak kinase hop tum1
resulted in extensive IC over-proliferation (100% of ovaries, n=30
each, compare Fig. 3A with Fig. 4A,B). Repression of the Stat
pathway also resulted in woc-like phenotypes; large clones of ICs
that are mutant for stat92E397 or stat92E85c9 failed to intermingle
with PGCs and mostly remained at the periphery of the germ cell
region (Fig. 4C,D, respectively, 100% of ovaries, n=52). This
further extends the similarity between woc and stat phenotypes.
As woc- and stat-mutant or -overexpression larval phenotypes
overlap, we asked whether these genes share phenotypes in the
adult. Stat signalling is required for GSC maintenance in both males
and females (Decotto and Spradling, 2005; Kiger et al., 2001;
Lopez-Onieva et al., 2008; Tulina and Matunis, 2001; Wang et al.,
2008). Because our data suggest that woc is required in ECs for
differentiation of GSCs and CBs, we tested whether, in addition to
GSC maintenance, Stat signalling might affect GSC differentiation.
Such a function could have been missed previously due to masking
by the earlier function of Stat in GSC maintenance, and because
observing EC-mediated control of GSC differentiation requires
mutating the majority of ECs within a germarium (using the Minute
technique).
Germaria carrying large populations of stat-mutant ECs
displayed aberrant GSC differentiation. In contrast to the WT,
cells carrying spherical fusomes were observed far from the niche
(Fig. 4E, arrowheads, all ovarioles, n=124). In line with the mutant
analysis, somatic removal of stat by three different RNAi lines
resulted in an excess of single cells (Fig. 4F, n=115, supplementary
material Table S2), suggesting that Stat signalling in ECs is required
for GSC differentiation.
To further establish a second role for Stat in GSC differentiation,
we analysed the outcome of reducing Zfh1 expression in ECs. Zfh1
is a transcriptional target of Stat, which maintains CySCs in the
Drosophila testis (Leatherman and Dinardo, 2008). Similar to woc
and stat phenotypes, removal of Zfh1 by RNAi from ovarian
somatic cells (supplementary material Fig. S1) resulted in
dissociation of ICs and germ cells in larval ovaries (Fig. 4G, 95%
of ovaries, n=21), and a failure of GSC differentiation in adults.
Approximately 70% of the ovaries tested (n=35) were filled with
single cells carrying spherical fusomes (Fig. 4H).
Development (2014) 141, 1-9 doi:10.1242/dev.109611
We next analysed EC protrusions in stat-RNAi and zfh1-RNAi
ovaries. EC extensions were labelled by anti-Coracle, whereas their
nuclei were marked by anti-Tj. Extensions in wild-type germaria
were easy to note (Fig. 4I). However, in stat-RNAi ovaries, EC
extensions in region 1 of the germarium were either missing
(Fig. 4J) or reduced (Fig. 4K). Extensions of ECs closest to the
niche were sometimes observed (Fig. 4K, arrowhead), suggesting
that these ECs may be less affected. zfh1-RNAi ovaries exhibited a
similar lack of EC extensions (Fig. 4L). Our combined analyses
show that Woc, Stat and zfh1, the target gene of Stat, are all required
for GSC differentiation and for soma-germline association.
Woc is required for proper Zfh1 expression
Considering the remarkable phenotypic similarity between zfh1,
woc and stat, we addressed the relationship between Woc and the
Stat pathway. Epistasis analysis showed that Woc did not regulate
Stat levels, neither did Stat affect Woc expression (supplementary
material Fig. S3). Furthermore, activation of Stat by expression of
Upd or HopTum-l did not rescue the woc phenotype, suggesting that
Woc should act in parallel or downstream of Stat activation
(supplementary material Fig. S3). We then tested whether Woc
might induce zfh1 expression in concert or in parallel to Stat. In
early larval third-instar ovaries, Zfh1 protein was expressed in all
somatic cell nuclei. Staining was stronger in nuclei that were in
contact with germ cells (Fig. 5A, compare arrowheads with arrows,
all ovaries, n=20). These cells likely become ICs during the late
third instar. Interestingly, ICs not only express higher levels of Zfh1,
but also show higher levels of Stat labelling than do non-IC cells
from larval ovaries (Fig. 5C,C0 ). Significantly, increased Zfh1 levels
in somatic cells that contact germ cells were not prominent in wocRNAi ovaries (Fig. 5B, compare arrowheads with 5A, all ovaries,
n=23), suggesting that Woc normally regulates this elevation.
To determine whether Woc controls Zfh1 levels in adult ECs,
ovaries were co-stained with anti-Tj antibody to detect ECs, and with
anti-Zfh1 antibody. Tj and Zfh1 staining colocalised (Fig. 5D,D0 ,
arrowheads), indicating that Zfh1 is expressed in ECs, but not in germ
cells. In woc-RNAi ovaries, Tj levels remained normal (compare
Fig. 5D,E, arrowheads), suggesting that protein expression in wocmutant ECs was not generally reduced. In contrast, Zfh1 levels were
Fig. 4. Phenotypic similarity of stat, zfh1 and woc.
(A-D,G) Anti-Tj (magenta) labels ICs. (A,B,F-H) Anti-Vasa
marks PGCs. Somatic overexpression of Upd (A) or
HopTum-l (B) results in additional ICs and PGCs (compare
with WT, Fig. 3A). (C-E) GFP (green) marks wild-type
cells. Large mutant clones of stat92E alleles result in
separation of ICs from PGCs (C,D, outlined). When ECs
are stat92E deficient (E, large stat397 mutant clone;
F, RNAi, compression of several z-sections), additional
single cells (anti-Hts, magenta, arrowheads) are present.
(G) In zfh1-RNAi ovaries, ICs (magenta) do not intermingle
with PGCs (green, outlined). (H) More single germ cells
carrying spherical fusomes (anti-Hts, magenta) are
present in zfh1-RNAi ovaries (arrowheads). (I-L) AntiCoracle (magenta) labels EC extensions and anti-Tj
(green) labels EC nuclei. EC extensions protrude into a
wild-type germarium (I). stat-RNAi germaria, extensions in
region 1 are either missing (J) or reduced (K). Arrowhead
in K indicates an EC nucleus close to the niche, which
retains a protrusion. (L) ECs in zfh1-RNAi germaria also
lack extensions. Scale bars: 10 μm.
4
DEVELOPMENT
RESEARCH ARTICLE
RESEARCH ARTICLE
Development (2014) 141, 1-9 doi:10.1242/dev.109611
Fig. 5. Woc is required for proper Zfh1 expression.
(A,B) Images were taken together with the same confocal
settings. Zfh1 (greyscale) stains all somatic nuclei in larval
ovaries. (A) Wild-type somatic cells in proximity to germ
cells exhibit stronger Zfh1 labelling (compare arrowheads
with arrows). (B) In woc-RNAi ovaries, Zfh1 levels in
somatic nuclei abutting PGCs are not as elevated as in WT
(compare arrowheads in A,B). (C,C0 ) Wild-type larval
ovaries stained with anti-Stat (green in C, greyscale in C0 ).
Higher Stat levels are present in ICs (PGCs are outlined in
C). (D,E) Anti-Tj (green) and anti-Zfh1 (D0 ,E0 , greyscale)
co-stain EC nuclei. Zfh1 staining is reduced in woc-RNAi
ECs (arrowheads E0 , compare with D0 ). woc-RNAi sheath
cells outside the outlined germarium still express high Zfh1
levels. Tj levels are unaffected (compare D with E).
(F) GFP (green) marks wild-type cells. In woc mutant cells
(arrowhead), Zfh1 (magenta in F, greyscale in F0 ) staining
is reduced compared with a neighbouring wild-type cell
(arrow). The nuclei of the marked cells are at the same
confocal plane and can therefore be compared.
(G) Quantification of Zfh1 protein expression in woc- and
stat-deficient cells. P-values of Student’s t-test and s.e.m.
bars are indicated. (H) Real-time qPCR of zfh1 transcripts
comparing bam mutant ovaries with bam mutants that
were also woc deficient. Two different recombinant lines
produced similar results in two independent experiments
(shown combined). (I) Real-time qPCR of zfh1 transcripts
comparing control cells (lacZ dsRNA) to woc dsRNA,
exposed to control or Upd-containing media. Student’s
t-test P-values of five independent experiments are shown.
Scale bars: 10 μm (bar in A applies to A,B; bar in D applies
to D-F).
Woc is required for a Stat-mediated elevation of zfh1
expression
Removing both Stat and Woc from ECs did not result in a significant
reduction in Zfh1 levels compared with removing woc alone
(Fig. 5G, P=0.09), suggesting that Woc and Stat act in concert to
increase Zfh1 levels. To determine how Woc might control Zfh1
levels, we first determined zfh1 RNA expression in ECs by real-time
qPCR. RNA from bamΔ86 ovaries, which contain mainly early germ
cells and ECs, was compared with RNA isolated from bam ovaries
that were also woc-deficient (bamΔ86; woc-RNAi). The two
genotypes are morphologically similar (supplementary material
Fig. S4), making the comparison valid. RT-PCR revealed a ∼50%
reduction in zfh1 expression in bamΔ86; woc-RNAi ovaries
compared with controls (Fig. 5H). Thus, Woc is required for
enhanced zfh1 RNA transcription in ECs.
We next tested how Woc and Stat might cooperate in promoting
zfh1 expression. As Stat is endogenously active in ECs, we chose
S2-NP cells, where Stat activity could be induced upon ligand
addition, and which had previously been shown to activate gene
expression following exposure to the Stat ligand Upd (Baeg et al.,
2005). In control cells, Upd elicited a normal response associated
with Stat signalling, as demonstrated by a ∼6-fold elevation of
Socs36E, a known target of the pathway (supplementary material
Fig. S4) (Baeg et al., 2005; Karsten et al., 2002). zfh1 expression
was elevated by ∼25% upon addition of Upd (Fig. 5I). This modest
elevation was statistically significant and resembled in magnitude
the decrease of either Zfh1 mRNA or protein levels observed in woc
or stat mutant ECs (Fig. 5G,H).
When cells were exposed to RNAi directed against woc in a
medium that did not contain Upd, zfh1 levels did not change
compared with control, lacZ-RNAi cells (Fig. 5I). This confirms that
Woc does not change Zfh1 levels in the resting state, independently of
Stat activation. Significantly, when Upd was added to woc-RNAi
cells, zfh1 expression remained at its uninduced level (Fig. 5I).
Combined, these data strongly support the conclusion that the Statmediated increase in zfh1 transcription requires Woc activity.
Zfh1 is haplo-insufficient and a major Woc target in ECs
Our results thus far suggest that Stat-mediated upregulation of Zfh1
requires Woc, and that this upregulation determines soma-germline
association and GSC/CB differentiation. However, removal of Woc
or Stat results in only a mild reduction in Zfh1 expression (Fig. 5).
We therefore queried whether this Woc/Stat-induced mild elevation
in Zfh1 levels is functionally important. To test this, we examined
germaria of heterozygous flies, carrying one wild-type copy of Zfh1
and one copy of either one of three null zfh1 alleles. In these
heterozygous flies, an increase in the number of single germ cells
carrying a spherical fusome was observed, when compared with the
WT (Fig. 6A-D, supplementary material Table S2). The increase in
single cells was correlated with reduced levels of Zfh1 protein
(Fig. 6E-H0 , supplementary material Table S3). Thus, Zfh1 function
5
DEVELOPMENT
significantly reduced (compare Fig. 5D0 with 5E0 ,G). Similar results
were obtained in woc-mutant cell clones [Fig. 5F,F0, compare wildtype cell (arrow) with mutant cell (arrowhead)]. Quantification of
Zfh1 protein levels revealed an average decrease of 27%-38% in Zfh1
protein levels following woc reduction (Fig. 5G).
Notably, an analysis of male cyst cells revealed a similar
reduction of Zfh1 levels in stat mutant cells relative to the WT
(Leatherman and Dinardo, 2008). We therefore confirmed that stat
mutant female ECs exhibited a similar reduction in Zfh1 protein
levels (Fig. 5G). These results link the wild-type function of both
Stat and Woc to increased Zfh1 levels in somatic cells that contact
the germline.
RESEARCH ARTICLE
Development (2014) 141, 1-9 doi:10.1242/dev.109611
Fig. 6. Haplo-insufficiency of Zfh1 and rescue of wocdeficient ovaries. (A-D) Compression of several z-sections
of WT (A), and of flies heterozygous for three zfh1 alleles
(B-D) labelled by anti-Hts (magenta) to highlight fusomes
within germ cells (anti-Vasa, Green). Arrowheads mark
accumulated single germ cells in heterozygotes. Cysts
are also present in the heterozygous flies (arrows).
(E-H) Heterozygous zfh1 flies express lower levels of Zfh1 in
ECs (marked by arrowheads in E-H and by anti-Tj in E0 -H0 )
compared with WT. Scale bar: 10 μm.
DISCUSSION
The balance between stem cell self-renewal and stem cell
differentiation must be strictly maintained to allow organ
homeostasis. We identify the chromatin-binding factor Woc as a
novel player in GSC differentiation. We further show that efficient
GSC differentiation requires high Zfh1 levels in somatic support cells.
Woc achieves this by assisting a Stat-mediated increase in zfh1
transcription, demonstrating that precise control of gene transcription is
required for correct stem cell differentiation. Stat signalling has been
recognised as a self-renewal signal in both male and female Drosophila
gonads. Our data demonstrate that Stat is also required for GSC
differentiation, and is therefore a cue that controls both maintenance
and differentiation (Fig. 7J).
6
Stat signalling within ECs is required for GSC differentiation
Stat signalling has long been recognised as a stem cell self-renewal
cue in both males and females (Brawley and Matunis, 2004; Decotto
and Spradling, 2005; Issigonis et al., 2009; Kiger et al., 2001;
Leatherman and Dinardo, 2008; Lopez-Onieva et al., 2008; Tulina
and Matunis, 2001; Wang et al., 2008). Here, we uncover a novel Stat
activity by showing that it is required for proper differentiation of the
GSC progeny. Stat is expressed in two distinct cell populations in the
germarium: cap cells and ECs (Decotto and Spradling, 2005; Wang
et al., 2008). GSCs contact cap cells and the anterior-most ECs.
Clonal analysis defined Stat within cap cells as being required
for GSC maintenance by enhancing Dpp expression, which is
indispensable for GSC maintenance (Lopez-Onieva et al., 2008;
Wang et al., 2008). Some contribution to GSC maintenance may also
be provided by ECs that are located at the anterior and contact GSCs,
as they also produce Dpp (Decotto and Spradling, 2005; LopezOnieva et al., 2008; Rojas-Rios et al., 2012; Wang et al., 2008).
In contrast to GSCs, their differentiating daughter cells contact
only ECs. Our data show that removal of Stat from ECs by either
RNAi or mutations results in a surplus of undifferentiated germ cells
(Fig. 4E,F; supplementary material Table S2). Thus, the function of
Stat in distinct cell populations – cap cells or ECs – determines GSC
self-renewal or differentiation, respectively. One possibility is that
the gene expression profile in cap cells and ECs following Stat
activation is different, and that these different targets direct GSC
maintenance or cyst differentiation. Otherwise, Stat response genes
within Cap and ECs may be similar, but the combination with other
cell type-specific signalling pathways will produce differential
responses in germ cells. One emerging common feature of Stat
signalling in all tested ovarian somatic cells is its requirement for
soma-germline adherence.
Soma-germline association and germ cell differentiation
Previous studies suggested that the primary role of Stat is to support
adhesion of stem cells to the niche, thereby promoting exposure of
stem cells to self-renewal cues that are produced by the niche
(Issigonis et al., 2009; Leatherman and Dinardo, 2010). Our work
extends this principle by showing that, in addition to stem-cell niche
adhesion, Stat, Zfh1 and Woc maintain the association of somatic
DEVELOPMENT
in ECs is haplo-insufficient, and correct GSC differentiation
requires Woc to ensure high levels of this protein.
To further test the importance of maintaining the correct levels of
Zfh1 by Woc, we tested whether increased Zfh1 expression from a
UAS promoter would rescue the woc-RNAi phenotype. As a control,
we also over-expressed a mutant form of Zfh1 (Zfh1*) that cannot
function as a repressor (Postigo and Dean, 1999). Overexpression of
either of these proteins alone did not result in overt ovarian phenotypes,
and germline cysts were produced normally (Fig. 7A,B). Significantly,
expression of the WT Zfh1 in woc-RNAi ovaries resulted in a very
strong phenotypic suppression; ∼70% of ovarioles (n=72) contained a
normal complement of cysts (Fig. 7C, compare with Fig. 1C). AntiCoracle staining of somatic EC extensions revealed a similar
restoration of this feature in the rescued ovarioles. Whereas
extensions were lost in woc-RNAi ovaries (compare Fig. 7D
with 7E), prominent extensions could readily be observed between
cysts in the rescued germaria (Fig. 7F). In line with normal cyst
development, egg chambers were observed in all rescued ovarioles, as
opposed to an almost complete lack of egg chambers in woc-RNAi
ovaries (Fig. 7G,H). By contrast, overexpression of Zfh1* could not
rescue woc-RNAi ovaries, which still contained many spherical
fusomes (Fig. 7I). This suggests that the repressor function is required
for Zfh1 activity in ECs. The rescue of the Woc phenotype by Zfh1
suggests that this transcriptional repressor is a major effector of
Stat-mediated response in ECs and a major Woc target.
RESEARCH ARTICLE
Development (2014) 141, 1-9 doi:10.1242/dev.109611
Physical association between ECs and germ cells is crucial for
GSC differentiation (Jin et al., 2013; Kirilly et al., 2011; Schulz
et al., 2002; Shields et al., 2014). Thus, loss of extensive physical
contact with ECs per se could account for the downregulation
phenotypes of stat, woc and zfh1. It is interesting to note that the
germ cell differentiation phenotype can be observed only when the
entire population of ECs within the germarium is mutated, either by
RNAi or by generating very large clones. The fact that few wildtype ECs could rescue GSC differentiation within an entire
germarium suggests that EC extensions are motile and may
contact GSC daughters that are not necessarily close to them
(Morris and Spradling, 2011).
Recently, piwi mutants have been shown to regulate both IC and
EC association with germ cells (Jin et al., 2013). Piwi has been shown
to interact with Tj, with both sharing the IC dissociation phenotype
(Li et al., 2003; Saito et al., 2009). We observed no change in Tj
labelling in woc-RNAi ovaries, suggesting that several pathways may
regulate the association of ECs with GSC daughter cells.
Fig. 7. Zfh1 overexpression can rescue woc-deficient ovaries.
(A-C,G-I) Anti-Hts labels somatic cells and fusomes; anti-Vasa (green) marks
germ cells. (A,B) Developing cysts are marked by arrows. Overexpression of
either a wild-type (A) or a mutated form of Zfh1 (B, Zfh1*) does not impair germ
cell differentiation. (C) Overexpression of Zfh1 in woc-RNAi ovaries rescues
GSC differentiation. Elongated fusomes and germline cysts are present
(arrows). (D-F) Anti-Coracle stains EC extensions (greyscale), which
encapsulate germline cysts in WT (D). (E,F) Compression of several
z-sections, taken with the same confocal settings. (E) A woc-RNAi germarium,
ECs (arrowhead) are present, but lack cell extensions. (F) Rescue of woc-RNAi
ovaries by Zfh1; extensions into the germarium are observed. (G-I) An
entire woc-RNAi ovary. Six ovarioles are shown in this confocal section, all
filled with single germ cells. Very few cysts and no egg chambers are observed.
(H) Upon overexpression of Zfh1, cysts and egg chambers are readily
observed in woc-RNAi ovaries. Four ovarioles are shown in this section.
(I) No rescue of woc-RNAi ovaries by expressing a mutated form of Zfh1.
Single germ cells are observed (arrowheads). (J) A model showing phenotypic
and molecular aspects of Woc function in larval and adult ovaries. Woc is
required for an increase in Zfh1 expression within ICs and ECs, respectively.
Elevated Zfh1 levels are required for soma-germline association and for GSC
differentiation. Scale bars: 10 μm (bar in A applies to A-F).
ICs with PGCs in larval ovaries, and of ECs with GSC daughters
following their departure from the niche. Stat signalling in larval
ovaries and in the germarium appears to be required primarily for
soma-germline association. At each stage of germ cell development,
somatic cells that adhere to germ cells would provide these with
different instructions. The permissive nature of the ovarian function
of Stat can explain the seemingly opposing roles of Stat in GSC
maintenance and differentiation.
RT-qPCR and protein labelling of ECs in adult germaria show that
Woc is required for an elevation in Zfh1 levels. Significantly, in larval
ovaries the cells in contact with germ cells display high Stat and Zfh1
levels, whereas cells at the anterior of the ovary, which do not contact
PGCs, contain lower Stat and Zfh1 levels. Reduction of Woc does not
affect Zfh1 levels in anterior cells, but does reduce Zfh1 levels in cells
that contact germ cells. This mirrors the tissue-culture experiments
and suggests that the Woc-Stat-Zfh1 connection might be conserved
in more than one cell type.
In stat-mutant male cyst cells, Zfh1 protein is reduced by only
about 25-35% (Leatherman and Dinardo, 2008). We show a similar
reduction in both stat92E and woc mutant EC clones in females.
Despite this mild effect on Zfh1 levels, cyst differentiation defects in
woc-RNAi ovaries are rescued by Zfh1 overexpression. This
suggests that Zfh1 is a major target of Woc in ECs, and that
correct levels of Zfh1 in these cells are of particular importance.
Indeed, our data show a haplo-insufficiency of Zfh1 function in the
germarium (Fig. 6, supplementary material Table S2). Interestingly,
heterozygosity of Zfhx1b, a human homologue of the fly Zfh1,
causes the Mowat-Wilson mental retardation syndrome in humans
(Zweier et al., 2002). Thus, haplo-insufficiency of this protein in
specific cells may be a feature of this transcriptional repressor.
Further studies will be needed to determine whether Woc is required
for increased expression of other haplo-insufficient genes.
Whereas promoting EC extensions through Zfh1 seems a major
route of Woc function in ECs, the possibility of additional Woc/Stattargets in ECs, which help differentiate GSCs, has not been ruled out.
Supporting the hypothesis of additional target genes is the observed
overproliferation of ICs in larval ovaries, which is induced by
overactivation of Stat or overexpression of Woc (Figs 3, 4), but not
by Zfh1 (not shown). To resolve this matter, identifying additional
targets of Stat and a better understanding of how Zfh1 affects ECs
must be achieved. In addition, Woc may have other main targets in
other cell types. Supporting this notion is the fact that whereas Zfh1
could rescue woc-mutant germaria, egg chamber development was
still aberrant, suggesting a different target of Woc in follicle cells.
Woc is most closely related to the mammalian MYM-type
(ZMYM: zinc finger, myeloproliferative and mental retardation
motif ) family of zinc-finger transcription factors. Aberrations in
ZMYM2 (Znf198) and ZMYM3 (Znf261) proteins are associated
with a myeloproliferative syndrome and with mental retardation,
respectively (Smedley et al., 1999). Our findings that Woc controls
7
DEVELOPMENT
Requirement for Woc in Stat-mediated Zfh1 expression
RESEARCH ARTICLE
MATERIALS AND METHODS
Fly stocks
Stocks that were used in this study are listed in the supplementary material
Table S4. Germline clones were generated using hs-flp;; FRT82B,nls-GFP.
Somatic clones were generated using c587-Gal4,UAS-flp;; FRT82B,nlsGFP. The Minute technique (Newsome et al., 2000) was used to generate
large somatic clones, mutant clones or wild-type (FRT82B) clones with
c587-Gal4,UAS-flp;; FRT82B,nls-GFP, RpS3.
Antibody staining
Antibodies were used in the following concentrations: mouse monoclonal
anti-Hts (1B1; 1:20) and anti-Coracle (1:200, catalogue no. C615.16) were
from the Developmental Studies Hybridoma Bank (DSHB); rabbit anti-Vasa
(1:5000) and anti-Zfh1 (1:5000) were a gift from Dr Ruth Lehmann (HHMI,
New York University, USA); rabbit anti-Woc (1:2000) was a gift from
Dr Maurizio Gatti (Università di Roma, Italy); rabbit anti-Stat92E (1:1000),
which recognises the whole pool of Stat protein in the cell, was a gift from
Dr Erika Bach (NYU School of Medicine, USA); guinea pig anti-Tj (1:7000)
was a gift from Dr Dorothea Godt (University of Toronto, Canada); rabbit
anti-pSMAD3 (1:100, catalogue no. 1880-1) was from Epitomics; and rabbit
anti-GFP (1:1000, catalogue no. A11122) was from Invitrogen. Secondary
antibodies were from Jackson ImmunoResearch or from Invitrogen and used
according to instructions. Young adult ovaries and late third-instar larval
gonads were obtained as previously described (Maimon and Gilboa, 2011).
Fixation and immunostaining were performed as described before (Gancz
et al., 2011). Confocal imaging was performed with Zeiss LSM 710 on a
Zeiss Observer Z1. Cell counts were carried out with the DeadEasy plug-in
in ImageJ.
Quantification of Zfh1 staining intensity
Control and experimental animals were dissected and stained on the same
day. Images were acquired on the same day, with the same acquisition
parameters. For each germarium, consecutive 1 μm z-sections were taken.
The brightest section for each EC was measured with the measure tool in
ImageJ software. A minimum of 18 cells from two to four independent
experiments are shown.
Cell culture, transfection and RNAi
S2-NP cells were a gift from Dr Norbert Perrimon (Harvard Medical School,
USA) and were maintained at 25°C in Drosophila Schneider’s medium
(Biological Industries, Israel) containing 10% foetal bovine serum (FBS,
GIBCO) and 1% penicillin–streptomycin (GIBCO). dsRNA synthesis was
carried out according to a Drosophila RNAi Screening Center (DRSC)
protocol using Readymix (ABgene), MEGAscript T7 kit (Ambion) and
RNAeasy (Qiagen). Two different amplicons chosen from the DRSC
database were tested for each gene to assure a transcript-specific reduction;
results from one amplicon are shown. Amplicon IDs DRSC15928 and
DRSC36479 were used for woc, DRSC16870 and DRSC37655 for stat and
DRSC24562 for lacZ.
Using a standard protocol, 6 μg of dsRNA against either woc or lacZ were
applied to 0.4×106 cells in 12-well plates 72 h prior to a 2 h incubation with
Upd-containing or control medium. To obtain Upd-containing media,
0.6×106 cells were transfected with 54 ng act5-upd (a gift from Dr Norbert
Perrimon) or act5-gal4 and pUAST (gifts from Dr Talila Volk, Weizmann
Institute, Israel) as control, using Escort IV (Sigma) in a 1:1 ratio according
to the manufacturer’s protocol. Medium containing Upd or control medium
were collected 72 h later and added to RNAi-treated cells.
Reverse transcription quantitative PCR (RT-qPCR)
Approximately 40 ovaries were collected from very young females (a few
hours to 2 days old) and RNA was purified either using Tri-Reagent (MRC)
followed by a DNAse treatment or with the RNeasy kit (Qiagen) for
8
harvested cells. Reverse transcription was performed with High Capacity
cDNA Reverse Transcription kit (Applied Biosystems). Quantitative PCR
(qPCR) used SYBR Green (Invitrogen) with the following primers (forward
and reverse): CGCCCAGGAGGAGTTCCT and GCAGTCGAAGCTGAACTTGTGA for Socs36E; GAGCACATTGCATGTTCACGTT and
GTCACCATTTCCCAGTTGCAT for stat92E; GCAAGTTCTCCGTGCTTTACAA and GAACATGCGGCGAATGG for woc; CGCCGGCGTTCTGATG and CGTTGACCGGAATGCTCGTAT for zfh1; CGTCAATGGTGTATTTATGTTGCA and ACGACACACACGCATCTAAGATTT
for bgcn (all from Sigma-Aldrich). Per reaction, 40 ng cDNA were used for
qPCR, performed in triplicates in Applied Biosystems StepOne, analysed by
DDCT and normalised to RpS17.
Statistical analyses
Experiments were repeated at least three independent times. For statistical
analyses, two-tailed Student’s t-tests were performed. P-values are reported
and s.d. or s.e.m. bars, as indicated, are shown.
Acknowledgements
We thank the TRiP at Harvard Medical School (NIH/NIGMS R01-GM084947) for
providing transgenic RNAi fly stocks used in this study. We thank the Bloomington,
FlyTrap, NIG-FLY and VDRC stock collections for the stocks used in this study.
We acknowledge the FlyBase team for keeping an updated, state-of-the-art
database for the entire community.
Competing interests
The authors declare no competing financial interests.
Author contributions
I.M. designed and performed most experiments, carried out data analysis and
handled the manuscript. M.P. conducted RT-PCR experiments. L.G. designed the
experiments and handled the manuscript.
Funding
This work was supported by the Israel Science Foundation [1146/08], by a Marie
Curie Re-Integration grant [FP7-People-IRG no. 230877] and by an Israel Cancer
Research Fund grant [no. 12-3073-PG].
Supplementary material
Supplementary material available online at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.109611/-/DC1
References
Ables, E. T. and Drummond-Barbosa, D. (2010). The steroid hormone ecdysone
functions with intrinsic chromatin remodeling factors to control female germline
stem cells in Drosophila. Cell Stem Cell 7, 581-592.
Baeg, G.-H., Zhou, R. and Perrimon, N. (2005). Genome-wide RNAi analysis of
JAK/STAT signaling components in Drosophila. Genes Dev. 19, 1861-1870.
Brawley, C. and Matunis, E. (2004). Regeneration of male germline stem cells by
spermatogonial dedifferentiation in vivo. Science 304, 1331-1334.
Buszczak, M., Paterno, S., Lighthouse, D., Bachman, J., Planck, J., Owen, S.,
Skora, A. D., Nystul, T. G., Ohlstein, B., Allen, A. et al. (2007). The carnegie
protein trap library: a versatile tool for Drosophila developmental studies. Genetics
175, 1505-1531.
Chen, D. and McKearin, D. (2003a). Dpp signaling silences bam transcription directly
to establish asymmetric divisions of germline stem cells. Curr. Biol. 13, 1786-1791.
Chen, D. and McKearin, D. M. (2003b). A discrete transcriptional silencer in the
bam gene determines asymmetric division of the Drosophila germline stem cell.
Development 130, 1159-1170.
Decotto, E. and Spradling, A. C. (2005). The Drosophila ovarian and testis stem
cell niches: similar somatic stem cells and signals. Dev. Cell 9, 501-510.
Flaherty, M. S., Salis, P., Evans, C. J., Ekas, L. A., Marouf, A., Zavadil, J.,
Banerjee, U. and Bach, E. A. (2010). chinmo is a functional effector of the JAK/
STAT pathway that regulates eye development, tumor formation, and stem cell
self-renewal in Drosophila. Dev. Cell 18, 556-568.
Font-Burgada, J., Rossell, D., Auer, H. and Azorin, F. (2008). Drosophila HP1c
isoform interacts with the zinc-finger proteins WOC and Relative-of-WOC to
regulate gene expression. Genes Dev. 22, 3007-3023.
Fortini, M. E., Lai, Z. C. and Rubin, G. M. (1991). The Drosophila zfh-1 and zfh-2
genes encode novel proteins containing both zinc-finger and homeodomain
motifs. Mech. Dev. 34, 113-122.
Fuller, M. T. and Spradling, A. C. (2007). Male and female Drosophila germline
stem cells: two versions of immortality. Science 316, 402-404.
DEVELOPMENT
Zfh1 expression downstream of Stat activation, and the similar
haplo-insufficiency of Zfh1 in both systems, open new avenues for
research into ZMYM2 and ZMYM3 function in mammalian
development and human disease.
Development (2014) 141, 1-9 doi:10.1242/dev.109611
Gancz, D. and Gilboa, L. (2013). Insulin and Target of rapamycin signaling
orchestrate the development of ovarian niche-stem cell units in Drosophila.
Development 140, 4145-4154.
Gancz, D., Lengil, T. and Gilboa, L. (2011). Coordinated regulation of niche and
stem cell precursors by hormonal signaling. PLoS Biol. 9, e1001202.
Gilboa, L. and Lehmann, R. (2006). Soma-germline interactions coordinate
homeostasis and growth in the Drosophila gonad. Nature 443, 97-100.
Gilboa, L., Forbes, A., Tazuke, S. I., Fuller, M. T. and Lehmann, R. (2003).
Germline stem cell differentiation in Drosophila requires gap junctions and
proceeds via an intermediate state. Development 130, 6625-6634.
Harris, R. E. and Ashe, H. L. (2011). Cease and desist: modulating short-range Dpp
signalling in the stem-cell niche. EMBO Rep. 12, 519-526.
Issigonis, M., Tulina, N., de Cuevas, M., Brawley, C., Sandler, L. and Matunis, E.
(2009). JAK-STAT signal inhibition regulates competition in the Drosophila testis
stem cell niche. Science 326, 153-156.
Jin, Z., Flynt, A. S. and Lai, E. C. (2013). Drosophila piwi mutants exhibit germline
stem cell tumors that are sustained by elevated Dpp signaling. Curr. Biol. 23,
1442-1448.
Karsten, P., Hä der, S. and Zeidler, M. P. (2002). Cloning and expression of
Drosophila SOCS36E and its potential regulation by the JAK/STAT pathway.
Mech. Dev. 117, 343-346.
Kiger, A. A., Jones, D. L., Schulz, C., Rogers, M. B. and Fuller, M. T. (2001). Stem
cell self-renewal specified by JAK-STAT activation in response to a support cell
cue. Science 294, 2542-2545.
Kirilly, D. and Xie, T. (2007). The Drosophila ovary: an active stem cell community.
Cell Res. 17, 15-25.
Kirilly, D., Wang, S. and Xie, T. (2011). Self-maintained escort cells form a germline
stem cell differentiation niche. Development 138, 5087-5097.
Leatherman, J. L. and Dinardo, S. (2008). Zfh-1 controls somatic stem cell selfrenewal in the Drosophila testis and nonautonomously influences germline stem
cell self-renewal. Cell Stem Cell 3, 44-54.
Leatherman, J. L. and Dinardo, S. (2010). Germline self-renewal requires cyst
stem cells and stat regulates niche adhesion in Drosophila testes. Nat. Cell Biol.
12, 806-811.
Li, M. A., Alls, J. D., Avancini, R. M., Koo, K. and Godt, D. (2003). The large Maf
factor Traffic Jam controls gonad morphogenesis in Drosophila. Nat. Cell Biol. 5,
994-1000.
Lim, J. G. Y. and Fuller, M. T. (2012). Somatic cell lineage is required for
differentiation and not maintenance of germline stem cells in Drosophila testes.
Proc. Natl. Acad. Sci. U.S.A. 109, 18477-18481.
Lopez-Onieva, L., Fernandez-Minan, A. and Gonzalez-Reyes, A. (2008). Jak/
Stat signalling in niche support cells regulates dpp transcription to control germline
stem cell maintenance in the Drosophila ovary. Development 135, 533-540.
Maimon, I. and Gilboa, L. (2011). Dissection and staining of Drosophila larval
ovaries. J. Vis. Exp. e2537.
Morris, L. X. and Spradling, A. C. (2011). Long-term live imaging provides new
insight into stem cell regulation and germline-soma coordination in the Drosophila
ovary. Development 138, 2207-2215.
Newsome, T. P., Asling, B. and Dickson, B. J. (2000). Analysis of Drosophila
photoreceptor axon guidance in eye-specific mosaics. Development 127,
851-860.
Ohlstein, B. and McKearin, D. (1997). Ectopic expression of the Drosophila Bam
protein eliminates oogenic germline stem cells. Development 124, 3651-3662.
Development (2014) 141, 1-9 doi:10.1242/dev.109611
Postigo, A. A. and Dean, D. C. (1999). ZEB represses transcription through
interaction with the corepressor CtBP. Proc. Natl. Acad. Sci. U.S.A. 96,
6683-6688.
Raffa, G. D., Cenci, G., Siriaco, G., Goldberg, M. L. and Gatti, M. (2005). The
putative Drosophila transcription factor woc is required to prevent telomeric
fusions. Mol. Cell 20, 821-831.
Rangan, P., Malone, C. D., Navarro, C., Newbold, S. P., Hayes, P. S.,
Sachidanandam, R., Hannon, G. J. and Lehmann, R. (2011). piRNA
production requires heterochromatin formation in Drosophila. Curr. Biol. 21,
1373-1379.
Rojas-Rı́os, P., Guerrero, I. and Gonzá lez-Reyes, A. (2012). Cytoneme-mediated
delivery of hedgehog regulates the expression of bone morphogenetic proteins to
maintain germline stem cells in Drosophila. PLoS Biol. 10, e1001298.
Saito, K., Inagaki, S., Mituyama, T., Kawamura, Y., Ono, Y., Sakota, E., Kotani,
H., Asai, K., Siomi, H. and Siomi, M. C. (2009). A regulatory circuit for piwi by the
large Maf gene traffic jam in Drosophila. Nature 461, 1296-1299.
Schulz, C., Wood, C. G., Jones, D. L., Tazuke, S. I. and Fuller, M. T. (2002).
Signaling from germ cells mediated by the rhomboid homolog stet organizes
encapsulation by somatic support cells. Development 129, 4523-4534.
Shields, A. R., Spence, A. C., Yamashita, Y. M., Davies, E. L. and Fuller, M. T.
(2014). The actin-binding protein profilin is required for germline stem cell
maintenance and germ cell enclosure by somatic cyst cells. Development 141,
73-82.
Singh, S. R., Zheng, Z., Wang, H., Oh, S. W., Chen, X. and Hou, S. X. (2010).
Competitiveness for the niche and mutual dependence of the germline and
somatic stem cells in the Drosophila testis are regulated by the JAK/STAT
signaling. J. Cell Physiol. 223, 500-510.
Smedley, D., Hamoudi, R., Lu, Y.-J., Cooper, C. and Shipley, J. (1999). Cloning
and mapping of members of the MYM family. Genomics 60, 244-247.
Spradling, A., Fuller, M. T., Braun, R. E. and Yoshida, S. (2011). Germline stem
cells. Cold Spring Harb. Perspect. Biol. 3, a002642.
Tulina, N. and Matunis, E. (2001). Control of stem cell self-renewal in Drosophila
spermatogenesis by JAK-STAT signaling. Science 294, 2546-2549.
Wang, L., Li, Z. and Cai, Y. (2008). The JAK/STAT pathway positively regulates
DPP signaling in the Drosophila germline stem cell niche. J. Cell Biol. 180,
721-728.
Warren, J. T., Wismar, J., Subrahmanyam, B. and Gilbert, L. I. (2001). Woc
(without children) gene control of ecdysone biosynthesis in Drosophila
melanogaster. Mol. Cell. Endocrinol. 181, 1-14.
Wismar, J., Habtemichael, N., Warren, J. T., Dai, J.-D., Gilbert, L. I. and Gateff, E.
(2000). The mutation without children(rgl) causes ecdysteroid deficiency in thirdinstar larvae of Drosophila melanogaster. Dev. Biol. 226, 1-17.
Xie, T. and Spradling, A. C. (1998). decapentaplegic is essential for the
maintenance and division of germline stem cells in the Drosophila ovary. Cell
94, 251-260.
Xie, T. and Spradling, A. C. (2000). A niche maintaining germline stem cells in the
Drosophila ovary. Science 290, 328-330.
Zweier, C., Albrecht, B., Mitulla, B., Behrens, R., Beese, M., GillessenKaesbach, G., Rott, H. D. and Rauch, A. (2002). “Mowat-Wilson” syndrome
with and without Hirschsprung disease is a distinct, recognizable multiple
congenital anomalies-mental retardation syndrome caused by mutations in the
zinc finger homeo box 1B gene. Am. J. Med. Genet. 108, 177-181.
DEVELOPMENT
RESEARCH ARTICLE
9

Download Report