REPRODUCTION-DEVELOPMENT
A Novel Isoform of Liver Receptor Homolog-1 Is
Regulated by Steroidogenic Factor-1 and the
Specificity Protein Family in Ovarian Granulosa Cells
Shinya Kawabe, Takashi Yazawa, Masafumi Kanno, Yoko Usami,
Tetsuya Mizutani, Yoshitaka Imamichi, Yunfeng Ju, Takehiro Matsumura,
Makoto Orisaka, and Kaoru Miyamoto
Department of Biochemistry (S.K., T.Y., M.K., Y.U., T.Mi., Y.I., Y.J., T.Ma., K.M), and Department of
Obstetrics and Gynecology (M.O.), Faculty of Medical Sciences, Translational Research Center,
Organization for Life Science Advancement Programs (S.K., T.Y., T.Mi., Y.I., K.M.), and Headquarters for
the Advancement of High Priority Research (Y.I.), University of Fukui, Fukui 910-1193, Japan
Co
pi
aa
ut
or
iza
da
p
or
CD
R
Liver receptor homolog-1 (LRH-1) is a member of the nuclear receptor 5A (NR5A) subfamily. It is
expressed in granulosa cells of the ovary and is involved in steroidogenesis and ovulation. To reveal
the transcriptional regulatory mechanism of LRH-1, we determined its transcription start site in the
ovary using KGN cells, a human granulosa cell tumor cell line. 5⬘-rapid amplification of cDNA ends
PCR revealed that human ovarian LRH-1 was transcribed from a novel transcription start site,
termed exon 2o, located 41 bp upstream of the reported exon 2. The novel LRH-1 isoform was
expressed in the human ovary but not the liver. Promoter analysis and an EMSA indicated that a
steroidogenic factor-1 (SF-1) binding site and a GC box upstream of exon 2o were required for
promoter activity, and that SF-1 and specificity protein (Sp)-1/3 bind to the respective regions in
ovarian granulosa cells. In KGN cells, transfection of SF-1 increased ovarian LRH-1 promoter activity
and SF-1-dependent reporter activity was further enhanced when peroxisome proliferator-activated receptor-␥ coactivator-1␣ (PGC-1␣) was cotransfected. In Drosophila SL2 cells, Sp1 was more
effective than Sp3 in enhancing promoter activity, and co-transfection of the NR5A-family synergistically increased activity. Infection with adenoviruses expressing SF-1 or PGC-1␣ induced LRH-1
expression in KGN cells. These results indicate that the expression of human LRH-1 is regulated in
a tissue-specific manner, and that the novel promoter region is controlled by the Sp-family, NR5Afamily and PGC-1␣ in ovarian granulosa cells in a coordinated fashion. (Endocrinology 154:
1648 –1660, 2013)
L
iver receptor homolog-1 (LRH-1) is a Cys2-Cys2 zinc
finger transcription factor that belongs to the nuclear
receptor (NR) 5A subfamily (1). LRH-1 (also known as
NR5A2) binds a consensus sequence, YCAAGGYCR, in
the promoter region of target genes (2). LRH-1 genes are
widely conserved among vertebrates (1), and the human
LRH-1 gene consists of eight exons spanning over 150 kb
on chromosome 1q32.11 (1). LRH-1 was first isolated
from endodermal tissues (2-4) and plays a key role in the
reverse cholesterol transport and bile-acid homeostasis (2,
5-11). LRH-1 expression is controlled by hepatocyte nuclear factor (HNF)-1␣ and HNF-3 in the liver (12) and by
pancreatic-duodenal homeobox 1 in the pancreas (13).
LRH-1 maintains pluripotency through the expression of
Oct4 in mouse embryonic stem (ES) cells at the epiblast
stage (14). LRH-1-knockout mice embryos die at embryonic day 6.5–7.5 with visceral endoderm dysfunction (15),
suggesting that LRH-1 is essential not only for cholesterol
ISSN Print 0013-7227 ISSN Online 1945-7170
Printed in U.S.A.
Copyright © 2013 by The Endocrine Society
Received October 2, 2012. Accepted February 11, 2013.
First Published Online March 7, 2013
Abbreviations: Adx-, adenoviruses expressing; 8Br-cAMP, 8-bromo-cAMP; CL, corpus luteum; ES, embryonic stem; FBS, fetal bovine serum; gc-LRH-1, granulosa cell-derived
LRH-1; HEK, human embryonic kidney; HNF, hepatocyte nuclear factor; li-LRH-1, liver type
LRH-1; LRH-1, liver receptor homolog-1; NR5A, nuclear receptor 5A; PKA, protein kinase
A; RACE, rapid amplification of cDNA ends; siRNA, small interfering RNA; Sp, specificity
protein; SF-1, steroidogenic factor-1; StAR, steroidogenic acute regulatory protein; TSS,
transcriptional start site; WCE, whole cell extract.
1648
endo.endojournals.org
Endocrinology, April 2013, 154(4):1648 –1660
doi: 10.1210/en.2012-2008
20/05/2014
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 20 May 2014. at 07:46 For personal use only. No other uses without permission. . All rights reserved.
doi: 10.1210/en.2012-2008
endo.endojournals.org
or
CD
R
oxisome proliferator-activated receptor-␥ coactivator
with a role in adaptive thermogenesis in brown adipose
tissue and skeletal muscle (39). PGC-1␣ can augment the
activity of several NRs by the binding of its LXXLL motif
to the conserved NR activation function-2 motif (40 – 42).
Our previous studies found that ovarian PGC-1␣ is expressed specifically in granulosa cells and markedly enhances the transcriptional activity of LRH-1 and SF-1
(43). Interestingly, PGC-1␣ induced LRH-1 expression
and stimulated progesterone synthesis in ovarian granulosa cells. The transcriptional mechanism of LRH-1 in the
liver and pancreas is well studied (12, 13), but its ovarian
transcription is poorly understood.
In the ovarian granulosa cells, the functions of SF-1 and
LRH-1 in part overlap; however, they obviously play different roles for follicle maturation and ovulation. Despite
many studies, their mechanisms of action have not yet
been solved. In this study, we focused on the transcriptional regulation of ovarian LRH-1 to provide a new insight into the NR5A-family in the ovary. We determined
the novel ovarian specific transcription start site (TSS) of
LRH-1 using KGN cells, a human granulosa cell tumor
cell line expressing both SF-1 and LRH-1. We identified
the 5⬘-flanking region of the human ovarian LRH-1 gene,
which contains an SF-1 binding site and a specificity protein (Sp) binding site (GC box). Our data also indicated
that LRH-1 expression is under the control of the NR5Aand Sp-family and that its promoter activity is enhanced by
PGC-1␣ in ovarian granulosa cells in a coordinated
fashion.
Co
pi
aa
ut
or
iza
da
p
homeostasis but also for embryonic development and
differentiation.
Another NR5A subfamily member, steroidogenic factor-1 (SF-1) (16) also called NR5A1 and adrenal 4 binding
protein (17), is a key regulator of steroidogenesis and is
essential for the development of adrenal gland and gonads
(18, 19). SF-1 knockout results in adrenal and gonadal
aplasia in newborn mice (20, 21). It is mainly expressed in
steroidogenic tissues (adrenal cortex, testis, and ovary)
and to a lesser extent in pituitary gonadotropes and the
ventromedial hypothalamus. SF-1 target genes include steroidogenesis-related genes such as cytochrome P450
(CYP) steroid hydroxylases, sex determination, and reproductive genes (18, 19).
Over the past decade, high LRH-1 expression has also
been identified in ovarian granulosa and luteal cells (8,
22–28), which synthesize estrogen and progesterone, respectively (29, 30). Several studies have reported that
LRH-1 plays a crucial role in ovarian progesterone synthesis. For example, higher progesterone production is observed in LRH-1-overexpressing rat granulosa cells stimulated by FSH (31), whereas Nr5a2⫹/⫺ female mice
exhibited impaired progesterone production, reduced fertility and diminished ovarian expression of the steroidogenic acute regulatory protein (StAR) (32). In human
granulosa cells, LRH-1 directly regulates the expression of
3-hydroxysteroid dehydrogenase type II (HSD3B2) (27),
StAR (33), and CYP11A1 (34). Moreover, mouse granulosa cell-specific conditional knockout of LRH-1 previously led to anovulation and a reduction in progesterone
levels (35).
Because LRH-1 deficiency cannot be compensated for
with SF-1 expressed in granulosa cells, it is thought that
LRH-1 is a key regulator of ovulation and steroidogenesis
in the ovary. Interestingly, LRH-1 is expressed at extremely high levels in the human corpus luteum (CL)
whereas SF-1 is maintained at low levels (27, 36). Therefore, LRH-1 might be the main regulator of steroidogenesis and the differentiation of granulosa cells into luteinized granulosa cells. Recently, we demonstrated that
LRH-1 could induce the differentiation of human bone
marrow-derived mesenchymal stem cells into steroidogenic cells in combination with cAMP treatment (37),
which led to the induction of various steroidogenesis-related genes (HSD3B2, StAR, CYP11A1, CYP17, and
CYP19) in LRH-1-transduced human bone marrow-derived mesenchymal stem cells. This shows that LRH-1 is
an important regulator of steroidogenesis.
Peroxisome proliferator-activated receptor-␥ coactivator-1␣ (PGC-1␣) is a multifunctional coactivator that acts
as a central regulator of cellular energy metabolism (38).
Initially, PGC-1␣ was identified as a cold-inducible per-
1649
Materials and Methods
Animals, cell culture, transfection, and luciferase
assay
Granulosa cells were obtained from immature Sprague Dawley female rats (21 d old) that received an injection of 2 mg
diethylstilbestrol in 0.2 mL sesame oil once daily over 4 consecutive days. Granulosa cell culture was performed as described
previously (44). Briefly, the ovaries were excised, and granulosa
cells were released by puncturing the follicles with a 26-gauge
needle. At all times, the animals were treated according to NIH
guidelines. Granulosa cells were collected by brief centrifugation
and then cultured in DMEM/Ham’s F-12 (Wako, Osaka, Japan)
supplemented with 0.1% BSA and gentamycin on 24-well collagen-coated plates at 5 ⫻ 105 cells per well. Each reporter plasmid was transfected into cells using FuGENE 6 (Roche, Indianapolis, Indiana) as described previously (44).
Human embryonic kidney (HEK) 293 and HepG2 (a human
hepatocellular carcinoma cell line) cells were cultured in DMEM
with 10% fetal bovine serum (FBS). The human granulosa cell
tumor-derived cell line KGN (45) (kindly provided by Dr Toshihiko Yanase, Fukuoka University, Fukuoka, Japan) and human
granulosa-luteal cells from women undergoing transvaginal
20/05/2014
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 20 May 2014. at 07:46 For personal use only. No other uses without permission. . All rights reserved.
Transcriptional Regulation of Ovarian LRH-1.
Total RNA from cultured cells was extracted using Trizol
reagent (Invitrogen). The 5⬘- and 3⬘-RACE-Ready cDNAs were
synthesized from 5 g total RNA using the GeneRacer Kit (Invitrogen) according to the manufacturer’s instructions. PCR for
RACE was performed in a 50 L reaction mixture comprising
KOD -Plus- (Toyobo, Osaka, Japan). The gene-specific primers
for RACE are listed in Table 1. The cDNA fragments obtained
from 5⬘- and 3⬘-RACE were dA-tailed with A-attachment mix
(Toyobo), and the products were subcloned into the pGEM-T
Easy vector (Promega). DNA sequencing was performed by an
ABI Prism 3130X Genetic Analyzer (Applied Biosystems).
RT-PCR and quantitative real-time PCR
R
RT-PCR and quantitative real-time PCR were performed as
described previously (46). The PCR products were separated by
electrophoresis on 1.5% agarose gels, and the resulting bands
were visualized by staining with ethidium bromide. The genespecific primers for RT-PCR and real-time PCR are listed in
Table 1.
Plasmids
The human ovarian LRH-1 promoter was amplified by PCR
and cloned into the pGL3 Basic vector (Promega). Mutations of
the SF-1 binding site and GC box in the ovarian LRH-1 promoter
Nucleotide Sequences of Oligonucleotides Used in PCR, Plasmid Construction and EMSAs
ut
pi
aa
5⬘-CGACTGGAGCACGAGGACACTGA-3⬘
5⬘-GGACACTGACATGGACTGAAGGAGTA-3⬘
5⬘-CTTCTTTTCGCCGGAGTTGAATCTGTGC-3⬘
5⬘-GTTGAATCTGTGCTGCCCGTG-3⬘
Co
RACE-PCR
5⬘-RACE 1st PCR
5⬘-RACE 2nd PCR
3⬘-RACE 1st PCR
3⬘-RACE 2nd PCR
RT-PCR
Total LRH-1
Ovary type LRH-1
Liver type LRH-1
-actin
Real-time PCR
Total LRH-1
SF-1
-actin
Plasmid construct
LRH-1 (⫺2802/⫹68)
Site-directed
mutagenesis
Mutation-GC box
Mutation-SF-1 binding
site ver.1
Mutation-SF-1 binding
site ver.2
EMSAs
LRH-1 (⫺72/⫺53)
LRH-1 (⫺72/⫺53)
Mutation
LRH-1 (⫺157/⫺130)
LRH-1 (⫺157/⫺130)
Mutation
Sense
or
Usage
iza
Table 1.
Rapid amplification of cDNA ends (RACE)
CD
oocyte retrieval for in vitro fertilization were cultured in DMEM/
Ham’s F-12 medium with 10% FBS. For mithramycin A (Sigma,
St. Louis, Missouri) treatment, HepG2 and KGN cells were incubated with or without 100 nM mithramycin A for 24 hours
before RNA or protein extraction. Cells were seeded in 24-well
plates at 1 ⫻ 105 cells per well 24 hours before transfection.
Reporter plasmids or expression vectors were transfected into
cells using Lipofectamine and Lipofectamine Plus reagents (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Luciferase activity was determined using a dual-luciferase
reporter assay system (Promega Corp, Madison, Wisconsin) according to the manufacturer’s instructions. Measurements were
made using a Lumat LB9501 luminometer (Berthold, Wildbad,
Germany) as described previously (44).
Schneider line 2 (SL2) cells (Drosophila cell line) were kindly
provided by Dr. Tamio Noguchi (Osaka Ohtani University,
Osaka, Japan) and were cultured in Schneider’s Drosophila medium (Invitrogen) with 10% FBS at 25°C. Cells were seeded into
six-well plates at 1 ⫻ 106 cells per well 24 hours before transfection. Reporter plasmids or expression vectors were transfected using the Calcium Phosphate Transfection Kit (Invitrogen) according to the manufacturer’s instructions. Luciferase
activity was determined using a Dual-Light System (Applied Biosystems, Foster City, California) and a Lumat LB9501 luminometer according to the manufacturer’s instructions.
Endocrinology, April 2013, 154(4):1648 –1660
or
Kawabe et al
da
p
1650
Antisense
5⬘-GGCCCTGTCTCTCTTGTACATTGGC-3⬘
5⬘-TATTCCTTCCTCCACGCATTCGGTC-3⬘
5⬘-GCTGTCAACGATACGCTACGTAACG-3⬘
5⬘-CGCTACGTAACGGCATGACAGTG-3⬘
5⬘-AGCTAGAAGCTGTAAGGGCCGAC-3⬘
5⬘-GTTGAATCTGTGCTGCCCGTG-3⬘
5⬘-GTGTCCTTCCCAAGGCCACG-3⬘
5⬘-CGTGATGGTGGGCATGGGTC-3⬘
5⬘-TTTTAGCCTGGACTTGAGGCTCA-3⬘
5⬘-CTTCCTCCACGCATTCGGTCG-3⬘
5⬘-CTTCCTCCACGCATTCGGTCG-3⬘
5⬘-CGTACATGGCTGGGGTGTTG-3⬘
5⬘-TACCGACAAGTGGTACATGGAA-3⬘
5⬘-GGAGTTTGTCTGCCTCAAGTTCA-3⬘
5⬘-GGACTTCGAGCAAGAGATGG-3⬘
5⬘-CGGCTTGTGATGCTATTATGGA-3⬘
5⬘-CGTCTTTCACCAGGATGTGGTT-3⬘
5⬘-AAGGAAGGCTGGAAGAGTGC-3⬘
5⬘-acgcgtCTCTTTCAGTCCCCCTCCATTTCGC-3⬘
5⬘-ctcgagATCCGTGTCGGTCCGGAAGCCCAGC-3⬘
5⬘-GAGGATTTTTAGGCACGCTCCGGCGAGGCG-3⬘
5⬘-TTAAAACTGAAATAATAATCGCAGCTTGGG-3⬘
5⬘-CGCCTCGCCGGAGCGTGCCTAAAAATCCTC-3⬘
5⬘-CCCAAGCTGCGATTATTATTTCAGTTTTAA-3⬘
5⬘-CTTTTTTAAAACTGAAATCCTCCTCGCAGC-3⬘
5⬘-GCTGCGAGGAGGATTTCAGTTTTAAAAAAG-3⬘
5⬘-GCCCCGAGGAGGCGGAGGCA-3⬘
5⬘-GCCCCGAGGATTTTTAGGCA-3⬘
5⬘-TGCCTCCGCCTCCTCGGGGC-3⬘
5⬘-TGCCTAAAAATCCTCGGGGC-3⬘
5⬘-TTTTTTAACCCTGACCTCCTCCTCGCAG-3⬘
5⬘-TTTTTTAAAACTGAAATAATAATCGCAG-3⬘
5⬘-CTGCGAGGAGGAGGTCAGGGTTAAAAAA-3⬘
5⬘-CTGCGATTATTATTTCAGTTTTAAAAAA-3⬘
Mutated bases are underlined.
20/05/2014
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 20 May 2014. at 07:46 For personal use only. No other uses without permission. . All rights reserved.
doi: 10.1210/en.2012-2008
endo.endojournals.org
In the competition experiments, a 50-fold or 200-fold molar
excess of unlabeled competitor DNAs was added. A supershift
assay was performed by preincubation of the WCE for 30 minutes with anti-Sp1 (sc-59; Santa Cruz Biotechnology), anti-Sp3
(sc-644 X; Santa Cruz Biotechnology), or anti-SF-1 (07-618;
Upstate Biotechnology, Lake Placid, New York) antibodies. After the binding reaction, the mixture was subjected to 4% or 6%
PAGE, and the gel was then dried and autoradiographed. The
EMSA oligonucleotides are listed in Table 1.
Western blotting
or
CD
R
Protein extraction from cultured cells and subsequent quantification were performed as described previously (44). Extracted protein (50 g) was resolved by 10% or 12% SDS-PAGE
and transferred to polyvinylidene difluoride membranes. Western blot analysis of LRH-1, SF-1, PGC-1␣, Sp1, Sp3, and -actin
were carried out with antisera directed against LRH-1 (antibody
18293; Abcam, Inc, Cambridge, Massachusetts), SF-1 (07-618;
Upstate Biotechnology), PGC-1␣ (516557; Calbiochem, La
Jolla, California), Sp1 (sc-59; Santa Cruz Biotechnology), Sp3
(sc-644 X; Santa Cruz Biotechnology), and -actin (sc-47778;
Santa Cruz Biotechnology). All immune complexes were ultimately visualized and quantitated using Chemi-Lumi One Super
(Nacalai Tesque, Inc, Kyoto, Japan) and a LAS-4000UVmini
(Fujifilm, Tokyo, Japan).
da
p
were created by PCR using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, California). The primers for
reporter plasmid construction and site-directed mutagenesis are
listed in Table 1. The following vectors were kindly provided by
various researchers: pGL3-LRH-1-liver (⫺2530/⫹157) by Dr.
Lluis Fajas (Inserm Equipe Avenir, Montpellier, France), pGL2StAR-1.3kb by Dr Teruo Sugawara (Hokkaido University Graduate School of Medicine, Sapporo, Japan), pcDNA3.1-PGC-1␣
by Dr Daniel P. Kelly (Center for Cardiovascular Research,
Washington University School of Medicine, St Louis, Missouri),
pPac-Sp1 and pPac-USp3 by Dr. Guntram Suske (PhilippsUniversitat¨ Marburg, Marburg, Germany), and pPac--galactosidase by Dr Timothy F. Osborne (University of California, Irvine, California). pGL3-CYP11A1-2.3kb, pGL3-HSD3B21.25kb, pcDNA3-human-SF-1, pcDNA3-rat-SF-1, pcDNA3human-li-LRH-1, and pCMV-Tag3B-human-SF-1 vectors have
been described previously (37, 43, 47).
The expression vectors for human ovarian LRH-1 (granulosa
cell-derived LRH-1 [gc-LRH-1]) and rat gc-LRH-1 cDNA containing the entire coding regions were generated by RT-PCR and
subcloned into pGEM-T Easy and pcDNA3 (Invitrogen) vectors.
PCR primers were as follows: human gc-LRH-1: forward,
GAATTCATGCTGCCCAAAGTGGAGACGGAAG;
reverse,
CTCGAGTTATGCTCTTTTGGCATGCAACATT;
rat gc-LRH-1: forward, GGATCCATGCTGCCCAAAGTGGAGACGG; reverse, CTCGAGTTAGGCTCTTTTGGCGTGCAGC. BamHI-XhoI restriction fragments, containing the
entire coding region of rat SF-1 or rat gc-LRH-1 cDNA, were
then excised and inserted into pPac, which had been cleaved
by BamHI-XhoI.
1651
Statistical analysis
or
iza
Values are the mean ⫾ SE of the mean. Data were analyzed by
one-way ANOVA followed by the Tukey-Kramer post hoc test
(StatView 5.0; SAS Institute Inc, Cary, North Carolina). Data
were also analyzed by Student’s t test when the experiment consisted of only two groups. Statistical significance was accepted
when P ⬍ .05.
ut
Adenovirus production and infection
Co
pi
aa
Adenovirus vectors were prepared using the Adeno-X Expression System 1 (Takara Bio, Inc, Shiga, Japan) according to
the manufacturer’s instructions. Adenovirus preparation and infection were performed as described previously (43).
Results
Small interfering RNA (siRNA)
siRNA experiments were performed as described previously
(48). Control siRNA-A (sc-37007; Santa Cruz Biotechnology,
Inc, Santa Cruz, California) or SF-1 siRNA (sc-37901; Santa
Cruz Biotechnology) was transfected into KGN cells in a 24-well
plate with Lipofectamine RNAiMAX according to the manufacturer’s instructions. The final siRNA concentration in the medium was 10 nM.
EMSAs
Primary rat granulosa cells were cultured in 90-mm dishes
containing 10 ⫻ 106 cells in 10 mL of medium. The cells were
collected by a scraper and washed with PBS. The resulting cells
were suspended by gentle pipetting in 400 L of cold 20 mM
HEPES buffer (pH 7.6) containing 500 mM NaCl, 1.5 mM
MgCl2, 0.2 mM EDTA (pH 8.0), 1 mM dithiothreitol, 1 mM
phenylmethylsulfonylfluoride, 0.1% Nonidet P-40 and 20%
glycerol. The cells were incubated on ice for 30 min and centrifuged at 15 000 ⫻ g for 15 minutes at 4°C. The supernatant,
which contained the whole-cell extract (WCE), was used for
EMSA. EMSAs were performed as described previously (44).
WCE (20 g protein) was incubated with 32P-labeled oligonucleotides and unlabeled polydeoxyinosinic-deoxycytidylic acid.
Identification of novel LRH-1 transcript in human
ovary and KGN cells
To identify the promoter regions activated in ovarian
granulosa cells, we first performed a luciferase reporter
assay using a reporter plasmid containing 2.5 kb upstream
from the human LRH-1 TSS (Figure 1, A and B). The
reporter plasmids were transiently transfected into human
hepatocarcinoma HepG2 cells and ovarian granulosa cells
(primary cultured rat granulosa cells and KGN cells). Consistent with a previous report (12), LRH-1 promoter activity was only observed in hepatocarcinoma cells (Figure
1A). No strong LRH-1 promoter activity was seen in ovarian granulosa cells, but LRH-1 mRNA was abundantly
expressed in the ovary in comparison to the liver (43).
Because KGN cells only express some NRs at low levels,
including LRH-1 (49), we infected them with adenovirus
expressing PGC-1␣ (Adx-PGC-1␣) to markedly increase
LRH-1 mRNA expression (43) in preparation for RACEready cDNA. 5⬘-RACE PCR revealed that the TSS of hu-
20/05/2014
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 20 May 2014. at 07:46 For personal use only. No other uses without permission. . All rights reserved.
Kawabe et al
Transcriptional Regulation of Ovarian LRH-1.
Endocrinology, April 2013, 154(4):1648 –1660
Co
pi
aa
ut
or
iza
da
p
or
CD
R
1652
Figure 1. Identification of Novel LRH-1 Transcript in Human Ovarian Granulosa Cells A, Transcriptional activities of DNA fragment containing 2.5
kb upstream from human LRH-1 TSS. Reporter plasmids were transiently transfected into cultured rat granulosa cells, KGN cells, and HepG2 cells.
Luciferase activities were measured and relative activities are shown. The inset graph showed the magnification of luciferase activities of ⫺2530/
⫹157 construct. Each value represents the mean ⫾ SE of three independent transfection experiments. B, Genomic structure of human LRH-1.
Exons are shown as filled boxes. The novel exon 2 in the ovary (exon 2o) is shown as an open box. The reported TSS and ovarian TSS are shown as
arrows. The positions of liver (⫺2530/⫹157) and ovary (⫺2802/⫹68) constructs are indicated. C, Nucleotide and deduced amino acid sequences
of cDNA encoding human ovarian LRH-1. Arrows indicate exon 2 and exon 2o. D, Expression levels of each gene in human ovary, liver, primary
human granulosa-luteal cells and KGN cells. KGN cells were infected with Adx-PGC-1␣. mRNA levels were analyzed by RT-PCR. Lanes G–L
represent granulosa-luteal cells from women undergoing oocyte retrieval for in vitro fertilization. E, Activation of the promoter activities of
steroidogenic genes by SF-1, li-LRH-1, and ovary type LRH-1 (gc-LRH-1). HEK293 cells were transiently transfected with reporter plasmids (100 ng)
and expression vector (5 ng). Luciferase activities were measured and relative activities are shown. Each value represents the mean ⫾ SE of three
independent transfection experiments. Letters indicate a significant difference (P ⬍ .05).
man LRH-1 is located 41 bp upstream of the reported
exon 2 in KGN cells (Figure 1, B and C). We named the
novel exon of ovarian LRH-1 exon 2o. Because the TSS is
within exon 2, the novel isoform is truncated by 40 amino
acids at the N-terminusl compared with LRH-1 expressed
in the liver. It nevertheless contains the main functional
20/05/2014
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 20 May 2014. at 07:46 For personal use only. No other uses without permission. . All rights reserved.
doi: 10.1210/en.2012-2008
endo.endojournals.org
or
CD
R
mutant oligonucleotides failed to compete with the complexes (Figure 2C and Supplemental Figure 3, A and B).
Incubation of WCE with anti-Sp1 and/or anti-Sp3 antibodies resulted in the appearance of supershifted
complexes.
We next examined whether SF-1/LRH-1 binds to the
⫺146/⫺139 region using EMSA of nuclear extracts from
HEK293 cells transfected with the Myc-tagged SF-1 or
Myc-tagged gc-LRH-1 expression vector. As shown in
Supplemental Figure 3, C and D, a single major protein/
DNA complex was formed. Because putative overlapping
SF-1 binding sites are present in the ⫺157/⫺130 region,
we used the unlabeled-mutant oligonucleotide replacing
all 5⬘-CC-3⬘ with 5⬘-AA-3⬘ as competitor DNA (Supplemental Figure 3, C and D). EMSA using WCE of cultured
rat granulosa cells revealed the formation of one major
protein/DNA complex (Figure 2C), which was competed
by unlabeled wild-type competitor but not by the unlabeled mutant oligonucleotide. Incubation of WCE with
the anti-SF-1 antibody resulted in the appearance of a supershifted complex. These data revealed that endogenous
NR5A-family can bind to the ⫺157/⫺130 region.
The reporter assay showed that promoter activity declined after mutation of the GC box and SF-1 binding site
in cultured rat granulosa cells (Figure 2D). In KGN cells,
the promoter activity of the GC box-mutated construct
declined to the same level as the GC box-deleted construct
(Supplemental Figure 4A). To determine the effect of SF-1
on promoter activity, KGN cells were transiently cotransfected with reporter plasmids and SF-1 expression vectors.
Dose-dependent enhancement of promoter activity was
observed after cotransfection with the SF-1 expression
vector in KGN cells (Supplemental Figure 4B). In addition,
the promoter activity was also increased by cotransfection
with the gc-LRH-1 expression vector (Figure 3A).
In a previous study, we showed that ovarian LRH-1 is
up-regulated by PGC-1␣ in granulosa cells (43). However,
the transcriptional mechanism associated with PGC-1␣ is
unknown. To determine whether PGC-1␣ enhances the
promoter activity of ovarian LRH-1, KGN cells were
cotransfected with the PGC-1␣ expression vector and reporter plasmids. As shown in Figure 3B, cotransfection
with the PGC-1␣ expression vector increased promoter
activity and further augmented SF-1-induced promoter
activity. The promoter activity of the SF-1 binding sitemutated construct declined to 66% compared with the
wild-type construct in KGN cells (Figure 3B). Although
SF-1 and/or PGC-1␣ expression vectors were cotransfected, the enhanced activities were almost abolished by
the mutation of the SF-1 binding site in KGN cells. These
results suggest that SF-1 and PGC-1␣ coordinately regulate LRH-1 transcriptional activity in granulosa cells.
or
iza
da
p
domains including the DNA-binding domain and the ligand-binding domain. 5⬘-RACE PCR using RACE-ready
cDNA constructed from whole ovary revealed that the
ovarian LRH-1 is conserved in rodents (Supplemental Figure 1, A and B, published on The Endocrine Society’s Journals Online web site at http://endo.endojournals.org) as
well as in rabbit (Supplemental Figure 1C).
RT-PCR using specific primers for distinct LRH-1 transcripts showed that the novel isoform is abundantly expressed in the human ovary as well as in primary human
granulosa-luteal cells, but not in the liver (Figure 1D),
suggesting stringent tissue-specific usage of LRH-1 gene
promoters. To determine the functionality of ovarian
LRH-1, it was isolated from human ovarian granulosa
cells and cloned into an expression vector. Similar to SF-1
and/or liver type LRH-1 (li-LRH-1), ovarian granulosa
cell-derived LRH-1 (gc-LRH-1) enhanced the promoter
activity of steroidogenesis-related genes such as
CYP11A1, HSD3B2, and StAR (Figure 1E). gc-LRH-1
activated promoters of steroidogenic enzymes, especially
CYP11A1 and HSD3B2, synergistically with 8-bromocAMP (8Br-cAMP) stimulation in the KGN cells (Supplemental Figure 2A). In addition, when LRH-1 siRNAs were
introduced into KGN cells (Supplemental Figure 2B), 8BrcAMP dependent expression of CYP11A1 and HSD3B2
was dramatically decreased (Supplemental Figure 2C).
Co
pi
aa
ut
Characterization of LRH-1 promoter regions in
ovarian granulosa cells
To determine the sequences required for promoter activity of human LRH-1 in ovarian granulosa cells, we isolated a DNA fragment of ⫺2802 to ⫹68 from the TSS
(exon 2o) of ovarian LRH-1 (Figure 1B). This reporter
plasmid was transiently transfected into cultured rat ovarian granulosa cells and demonstrated strong promoter activity (Figure 2A). For further analysis, we used a series of
5⬘-deletion constructs, which revealed that remarkable activity remained in the ⫺157/⫹68 construct (29-fold);
however, the promoter activity was markedly reduced by
the truncation of upstream to ⫺117 and further reduced
by truncation to ⫺57. As shown in Figure 2B, a TATA-less
promoter is present upstream of the ovarian LRH-1 TSS,
whereas two promoter regions contain a putative SF-1
binding site (⫺146/⫺139) and a GC box (⫺64/⫺56).
To identify the endogenous nuclear proteins binding to
the GC box (⫺64/⫺56), a core motif for Sp-family binding, EMSA was carried out using WCE of cultured rat
granulosa cells. Two major protein/DNA complexes were
observed when EMSA was carried out using nuclear extracts from KGN cells or human ovary (Supplemental Figure 3, A and B), and disappeared by the addition of an
unlabeled wild-type competitor (Figure 2C). Unlabeled-
1653
20/05/2014
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 20 May 2014. at 07:46 For personal use only. No other uses without permission. . All rights reserved.
1654
Kawabe et al
Transcriptional Regulation of Ovarian LRH-1.
SF-1
binding site
A
Endocrinology, April 2013, 154(4):1648 –1660
GC box
-2802/+68
Luc
-915/+68
Luc
-435/+68
Luc
-205/+68
Luc
-157/+68
Luc
-117/+68
Luc
-67/+68
Luc
-57/+68
Luc
-12/+68
Luc
pGL3 Basic
Luc
be
e
d
d
d
c
bc
a
a
a
0
B
5
10
15
20
25
Relative luciferase activity
(Fold)
30
35
C
probe
SF-1 binding site
antibody
competitor
-72/-53
-157/-130
- - - - -
- - -
GC box
super shift
super shift
R
Sp1
Sp3
CD
TSS
D
SF-1
binding site
iza
da
p
or
SF-1
or
GC box
Luc
-157/+68 Mut-SF-1
Luc
ut
-157/+68
-157/+68 Mut-GC box
aa
b
a
Luc
Co
pGL3 Basic
Luc
pi
-57/+68
b
Luc
-157/+68 Mut-SF-1/GC box
d
c
a
Luc
0
10
20
30
40
Relative luciferase activity
(Fold)
50
Figure 2. Analysis of the Human Ovarian LRH-1 Promoter Region in Rat Ovarian Granulosa Cells A, 5⬘-deletion analysis of the human ovarian
LRH-1 promoter region. Progressive deletions of the ovarian LRH-1 promoter are schematically illustrated in the left panel. Reporter plasmids (400
ng) were transiently transfected into cultured rat granulosa cells. Luciferase activities were measured and relative activities are shown. Each value
represents the mean ⫾ SE of three independent transfection experiments. B, Nucleotide sequences of human ovarian LRH-1 promoter region. The
TSS is indicated by an arrow; a putative SF-1 binding site and a GC box are enclosed. C, EMSA analysis of a GC box (⫺72/⫺53) and a putative SF-1
binding site (⫺157/⫺130) of human ovarian LRH-1. Each end-labeled oligonucleotide was incubated with 20 g WCEs from cultured rat
granulosa cells. DNA-protein complexes were separated by electrophoresis on a nondenaturing 4% (⫺72/⫺53) or 6% (⫺157/130) polyacrylamide
gel. Unlabeled wild-type (WT) and mutated (Mut) oligonucleotides were used as competitor DNAs. Where indicated, antibodies against Sp1, Sp3
or SF-1 were used for supershift analysis. Arrows indicate specific DNA-protein complexes. Arrowheads indicate supershifted complexes. D, Effect
of mutation in the SF-1 binding site and GC box within the promoter region of human ovarian LRH-1. The mutant promoter constructs used are
drawn schematically. Reporter plasmids (400 ng) were transiently transfected into cultured rat granulosa cells. Luciferase activities were measured
and relative activities are shown. Each value represents the mean ⫾ SE of three independent transfection experiments. Letters indicate a significant
difference (P ⬍ .05).
To examine whether the Sp-family is involved in the
promoter activity of ovarian LRH-1, Drosophila SL2 cells
lacking endogenous Sp-family proteins were transiently
cotransfected with reporter plasmids and Sp1 or Sp3 expression vectors. As shown in Figure 3C, the promoter
activity was approximately 9.4-fold and 5.8-fold increased by cotransfection with Sp1 and Sp3 expression
vectors, respectively. The mutant promoter construct inhibited Sp-induced promoter activities in SL2 cells,
whereas Sp1- and Sp3-induced promoter activities were
synergistically enhanced by cotransfection with SF-1 or
gc-LRH-1 expression vectors (Figure 3D). However, these
enhanced activities were abolished by mutation of the SF-1
binding site.
20/05/2014
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 20 May 2014. at 07:46 For personal use only. No other uses without permission. . All rights reserved.
doi: 10.1210/en.2012-2008
endo.endojournals.org
1655
da
p
or
CD
R
duced in KGN cells by Adx-SF-1 infection (Figure 4, C and D), but was
dramatically induced by AdxPGC-1␣ infection. Conversely, Sp1/
Sp3 protein levels were unaffected by
infection with either Adx-SF-1 or
Adx-PGC-1␣ (Figure 4D). Consistent with the above results, augmentation of progesterone production
through synergy between PGC-1a
and LRH-1 was observed in KGN
cells (Supplemental Figure 5). The
expression of LRH-1 mRNA was reduced by SF-1 siRNA in KGN cells
(Figure 4E). These results suggest
that the human ovarian LRH-1 transcript is regulated by Sp1/3 and SF-1/
PGC-1␣ via the GC box and ⫺157/
⫺130 regions in ovarian granulosa
cells.
Figure 3. The Sp-Family and NR5A-Family Cooperate to Induce Human Ovarian LRH-1 Promoter
Activity A, Effects of SF-1 and gc-LRH-1 expression on the promoter activity of human ovarian
LRH-1 in KGN cells. B, Effect of mutation in the SF-1 binding site within the promoter region of
human ovarian LRH-1 in KGN cells transfected with SF-1 and/or PGC-1␣ expression vectors. C,
Effect of mutation in the GC box within the promoter region of human ovarian LRH-1 in SL2 cells
transfected with Sp1 or Sp3 expression vectors. D, Effect of mutation in the SF-1 binding site
within the promoter region of human ovarian LRH-1 in SL2 cells transfected with Sp-family and/
or NR5A-family expression vectors. Reporter plasmids (100 ng), SF-1 (5 ng), gc-LRH-1 (5 ng), and/
or PGC-1␣ (50 ng) expression vectors were transiently transfected into KGN cells. SL2 cells that
lack endogenous Sp-family were transiently transfected with reporter plasmids (1 g) along with
pPac--galactosidase control vector (50 ng) and each pPac expression vector (50 ng). Luciferase
activities were measured and relative activities are shown. Each value represents the mean ⫾ SE
of three independent transfection experiments. Letters indicate a significant difference (P ⬍ .05).
*P ⬍ .05.
Discussion
Co
pi
aa
ut
or
iza
Ovarian folliculogenesis, ovulation,
and luteinization are stringently regulated by pituitary gonadotropins
(51), and numerous genes have been
identified that are involved in follicle
growth and CL formation (51, 52).
LRH-1 is essential for ovulation, as
shown by the lack of ovulation and
CL formation in LRH-1 conditional
knockout mice (35). LRH-1 is abundantly expressed in the ovary compared with other tissues (53) but its
transcriptional mechanisms were unknown. In the present
study, we identified a novel ovarian-specific LRH-1 isoform with distinct TSS not only in human (Figure 1) but
also in other mammals (Supplemental Figure 1). These
results indicate that ovarian-specific LRH-1 isoform is
evolutionarily conserved through diverse mammals.
LRH-1 transcriptional regulators HNF-1␣ and
HNF-3 are abundantly expressed in the liver (54), and
pancreatic-duodenal homeobox 1 is predominantly expressed in the pancreas and duodenum (55), but none are
expressed in the ovary. Gao et al. (56) identified another
novel transcript of LRH-1 (mlrh-1v2) from mouse ES cells
and showed that the mlrh-1v2 promoter region was upstream of the novel TSS. However, the transcription factors involved in activating the ES cell-specific promoter
were undetermined. Here, we revealed that the ubiquitous
Effects of mithramycin A and SF-1 on endogenous
LRH-1 expression levels in KGN cells
To determine the contribution of the GC box to endogenous expression levels of ovarian LRH-1, we examined the effects of mithramycin A, a competitor of Spfamily binding to GC-rich sequences (50), on LRH-1expressing cells (Figure 4A). In HepG2 cells, mithramycin
A had no effect on LRH-1 expression, but a significant
decline in expression was observed in KGN cells. Protein
levels of Sp1/3 were hardly affected by mithramycin A in
KGN cells (Figure 4B). This shows that LRH-1 expression
decreases as a result of inhibition of Sp-family binding to
GC boxes by mithramycin A in KGN cells.
To determine the contribution of SF-1 and PGC-1␣ to
endogenous expression levels of ovarian LRH-1, KGN
cells were infected with adenoviruses expressing SF-1
(Adx-SF-1) or Adx-PGC-1␣. LRH-1 expression was in-
20/05/2014
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 20 May 2014. at 07:46 For personal use only. No other uses without permission. . All rights reserved.
1656
Kawabe et al
Transcriptional Regulation of Ovarian LRH-1.
Endocrinology, April 2013, 154(4):1648 –1660
Co
pi
aa
ut
or
iza
da
p
or
CD
R
and/or Sp3 have crucial roles in the
transcriptional regulation of a disintegrin and metalloproteinase with
thrombospondin-like motifs-1 (59),
CYP11A1 (60), early growth response factor-1 (61), epiregulin (62),
IGF-binding protein-3 (63), cathepsin L (64), LH receptor (65), progesterone receptor (66, 67), reproductive homeobox X-linked 5 (68), and
serum/glucocorticoid inducible-protein kinase (58) in ovarian granulosa
cells and luteal cells. These studies
suggest that the Sp-family contributes to tissue-specific expression and
gonadotropin-inducible transient expression of steroidogenesis- and follicular development-related genes.
The transcriptional activity of the
Sp-family is regulated by posttranslational modification (57, 69). FSH/
cAMP, which stimulates the protein
kinase A (PKA) pathway, induces the
expression and promoter activity of
many genes regulated by the Sp-family in granulosa cells (58, 61– 63, 65,
66). Moreover, Sp1 DNA-binding
activity is activated by PKA (70), and
Ahlgren et al. (71) reported that the
Sp1-dependent promoter activity of
bovine CYP11A1 is further stimuFigure 4. The SF-1 and GC Box Promote the Levels of Endogenous LRH-1 mRNA in KGN Cells
lated by PKA. Rat LRH-1 is also inA, Effect of mithramycin A on the levels of endogenous LRH-1 mRNA. KGN and HepG2 cells
duced by FSH stimulation in granuwere treated with or without mithramycin A (100 nM) for 24 hours before RNA extraction. B,
losa cells (72). It is possible that Sp1
Effect of mithramycin A on the levels of endogenous Sp-family in KGN cells. KGN cells were
treated with or without mithramycin A (100 nM) for 24 hours before protein extraction. The
phosphorylation is involved in
specific signals of each protein were visualized by Western blot analysis with antibodies against
LRH-1 expression in granulosa cells,
Sp1, Sp3, and -actin using the same lysates. C, SF-1 and PGC-1␣ induce the levels of
but further studies are required to
endogenous LRH-1 mRNA in KGN cells. KGN cells were infected with Adx-GFP, Adx-SF-1, or Adxclarify this.
PGC-1␣. Gene expression of LRH-1 was measured by quantitative RT-PCR and normalized to actin expression. D, SF-1 and PGC-1␣ induces the levels of endogenous LRH-1 protein in KGN
We showed that SF-1 is an imporcells. KGN cells were infected with Adx-GFP, Adx-SF-1 or Adx-PGC-1␣. The specific signals of
tant
transcriptional regulator of
each protein were visualized by Western blot analysis with antibodies against LRH-1, SF-1, PGCLRH-1 in granulosa cells. In KGN
1␣, Sp1, Sp3, and -actin using the same lysates. E, Effects of siRNA on the levels of endogenous
LRH-1 and SF-1 mRNA in KGN cells. Synthetic siRNA for SF-1 (siSF-1) or control (siControl) was
cells, SF-1 is expressed at very low
introduced into KGN cells. Each value represents the mean ⫾ SE of three independent
levels that are undetectable by Westexperiments. *P ⬍ .05; **P ⬍ .01. GFP, green fluorescent protein.
ern blot analysis (Figure 4D). For this
reason, SF-1 knockdown has little eftranscription factors Sp1 and Sp3 could bind to the proximal fect on endogenous LRH-1 expression in KGN cells (Figpromoter region of ovarian LRH-1 and regulate its tran- ure 4E), although SF-1 overexpression greatly stimulates
scription (Figures 2 and 3). Sp1 and Sp3 bind to G-rich ele- endogenous LRH-1 expression (Figure 4, C and D). In SL2
ments such as the GC box on target gene promoters, which cells, SF-1/LRH-1 synergistically activated the Sp-familydependent promoter of human ovarian LRH-1 (Figure
is important in activation of TATA-less promoters (57).
Interestingly, Sp1 is expressed at high levels in ovarian 3D). However, SF-1/LRH-1 alone was unable to activate
granulosa cells (58), and several studies showed that Sp1 the LRH-1 promoter. Because the Sp-family is important
20/05/2014
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 20 May 2014. at 07:46 For personal use only. No other uses without permission. . All rights reserved.
doi: 10.1210/en.2012-2008
endo.endojournals.org
or
CD
R
We previously reported that PGC-1␣ induces LRH-1
expression in granulosa cells (43). PGC-1␣ is a powerful
coactivator for several NRs including the NR5A-family
(40 – 43). In KGN cells, PGC-1␣ synergistically activated
the SF-1-induced promoter activity of human ovarian
LRH-1 (Figure 3B). Furthermore, in the observed induction of LRH-1 expression by PGC-1␣ overexpression in
granulosa cells (Figure 4, C and D), LRH-1 appears to be
under the control of PGC-1␣. As PGC-1␣ induces SF-1
expression and is a coactivator of the NR5A-family (43),
its overexpression might induce LRH-1 expression more
effectively than SF-1 overexpression (Figure 4C). SF-1 is
expressed mainly in steroidogenic tissues, but the expression profile of LRH-1 is not necessarily the same. For
instance, SF-1, but not LRH-1, is expressed in ovarian
theca and stromal cells (28, 80). However, PGC-1␣ is specifically expressed in granulosa cells (43). Together, these
facts and our data strongly suggest that the coexpression
of SF-1 and PGC-1␣ contributes to the granulosa cell expression of LRH-1 in the ovary. In luteinized granulosa
cells, LRH-1 induction by the NR5A-family and PGC-1␣
might be involved in progesterone production via the induction of steroidogenesis-related genes in coordination
with PGC-1␣. Actually progesterone production was augmented with PGC-1␣ in KGN cells (Supplemental Figure
5) probably through interaction between PGC-1␣ and
LRH-1. Recently, the steroidogenic tissues- or cells-specific distal enhancer regions of several steroidogenesis-related genes are reported by our group and others (48, 82,
83). In the rat ovary, LRH-1 expression is increased by
FSH and prolactin (24, 72). It is possible that ovarian
LRH-1 expression is regulated, in part, via distal enhancer
regions. Further study is necessary to elucidate such a
possibility.
In summary, we have identified a novel isoform and
promoter region of human LRH-1 expressed in ovarian
granulosa cells, which is transcribed from the novel exon
2o. Granulosa cell expression of LRH-1 is under the control of the Sp-family and the NR5A-family. In ovarian
granulosa cells, coordinated regulation of SF-1 and
PGC-1␣ should up-regulate LRH-1 expression. These
data suggest that ovarian LRH-1 is a novel SF-1 target
gene and is autoregulated via its novel promoter region.
LRH-1 and SF-1 belong to the same subfamily and could
regulate the same steroidogenesis-related genes (1, 19);
however, SF-1 cannot compensate for the lack of LRH-1
in ovarian granulosa cells (35). Consistent with a previous
study (35), our results suggest that expression of genes
involved in progesterone biosynthesis (CYP11A1,
HSD3B2, and StAR) are under the control of ovarian
LRH-1 in human ovarian granulosa cells. Further studies
are needed to elucidate the different roles for SF-1 and
Co
pi
aa
ut
or
iza
da
p
for the recruitment of general transcription factors to
TATA-less promoters (57), the synergistic activation of
the LRH-1 promoter by the NR5A-family might be dependent on the Sp-family. This result also suggests the
existence of an interaction between the Sp-family and the
NR5A-family. Sp1 synergistically activates the target gene
promoter with other transcription factors, and these Sp1mediated transactivations would involve the tissue-specific expression of the target gene (57). Furthermore, the
interaction and cooperation between SF-1 and Sp1 is reported to be necessary for the promoter activity of human
StAR and bovine CYP11A1 in Y1 adrenal tumor cells or
bovine luteal cells (60, 73, 74). Coimmunoprecipitation
and two-hybrid analysis revealed that the SF-1 DNAbinding domain shares more than 90% homology with
that of LRH-1 and interacts directly with Sp1. Therefore,
LRH-1 might regulate its own promoter activity through
interaction with the Sp-family.
SF-1 knockout mice have previously been shown to
have adrenal and gonadal agenesis (20, 21); therefore, the
roles of ovarian SF-1 could not be defined by this model.
Pelusi et al. (75) reported that the granulosa cell-specific
conditional knockout of SF-1 (SF-1gc⫺/⫺) results in an upregulation of LRH-1 in the ovary. This result is inconsistent with our own which shows that ovarian LRH-1 is
under the control of SF-1. Although the reason for this
discrepancy is unclear, it might be a result of the method
used to generate SF-1gc⫺/⫺ mice which involved crossing
SF-1-floxed with anti-Müllerian hormone receptor-2
(Amhr2)-Cre mice (76). The expression of rodent Amhr2
is observed in granulosa cells of secondary and small antral follicles, but is undetectable or only present at low
levels in primordial and primary follicles (77–79), contrasting with detectable expression of SF-1 and LRH-1
(80). Therefore, this SF-1gc⫺/⫺ model is not likely to abolish SF-1 expression in granulosa cells of primordial and
primary follicles. In addition, our present data suggest an
alternative ovarian LRH-1 autoregulation hypothesis
(Figure 3, A and D), which might explain the ovarian
LRH-1 induction and require a compensatory mechanism
to maintain ovarian function in SF-1gc⫺/⫺ mice. In human
CL, LRH-1 expression is higher than in mature ovarian
follicles despite lower SF-1 levels (27). Induction of
LRH-1 accompanying follicle development could be explained by an autoregulatory mechanism of LRH-1. In
support of this, Weck and Mayo (81) reported that SF-1 is
bound to the inhibin ␣-subunit promoter, but that forskolin stimulation induces LRH-1 to replace SF-1 in mice
ovarian granulosa cells. In luteinized granulosa cells, SF-1
should be replaced by LRH-1 which activates its own promoter. Autoregulation of LRH-1 might therefore maintain high expression of LRH-1 in the CL.
1657
20/05/2014
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 20 May 2014. at 07:46 For personal use only. No other uses without permission. . All rights reserved.
Transcriptional Regulation of Ovarian LRH-1.
Endocrinology, April 2013, 154(4):1648 –1660
ovarian LRH-1 in follicle development and steroidogenesis. Because ovarian LRH-1 is essential for steroidogenesis and ovulation, our findings about ovarian-specific
promoter of LRH-1 open the possibility of contraceptive
development and drug-induced differentiation of stem
cells into steroidogenic cells, which deactivate or activate
the ovarian LRH-1 promoter.
nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell. 2000;6:517–526.
Lu TT, Makishima M, Repa JJ, et al. Molecular basis for feedback
regulation of bile acid synthesis by nuclear receptors. Mol Cell.
2000;6:507–515.
Schoonjans K, Annicotte JS, Huby T, et al. Liver receptor homolog
1 controls the expression of the scavenger receptor class B type I.
EMBO Rep. 2002;3:1181–1187.
Kanayama T, Arito M, So K, Hachimura S, Inoue H, Sato R. Interaction between sterol regulatory element-binding proteins and liver
receptor homolog-1 reciprocally suppresses their transcriptional activities. J Biol Chem. 2007;282:10290 –10298.
Mataki C, Magnier BC, Houten SM, et al. Compromised intestinal
lipid absorption in mice with a liver-specific deficiency of liver receptor homolog 1. Mol Cell Biol. 2007;27:8330 – 8339.
Song X, Kaimal R, Yan B, Deng R. Liver receptor homolog 1 transcriptionally regulates human bile salt export pump expression. J
Lipid Res. 2008;49:973–984.
Zhang CK, Lin W, Cai YN, et al. Characterization of the genomic
structure and tissue-specific promoter of the human nuclear receptor
NR5A2 (hB1F) gene. Gene. 2001;273:239 –249.
Annicotte JS, Fayard E, Swift GH, et al. Pancreatic-duodenal homeobox 1 regulates expression of liver receptor homolog 1 during
pancreas development. Mol Cell Biol. 2003;23:6713– 6724.
Gu P, Goodwin B, Chung AC, et al. Orphan nuclear receptor LRH-1
is required to maintain Oct4 expression at the epiblast stage of embryonic development. Mol Cell Biol. 2005;25:3492–3505.
Paré JF, Malenfant D, Courtemanche C, et al. The fetoprotein transcription factor (FTF) gene is essential to embryogenesis and cholesterol homeostasis and is regulated by a DR4 element. J Biol Chem.
2004;279:21206 –21216.
Lala DS, Rice DA, Parker KL. Steroidogenic factor 1, a key regulator
of steroidogenic enzyme expression, is the mouse homolog of fushi
tarazu-factor 1. Mol Endocrinol. 1992;6:1249 –1258.
Honda SI, Morohashi KI, Nomura M, Takeya H, Kitajima M,
Omura T. Ad4BP regulating steroidogenic P-450 gene is a member
of steroid hormone receptor superfamily. J Biol Chem. 1993;268:
7494 –7502.
Val P, Lefrancois-Martinez AM, Veyssière G, Martinez. A SF-1 a key
player in the development and differentiation of steroidogenic tissues. Nucl Recept. 2003;18:8.
Schimmer BP, White PC. Minireview: steroidogenic factor 1: its
roles in differentiation, development, and disease. Mol Endocrinol.
2010;24:1322–1337.
Luo X, Ikeda Y, Parker KL. A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell. 1994;77:481– 490.
Sadovsky Y, Crawford PA, Woodson KG, et al. Mice deficient in the
orphan receptor steroidogenic factor 1 lack adrenal glands and gonads but express P450 side-chain-cleavage enzyme in the placenta
and have normal embryonic serum levels of corticosteroids. Proc
Natl Acad Sci USA. 1995;92:10939 –10943.
Boerboom D, Pilon N, Behdjani R, Silversides DW, Sirois J. Expression and regulation of transcripts encoding two members of the
NR5A nuclear receptor subfamily of orphan nuclear receptors, steroidogenic factor-1 and NR5A2, in equine ovarian cells during the
ovulatory process. Endocrinology. 2000;141:4647– 4656.
Sirianni R, Seely JB, Attia G, et al. Liver receptor homologue-1 is
expressed in human steroidogenic tissues and activates transcription
of genes encoding steroidogenic enzymes. J Endocrinol. 2002;174:
R13–R17.
Falender AE, Lanz R, Malenfant D, Belanger L, Richards JS. Differential expression of steroidogenic factor-1 and FTF/LRH-1 in the
rodent ovary. Endocrinology. 2003;144:3598 –3610.
Hinshelwood MM, Repa JJ, Shelton JM, Richardson JA, Mangelsdorf DJ, Mendelson CR. Expression of LRH-1 and SF-1 in the mouse
7.
8.
9.
Acknowledgments
10.
The authors thank Drs T. Yanase (Fukuoka University, Fukuoka, Japan), T. Noguchi (Osaka Ohtani University, Osaka,
Japan), L. Fajas (Inserm Equipe Avenir, Montpellier, France), T.
Sugawara (Hokkaido University Graduate School of Medicine,
Sapporo, Japan), D. P. Kelly (Center for Cardiovascular Research, Washington University School of Medicine, St Louis,
Missouri), G. Suske (Philipps-Universitat¨ Marburg, Marburg,
Germany), and T. F. Osborne (University of California, Irvine,
California) for providing reagents. The authors also thank Ms.
Y. Inoue, Y. Yamazaki, K. Matsuura, and H. Fujii for technical
assistance.
11.
12.
R
13.
14.
da
p
15.
16.
17.
18.
Co
pi
aa
ut
or
iza
Address all correspondence and requests for reprints to:
Takashi Yazawa, Department of Biochemistry, Faculty of Medical Sciences, University of Fukui, 23-3 Matsuokashimoaizuki,
Eiheiji-cho, Yoshida-gun, Fukui 910-1193, Japan. E-mail:
[email protected].
This work was supported by a Grant-in-Aid for Young Scientists B (No. 23791820) and a Grant-in-Aid for Scientific Research C (No. 23590329) from the Ministry of Education, Culture, Sports, Science and Technology; the Smoking Research
Foundation; Research Grants from the University of Fukui; and
Grants-in-Aid for Kaneko/Narita Encouragement (Protein Research Foundation).
Disclosure Summary: All authors have nothing to disclose.
19.
20.
References
1. Fayard E, Auwerx J, Schoonjans K. LRH-1: an orphan nuclear receptor involved in development, metabolism and steroidogenesis.
Trends Cell Biol. 2004;14:250 –260.
2. Nitta M, Ku S, Brown C, Okamoto AY, Shan B. CPF: an orphan
nuclear receptor that regulates liver-specific expression of the human cholesterol 7␣-hydroxylase gene. Proc Natl Acad Sci USA.
1999;96:6660 – 6665.
3. Galarneau L, Paré JF, Allard D, et al. The ␣1-fetoprotein locus is
activated by a nuclear receptor of the Drosophila FTZ-F1 family.
Mol Cell Biol. 1996;16:3853–3865.
4. Li M, Xie YH, Kong YY, Wu X, Zhu L, Wang Y. Cloning and
characterization of a novel human hepatocyte transcription factor,
hB1F, which binds and activates enhancer II of hepatitis B virus.
J Biol Chem. 1998;273:29022–29031.
5. Repa JJ, Mangelsdrf DJ. Nuclear receptor regulation of cholesterol
and bile acid metabolism. Curr Opin Biotechnol. 1999;10:557–563.
6. Goodwin B, Jones SA, Price RR, et al. A regulatory cascade of the
CD
Kawabe et al
or
1658
21.
22.
23.
24.
25.
20/05/2014
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 20 May 2014. at 07:46 For personal use only. No other uses without permission. . All rights reserved.
doi: 10.1210/en.2012-2008
33.
34.
35.
Co
37.
38.
39.
40.
41.
42.
43.
44.
50.
51.
52.
53.
54.
55.
56.
pi
aa
36.
49.
R
32.
48.
CD
31.
47.
or
30.
46.
57.
58.
59.
60.
61.
62.
63.
1659
steroidogenic factor 1, and Dax-1 in the regulation of gonadotropininducible ovarian transcription factor 1 gene expression by folliclestimulating hormone in ovarian granulosa cells. Endocrinology.
2003;144:1920 –1930.
Nishi Y, Yanase T, Mu YM, et al. Establishment and characterization of a steroidogenic human granulosa-like tumor cell line, KGN,
that expresses functional follicle-stimulating hormone receptor. Endocrinology. 2001;142:437– 445.
Yazawa T, Mizutani T, Yamada K, et al. Differentiation of adult
stem cells derived from bone marrow stroma into Leydig or adrenocortical cells. Endocrinology. 2006;147:4104 – 4111.
Mizutani T, Yamada K, Minegishi T, Miyamoto K. Transcriptional
regulation of rat scavenger receptor class B type I gene. J Biol Chem.
2000;275:22512–22519.
Mizutani T, Yazawa T, Ju Y, et al. Identification of a novel distal
control region upstream of the human steroidogenic acute regulatory protein (StAR) gene that participates in SF-1-dependent chromatin architecture. J Biol Chem. 2010;285:28240 –28251.
Alexiadis M, Eriksson N, Jamieson S, et al. Nuclear receptor profiling of ovarian granulosa cell tumors. Horm Cancer. 2011;2:157–
169.
Blume SW, Snyder RC, Ray R, Thomas S, Koller CA, Miller DM.
Mithramycin inhibits SP1 binding and selectively inhibits transcriptional activity of the dihydrofolate reductase gene in vitro and in
vivo. J Clin Invest. 1991;88:1613–1621.
Richards JS, Pangas SA. The ovary: basic biology and clinical implications. J Clin Invest. 2010;120:963–972.
Matzuk MM, Lamb DJ. The biology of infertility: research advances
and clinical challenges. Nat Med. 2008;14:1197–1213.
Bookout AL, Jeong Y, Downes M, Yu RT, Evans RM, Mangelsdorf
DJ. Anatomical profiling of nuclear receptor expression reveals a
hierarchical transcriptional network. Cell. 2006;126:789 –799.
Cereghini S. Liver-enriched transcription factors and hepatocyte differentiation. FASEB J. 1996;10:267–282.
Miller CP, McGehee RE Jr., Habener JF. IDX-1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that transactivates the somatostatin gene. EMBO J. 1994;
13:1145–1156.
Gao DM, Wang LF, Liu J, Kong YY, Wang Y, Xie YH. Expression
of mouse liver receptor homologue 1 in embryonic stem cells is
directed by a novel promoter. FEBS Lett. 2006;580:1702–1708.
Wierstra I. Sp1: emerging roles— beyond constitutive activation of
TATA-less housekeeping genes. Biochem Biophys Res Commun.
2008;372:1–13.
Alliston TN, Maiyar AC, Buse P, Firestone GL, Richards JS. Follicle
stimulating hormone-regulated expression of serum/glucocorticoidinducible kinase in rat ovarian granulosa cells: a functional role for
the Sp1 family in promoter activity. Mol Endocrinol. 1997;11:
1934 –1949.
Doyle KMH, Russell DL, Sriraman V, Richards JS. Coordinate transcription of the ADAMTS-1 gene by luteinizing hormone and progesterone receptor. Mol Endocrinol. 2004;18:2463–2478.
Liu Z, Simpson ER. Steroidogenic factor 1 (SF-1) and SP1 are required for regulation of bovine CYP11A gene expression in bovine
luteal cells and adrenal Y1 cells. Mol Endocrinol. 1997;11:127–137.
Russell DL, Doyle KMH, Gonzales-Robayna I, Pipaon C, Richards
JS. Egr-1 induction in rat granulosa cells by follicle-stimulating hormone and luteinizing hormone: combinatorial regulation by transcription factors cyclic adenosine 3⬘,5⬘-monophosphate regulatory
element binding protein, serum response factor, Sp1, and early
growth response factor-1. Mol Endocrinol. 2003;17:520 –533.
Sekiguchi T, Mizutani T, Yamada K, et al. Transcriptional regulation of the epiregulin gene in the rat ovary. Endocrinology. 2002;
143:4718 – 4729.
Ongeri EM, Verderame MF, Hammond JM. Follicle-stimulating
hormone induction of ovarian insulin-like growth factor-binding
protein-3 transcription requires a TATA box-binding protein and
da
p
29.
45.
iza
28.
or
27.
ovary: localization in different cell types correlates with differing
function. Mol Cell Endocrinol. 2003;207:39 – 45.
Liu DL, Liu WZ, Li QL, et al. Expression and functional analysis of
liver receptor homologue 1 as a potential steroidogenic factor in rat
ovary. Biol Reprod. 2003;69:508 –517.
Peng N, Kim JW, Rainey WE, Carr BR, Attia GR. The role of the
orphan nuclear receptor, liver receptor homologue-1, in the regulation of human corpus luteum 3-hydroxysteroid dehydrogenase
type II. J Clin Endocrinol Metab. 2003;88:6020 – 6028.
Mendelson CR, Jiang B, Shelton JM, Richardson JA, Hinshelwood
MM. Transcriptional regulation of aromatase in placenta and
ovary. J Steroid Biochem Mol Biol. 2005;95:25–33.
Havelock JC, Rainey WE, Carr BR. Ovarian granulosa cell lines.
Mol Cell Endocrinol. 2004;228:67–78.
Stocco C, Telleria C, Gibori G. The molecular control of corpus
luteum formation, function, and regression. Endocr Rev. 2007;28:
117–149.
Saxena D, Safi R, Little-Ihrig L, Zeleznik AJ. Liver receptor homolog-1 stimulates the progesterone biosynthetic pathway during
follicle-stimulating hormone-induced granulosa cell differentiation.
Endocrinology. 2004;145:3821–3829.
Labelle-Dumais C, Paré JF, Bélanger L, Farookhi R, Dufort D. Impaired progesterone production in Nr5a2⫹/⫺ mice leads to a reduction in female reproductive function. Biol Reprod. 2007;77:217–
225.
Kim JW, Peng N, Rainey WE, Carr BR, Attia GR. Liver receptor
homolog-1 regulates the expression of steroidogenic acute regulatory protein in human granulosa cells. J Clin Endocrinol Metab.
2004;89:3042–3047.
Kim JW, Havelock JC, Carr BR, Attia GR. The orphan nuclear
receptor, liver receptor homolog-1, regulates cholesterol side-chain
cleavage cytochrome P450 enzyme in human granulosa cells. J Clin
Endocrinol Metab. 2005;90:1678 –1685.
Duggavathi R, Volle DH, Mataki C, et al. Liver receptor homolog
1 is essential for ovulation. Genes Dev. 2008;22:1871–1876.
Sato Y, Suzuki T, Hidaka K, et al. Immunolocalization of nuclear
transcription factors, DAX-1 and COUP-TF II, in the normal human
ovary: correlation with adrenal 4 binding protein/steroidogenic factor-1 immunolocalization during the menstrual cycle. J Clin Endocrinol Metab. 2003;88:3415–3420.
Yazawa T, Inaoka Y, Mizutani T, Kuribayashi M, Umezawa A,
Miyamoto K. Liver receptor homolog-1 regulates the transcription
of steroidogenic enzymes and induces the differentiation of mesenchymal stem cells into steroidogenic cells. Endocrinology. 2009;
150:3885–3893.
Puigserver P, Spiegelman BM. Peroxisome proliferator-activated receptor-␥ coactivator 1␣ (PGC-1␣): transcriptional coactivator and
metabolic regulator. Endocr Rev. 2003;24:78 –90.
Puigserver P, Wu Z, Park CW, Graves R, Wright M, Spiegelman
BM. A cold-inducible coactivator of nuclear receptors linked to
adaptive thermogenesis. Cell. 1998;92:829 – 839.
Vega RB, Huss JM, Kelly DP. The coactivator PGC-1 cooperates
with peroxisome proliferator-activated receptor ␣ in transcriptional
control of nuclear genes encoding mitochondrial fatty acid oxidation enzymes. Mol Cell Biol. 2000;20:1868 –1876.
Yoon JC, Puigserver P, Chen G, et al. Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature.
2001;413:131–138.
Shin DJ, Osborne TF. Peroxisome proliferator-activated receptor-␥
coactivator-1␣ activation of CYP7A1 during food restriction and
diabetes is still inhibited by small heterodimer partner. J Biol Chem.
2008;283:15089 –15096.
Yazawa T, Inaoka Y, Okada R, et al. PPAR-␥ coactivator-1␣ regulates progesterone production in ovarian granulosa cells with SF-1
and LRH-1. Mol Endocrinol. 2010;24:485– 496.
Yazawa T, Mizutani T, Yamada K, et al. Involvement of cyclic
adenosine 5⬘-monophosphate response element-binding protein,
ut
26.
endo.endojournals.org
20/05/2014
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 20 May 2014. at 07:46 For personal use only. No other uses without permission. . All rights reserved.
71.
72.
73.
78.
79.
80.
81.
R
77.
CD
76.
or
70.
75.
da
p
69.
74.
82.
iza
68.
Sp1 and steroidogenic factor-1 (SF-1) to regulate bovine CYP11A
gene expression. Mol Cell Endocrinol. 1999;153:183–196.
Sugawara T, Saito M, Fujimoto S. Sp1 and SF-1 interact and cooperate in the regulation of human steroidogenic acute regulatory protein gene expression. Endocrinology. 2000;141:2895–2903.
Pelusi C, Ikeda Y, Zubair M, Parker KL. Impaired follicle development and infertility in female mice lacking steroidogenic factor 1 in
ovarian granulosa cells. Biol Reprod. 2008;79:1074 –1083.
Jeyasuria P, Ikeda Y, Jamin SP, et al. Cell-specific knockout of steroidogenic factor 1 reveals its essential role in gonadal function. Mol
Endocrinol. 2004;18:1610 –1619.
Baarends WM, Uilenbroek JTJ, Kramer P, et al. Anti-müllerian
hormone and anti-müllerian hormone type II receptor messenger
ribonucleic acid expression in rat ovaries during postnatal development, the estrous cycle, and gonadotropin-induced follicle growth.
Endocrinology. 1995;136:4951– 4962.
Jorgez CJ, Klysik M, Jamin SP, Behringer RR, Matzuk MM. Granulosa cell-specific inactivation of follistatin causes female fertility
defects. Mol Endocrinol. 2004;18:953–967.
Klattig J, Sierig R, Kruspe D, Besenbeck B, Englert C. Wilms’ tumor
protein Wt1 is an activator of the anti-müllerian hormone receptor
gene Amhr2. Mol Cell Biol. 2007;27:4355– 4364.
Hinshelwood MM, Shelton JM, Richardson JA, Mendelson CR.
Temporal and spatial expression of liver receptor homologue-1
(LRH-1) during embryogenesis suggests a potential role in gonadal
development. Dev Dyn. 2005;234:159 –168.
Weck J, Mayo KE. Switching of NR5A proteins associated with the
inhibin ␣-subunit gene promoter after activation of the gene in granulosa cells. Mol Endocrinol. 2006;20:1090 –1103.
Shima Y, Miyabayashi K, Baba T, et al. Identification of an enhancer
in the Ad4BP/SF-1 gene specific for fetal Leydig cells. Endocrinology. 2012;153:417– 425.
Ju Y, Mizutani T, Imamichi Y, et al. Nuclear receptor 5A (NR5A)
family regulates 5-aminolevulinic acid synthase 1 (ALAS1) gene expression in steroidogenic cells. Endocrinology. 2012;153:5522–
5534.
or
67.
the protein kinase A and phosphatidylinositol-3 kinase pathways.
Mol Endocrinol. 2005;19:1837–1848.
Sriraman V, Richards JS. Cathepsin L gene expression and promoter
activation in rodent granulosa cells. Endocrinology. 2004;145:582–
591.
Chen S, Shi H, Liu X, Segaloff DL. Multiple elements and protein
factors coordinate the basal and cyclic adenosine 3⬘,5⬘-monophosphate-induced transcription of the lutropine receptor gene in rat
granulosa cells. Endocrinology. 1999;140:2100 –2109.
Clemens JW, Robker RL, Kraust WL, Katzenellenbogen BS, Richards JS. Hormone induction of progesterone receptor (PR) messenger ribonucleic acid and activation of PR promoter regions in ovarian granulosa cells: evidence for a role of cyclic adenosine 3⬘,5⬘monophosphate but not estradiol. Mol Endocrinol. 1998;12:1201–
1214.
Sriraman V, Sharma SC, Richards JS. Transactivation of the progesterone receptor gene in granulosa cells: evidence that Sp1/Sp3
binding sites in the proximal promoter play a key role in luteinizing
hormone inducibility. Mol Endocrinol. 2003;17:436 – 449.
MacLean JA II, Rao MK, Doyle KNH, Richards JS, Wilkinson MF.
Regulation of the Rhox5 homeobox gene in primary granulosa cells:
preovulatory expression and dependence on SP1/SP3 and GABP.
Biol Reprod. 2005;73:1126 –1134.
Li L, Davie JR. The role of Sp1 and Sp3 in normal and cancer cell
biology. Ann Anat. 2010;192:275–283.
Rohlff C, Ahmad S, Borellini F, Lei J, Glazer RI. Modulation of
transcription factor Sp1 by cAMP-dependent protein kinase. J Biol
Chem. 1997;272:21137–21141.
Ahlgren R, Suske G, Waterman MR, Lund J. Role of Sp1 in cAMPdependent transcriptional regulation of the bovine CYP11A gene.
J Biol Chem. 1999;274:19422–19428.
Saxena D, Escamilla-Hernandez R, Little-Ihrig L, Zeleznik AJ. Liver
receptor homolog-1 and steroidogenic factor-1 have similar actions
on rat granulosa cell steroidogenesis. Endocrinology. 2007;148:
726 –734.
Liu Z, Simpson ER. Molecular mechanism for cooperation between
ut
66.
Endocrinology, April 2013, 154(4):1648 –1660
83.
aa
65.
Transcriptional Regulation of Ovarian LRH-1.
pi
64.
Kawabe et al
Co
1660
20/05/2014
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 20 May 2014. at 07:46 For personal use only. No other uses without permission. . All rights reserved.
© Copyright 2026 ExpyDoc