Supporting Information Ippolito et al. 10.1073/pnas.1319228111 SI Text Generation of Bcl11a Conditional Knockout Mice. To construct the B-cell chronic lymphocytic leukemia/lymphoma 11A (Bcl11a) conditional targeting vector, two genomic fragments were first subcloned from the C57BL/6 mouse BAC RP23-42p24. A 4.947-kb KpnI–NotI fragment containing exon 1 plus 3.562 kb upstream (KpnI) and 1.332 kb downstream (NotI) was subcloned into pBluescript. Further sequence downstream (3′) of exon 1 was subcloned from a 2.143 NotI–BamHI fragment. These subclones were used as templates for the generation of three blunt-ended PCR fragments using the proofreading polymerase Pfu turbo (Stratagene). These three fragments were sequentially ligated into the conditional targeting vector pDELBOY (1). Fragment 1 (0.89 kb) was created using the primer pair 5′-TCTGGCGCGCCTCCTGCTAGCCAGGTTTCTTTCCTTT-3′ and 5′-GTCTAGAGAGTAGGTC-CCGGACACCCT-3′; this fragment was blunt-end ligated into the Klenow-treated XhoI site of pDELBOY and screened for the correct orientation. Fragment 2 (2.222 kb) was created using the primer pair 5′-TGGATCCGGTACCAGGGTGTCCGGGACCTACTCTA-3′ and 5′-GTCGGTACCGCGCGC-TCC-CGTCCTCTGTCT-3′; this fragment was cut with KpnI, ligated into the unique KpnI site of pDELBOY, and screened for the correct orientation. Fragment 3 (2.148 kb) was created using the primer pair 5′-TCTGTCGACGCCTCGCCCG-ACCTCGCCGTGT-3′ and 5′-GTCGTCGACTCCCTGAACTGGCCGGTTGTTGGGA-3′; this fragment was cut with SalI, ligated into the unique SalI site of pDELBOY, and screened for the correct orientation. The finished targeting vector, pDEL-Bcl11a-cko-17, was thoroughly sequenced on both strands to ensure nucleotide identity with the original germ-line sequence and to verify the integrity of both loxP sites. pDEL-Bcl11a-cko-17 was linearized with the restriction enzyme AscI at the short arm. C57BL/6 SM-4 ES cells were transfected and selected with G418 per standard protocols. Approximately 90 ES cell colonies were screened by PCR amplification of the 5′ arm of homology, using a forward primer specific for germ-line sequence external to the targeted region (SA-FWD: 5′-CGCGCGCGTGTGCATTAAAGAG-3′) and another primer specific for the pDELBOY neo cassette (SA-REV: 5′-AATAGGAACTTCGGCCGCCACC-3′). This PCR screen identified two ES clones positive for homologous recombination. One of these clones, ES no. 65, was verified by Southern hybridization analysis using probes specific for the 5′ and 3′ flanks of the targeted region. The 5′ Southern used a 0.992-kb KpnI–EcoRI fragment as probe derived from the 4.947-kb KpnI–NotI genomic subclone. The 3′ Southern used a 0.886-kb PCR fragment as probe derived from the exon1– exon2 intronic region, using the primers 5′-CAGTCCTTGGCTTTGCTTTTGT-3′ and 5′CTCAACATTTTCTATGCTCTTAACG3′; XbaI–SalI double digest yielded a 5.8-kb targeted allele and a 9.4-kb wild-type allele. Conditional knockout (cKO) mice were routinely PCR genotyped using tail genomic DNA and the following primer pair at an annealing temperature of 63 °C, 45 s 72 °C extensions, for 30 cycles: FRAG1-neo-FWD (5′-CCTCCCCTAGCCCGCTGCAGAGCTCT-3′) and FRAG2-REV (5′-GAGCGGG-CGGAAGAAAACCAGG-3′) to detect a targeted floxed allele of 375 bp and a wild-type allele of 250 bp. Retroviral Transduction of B-Cell Lines and LymphoChip Gene Expression Profiling. Phoenix-A (ΦNX-A) amphotropic retrovirus-packaging 293 cells were plated at a density of 3 × 106 cells per 10-cm plate in DMEM supplemented with 10% FBS and allowed to adhere 6 h to Ippolito et al. www.pnas.org/cgi/content/short/1319228111 overnight before transfection with retroviral constructs. Twentyfour hours after transfection with 20 μg of retroviral vectors pXY-PURO (negative control vector) or pXY-BCL11A-XS or pXY-BCL11A-XL using Fugene-6 reagent (Roche), the media was removed and replaced with 6 mL of fresh DMEM with FBS. The next day, conditioned supernatant was filtered through a 0.4-μm syringe filter, and DOTAP liposomal transfection reagent (Roche) was added at 1:100 dilution. Retroviral supernatant was held briefly at 4 °C while target cells were spun down at 2 × 106 per well of a six-well plate, then aspirated, resuspended in 2 mL of retroviral supernatant per 2 × 106 target cells, and centrifuged at 20 °C, 2,500 × g, for 1.5 h. Afterward, one-half volume of media was removed and replaced with fresh media. After 48 h, an empirically determined amount of puromycin was added to infected cells. (For Raji cells, e.g., cells were selected with 2 μg/mL puromycin.) Typically, uninfected cells were killed around day 3 of selection, whereas infected cells grew out between day 5 and day 7. At this point, cells were pelleted by centrifugation, media-aspirated, and lysed in TRIzol reagent for total RNA extraction. RNA was used for LymphoChip microarray profiling (2) or oligo-dT cDNA synthesis using SuperScript III reagent kit (Invitrogen) and for endpoint RT-PCR experiments. PCR and human primer pairs in Table S1 were used to amplify gene transcripts from BCL11Aoverexpressing cells. Chromatin Immunoprecipitation. A 20-mL high-density Raji culture containing 0.5–0.6 × 107 cells was used per immunoprecipitation (IP). One percent formaldehyde was added directly to culture medium [540 μL added dropwise using a commercial stock solution of 37% (vol/vol) formaldehyde/10% (vol/vol) methanol] and cellular chromatin was cross-linked at room temperature for 20 min with periodic rocking by hand. The reaction was terminated by immediately diluting with a maximal volume of ice-cold PBS supplemented with protease inhibitors. After cell lysis and preparation of nuclei, the chromatin was sonicated with a Branson Sonifier 250 sonicator (90% duty cycle, power setting 3) using five pulses of 15 s each; the chromatin was incubated 1 min on ice between pulses. An aliquot was reverse cross-linked (65 °C in the presence of 5 M NaCl overnight) and checked by gel electrophoresis to determine that the chromatin had been sheared to an average size of 200–1,000 bp. Chromatin supernatants were collected and spun at 15,000 × g at 4 °C for 10 min, and the clarified supernatant was transferred to a new tube and then diluted 1:10 in IP buffer [0.1% SDS, 1% Triton X-100, 1.5 mM EDTA, 150 mM NaCl, 15 mM Tris·HCl (pH 8.0), 1× protease inhibitor mixture, 10 mM NaF, 5 mM Na butyrate] and were precleared by rocking on a platform with 2 μg sheared salmon DNA and protein A-Sepharose (50% slurry in PBS + NaN3) overnight at 4 °C. The chromatin was immunoprecipitated using 6 μg per IP of affinity-purified rabbit anti-BCL11A polyclonal antibody (Bethyl Labs BL1797) or 6 μg preimmune rabbit IgG (Bethyl Labs P120-101) as control. Immunoprecipitation was performed overnight at 4 °C. After numerous washes with sequential buffer solutions, but before pelleting the protein A-Sepharose beads, one-third of the beads were removed, spun down, resuspended, and boiled in Laemmli loading solution, and run on a 7.5% Western gel to confirm the successful pull-down of BCL11A. To elute the remaining two-thirds, 250 μL of freshly prepared elution buffer (1% SDS, 0.1 M NaHCO3) was added for 15 min at room temperature on a platform rocker; the elution was repeated once more. Eluates were heated at 65 °C (in the presence of 5 M 1 of 8 NaCl) for at least 6 h to reverse the formaldehyde cross-linking. Chromatin was extracted once with phenol–chloroform, then once more with chloroform only. A 1.5-μL aliquot (from a total ∼400 μL) was used for each PCR, and the products were analyzed on a 2% agarose DNA gel after 38 cycles of PCR using an annealing temperature of 62 °C with 72 °C 1 min, 15-s extensions. Primers are in Table S1. Inducible shRNA Knockdown and RT-PCR in the CAL-1 Plasmacytoid Dendritic Cell Line. CAL-1 cells were first stably transduced with a retrovirus expressing the bacterial tetracycline repressor (TETR) and the blasticidin resistance gene. An amphotropic retrovirus was produced in Phoenix cells with the pRSMX-PG vector containing shRNA targeted to exon 2 of Bcl11a under the control of a modified H1 promoter containing binding sites for TETR (3). Selected TETR-expressing CAL-1 cells were infected with pRSMX-PG retrovirus, and after puromycin selection, doxycycline (50 μg/mL) was applied for induction of shRNA expression. Cells were harvested for total RNA isolation at multiple time-points. RTPCRs with the listed human primer pairs in Table S1 were performed to amplify gene transcripts from induced BCL11A knockdown cells. The RT-PCR gel was scanned into a digitized image with the Typhoon Trio variable mode imager (GE Healthcare), and band densities were determined with ImageQuant TL software (GE Healthcare). Culture of fetal liver or bone marrow cells. Liver from fetuses was pressed through a 70-μm nylon cell strainer with a 5-cc syringe plunger to make a single-cell suspension. Bone marrow was washed out of femurs and tibias of 8-wk-old mice with a 25-gauge needle and 10 mL of PBS. Cells were washed, pelleted by centrifugation, and resuspended in RPMI-1640 medium. Fetal liver cells (including RBCs) were seeded at 10 × 106 nucleated cells per milliliter of RPMI-1640 (supplemented with 10% FBS) in 24-well plates, and bone marrow cells were subjected to RBC 1. Rossi DJ, et al. (2001) Inability to enter S phase and defective RNA polymerase II CTD phosphorylation in mice lacking Mat1. EMBO J 20(11):2844–2856. 2. Alizadeh A, et al. (1999) The LymphoChip: A specialized cDNA microarray for the genomic-scale analysis of gene expression in normal and malignant lymphocytes. Cold Spring Harb Symp Quant Biol 64:71–78. Ippolito et al. www.pnas.org/cgi/content/short/1319228111 lysis buffer [0.15 M NH4Cl, 10 mM KHCO3, and 0.1 mM Na2 EDTA (pH 7.2)] for 3 min before centrifugation, washing, and plating at 2 × 106 cells per milliliter in 12-well plates in the same media. Cells were cultured in 100 ng/mL Flt3-ligand (Flt3L) or 50 ng/mL GM-CSF to induce plasmacytoid dendritic cell (pDC) or conventional dendritic cell (cDC) expansion, respectively. Time points are indicated in text and figures. pDCs were identified as indicated in the figure legends. For Siglec-H RT-PCR, 1.5 μL of oligo-dT–primed cDNA was used as template. Cycling conditions were 58 °C annealing, 1 min, 40-s extensions at 72 °C for 38 cycles. ELISA measurement of IFN-α in the supernatants of cultured fetal liver cells. For quantitation of cytokine production, fetal liver cells were cultured with Flt3L for 7 d. Cells were stimulated day 7 with 5 μM CpG oligodeoxynucleotide D19 or left untreated for 24 h. Cellfree supernatants were collected and analyzed with a mouse IFN-α ELISA kit per the manufacturer’s instructions (PBL Biomedical Laboratories). Data were acquired using a Bio-Tek model EL311 automated microplate reader measuring absorbance at 450 nm. ID3 luciferase reporter assay. PCR was used to generate an ∼820-bp amplicon of ID3 regulatory region genomic DNA containing the same region consistently PCR-amplified in ChIP experiments: ID3 primers ID3-luc-FWD (5′-CAACAGGGTACCAAGTGCAGGTCCCCAAATGTCT-3′) and ID3-luc-REV (5′-GTCAGATCTCGCCTTTAGCCCAACACTGGTT-3′). This product was ligated into the firefly luciferase plasmid pGL2 Basic (Promega). Constant amounts (1 μg) of pGL2 or pGL2-ID3-820 were cotransfected with 5 ng of control vector pRL-TK (encoding Renilla luciferase) plus varying amounts of pGFPC1-BCL11A-XL into Raji or CAL-1 cells using FuGENE 6 (Roche) or Amaxa (Lonza) transfection reagents. Equivalent total amounts of plasmid DNA were used in each transfection. Luciferase activity was measured 24 h posttransfection using a Dual-Luciferase Reporter Assay System (Promega) per the manufacturer’s protocol. 3. Ngo VN, et al. (2006) A loss-of-function RNA interference screen for molecular targets in cancer. Nature 441(7089):106–110. 2 of 8 Fig. S1. In vivo cellular and molecular absence of pDC in Bcl11a-deficient fetal tissues. (A) Nucleated cells expressing the B220 leukocyte common antigen are nearly undetectable in pooled liver and spleen cells isolated from Bcl11a knockout (−/−) fetal (E17) mice compared with siblings. Flow cytometry representative of n = 3 independent experiments indicates that Cd19+ B cells and all B220+ cells are lost in a Bcl11a dose-dependent fashion in the conventional knockout. (B) Mature Cd11b– Cd11c+ B220+ PDCA1+ pDCs are nearly absent (reduced as much as 25-fold) in pooled fetal liver and spleen from Bcl11a−/− mice compared with wild-type littermate controls (+/+). B cells are also absent in Bcl11a−/− mice, as previously described (1). The Cd11b+ myeloid cell population is unperturbed. The result show percent of total nucleated cells representative of n = 3 independent experiments involving >10 total littermates. (C) Late gestation (E17) Bcl11a−/− mice are deficient for the pDC gene transcript Siglec-H (n = 2 independent experiments). 1. Liu P, et al. (2003) Bcl11a is essential for normal lymphoid development. Nat Immunol 4(6):525–532. Ippolito et al. www.pnas.org/cgi/content/short/1319228111 3 of 8 Fig. S2. Conditional knockout mice. To determine whether the defect in fetal pDC development observed among Bcl11a-deficient conventional knockout mice is cell-intrinsic, we generated a conditional knockout allele of Bcl11a for in vivo studies of hematopoiesis in adult mice. Our strategy resulted in deletion of the first exon, which is included in all previously characterized Bcl11a transcripts in mouse and man (1–4). The deletion also removed ∼1.5 kb of upstream sequence containing an ultraconserved noncoding region (UCR) predicted to reside within the core of the Bcl11a proximal promoter. UCRs are phylogenetically ancient, typically exhibiting perfect identity across multiple vertebrate species, and are strongly associated with developmental regulatory gene networks that encode DNA-binding proteins. A targeting vector containing short (0.9 kb) and long (4.37 kb) arms of homology, a neomycin cassette (pgk-neo) for positive selection, and a thymidine kinase cassette (pgk-hsv-tk) for negative selection, is depicted. Two loxP sites flank, or “flox,” the region to be deleted. The downstream loxP site, flanked by engineered KpnI and SalI sites, deletes a NotI site otherwise present in the germ line of wild-type mice. The 5′-UTR, exon 1, and an ultraconserved DNA element (uc.62) are within the region targeted for deletion. The targeting vector was electroporated into SM-4 C57/BL6 ES cells using standard methods and a clone identified to have undergone homologous recombination at the Bcl11a locus was subsequently verified by Southern analysis (across the long arm of homology using a 3′ probe) to have transmitted through the germ line to C57/BL6 founder pups. In addition to the presence of a WT allele of 9.4 kb, germ-line transmission of the targeted (TA) Bcl11a allele was revealed by the appearance of a 5.8-kb band when tail genomic DNA was digested with the restriction enzymes XbaI and SalI. These mice were crossed to C57/BL6 Flp transgenics to delete the FRT-Neo-FRT cassette in vivo, and then to conditionally knock out the gene, Bcl11afl/fl mice were crossed with Cre-deleter strains, Mx1 (37) and Vav (5, 6). For Mx1 induction, polyI:polyC (pI:pC; Sigma) was prepared at 2 mg/mL in PBS and administrated via i.p. 1. Satterwhite E, et al. (2001) The BCL11 gene family: Involvement of BCL11A in lymphoid malignancies. Blood 98(12):3413–3420. 2. Liu H, et al. (2006) Functional studies of BCL11A: Characterization of the conserved BCL11A-XL splice variant and its interaction with BCL6 in nuclear paraspeckles of germinal center B cells. Mol Cancer 5:18. 3. Sankaran VG, et al. (2009) Developmental and species-divergent globin switching are driven by BCL11A. Nature 460(7259):1093–1097. 4. Xu J, et al. (2010) Transcriptional silencing of gamma-globin by BCL11A involves long-range interactions and cooperation with SOX6. Genes Dev 24(8):783–798. 5. Georgiades P, et al. (2002) VavCre transgenic mice: A tool for mutagenesis in hematopoietic and endothelial lineages. Genesis 34(4):251–256. 6. Stadtfeld M, Graf T (2005) Assessing the role of hematopoietic plasticity for endothelial and hepatocyte development by non-invasive lineage tracing. Development 132(1):203–213. Ippolito et al. www.pnas.org/cgi/content/short/1319228111 4 of 8 Fig. S3. Peak score from BCL11A ChIP sequencing (ChIP-seq) of CAL1 and GM12878 cell lines. Fig. S4. Evolutionary conservation of the Ets transcription factor/interferon regulatory transcription factor (IRF) composite element (EICE). The binding site is moderately conserved between human and mouse in the BCL11A, E2-2/TCF4, FLT3, and ID3 loci. The consensus motif was compiled from de novo analysis of CAL-1 ChIP-seq peaks, ranking as indicated. This motif matches the top-ranked motif from the ENCODE Consortium ChIP-seq data on the human lymphoblastoid cell line, GM12878. There were two potential sites near the ChIP PCR products for TCF4 (Fig. 5C), one on the forward strand (h/mTCF4 F) and one on the reverse strand (h/mTCF4 R). Ippolito et al. www.pnas.org/cgi/content/short/1319228111 5 of 8 MTG16 E2-2/TCF4 Fig. S5. Model of pDC development. We propose a model in which CDPs progress to pDC by default via constitutive expression of E2-2 and BCL11A through a feedback loop. In this loop, BCL11A activates E2-2 transcription and induces transcription of ID3, which may, in turn, heterodimerize with and thereby reduce the protein activity of E2-2 (or other E-protein family members). In this way, ID3 (and perhaps BCL11A’s autoregulation) provide homeostatic maintenance within pDC by buffering E2-2. In the absence of BCL11A, cDCs persist, and therefore an alternate CMP-CDP-cDC pathway is favored. Other putative direct targets of BCL11A (Fig. 3) that are necessary for pDC development include PU.1/SPI1 and SPIB. Ippolito et al. www.pnas.org/cgi/content/short/1319228111 6 of 8 Table S1. Primers used for all procedures Sample source and gene target Conventional Bcl11a−/− mice WT allele (247 bp) Evi9-1-FWD Evi9-2-REV KO allele (410 bp) 51-2-FWD Neo-stop-REV RT-PCR of Bcl11a−/− fetal liver or Bcl11a cKO spleen cells Bcl11a (379 bp) Bcl11aEX2-FWD Bcl11aEX4-REV Siglech (950 bp) Siglech-FWD Siglech-REV Id3 (194 bp) Id3-FWD Id3-REV Cd19 (400 bp) Cd19-FWD Cd19-REV β-Actin (605 bp) Actin-FWD Actin-REV Hprt Hprt-FWD Hprt-REV RT-PCR of retrovirally transduced B-cell lines BCL11A (376 bp) FWD REV ID2 (392 bp) FWD REV ID3 (206 bp) FWD REV GAPDH FWD REV ChIP ID3 promoter (201 bp) HuID3-2-pro-FWD HuID3-2-pro-REV ID3 10 kb upstream (185 bp) HuID3-10kb-FWD HuID3-10kb-REV E2-2/TCF4 (176 bp) E2-2-FWD E2-2-REV BCL11A (207 bp) BCL11A-FWD BCL11A-REV Inducible shRNA knockdown and RT-PCR in the CAL-1 pDC cell line BCL11A (252 bp) FWD REV ID3 (206 bp) FWD REV E2-2/TCF4 (186 bp) FWD REV GAPDH (106 bp) Ippolito et al. www.pnas.org/cgi/content/short/1319228111 Primer 5′-CCATGACGGCTCTCCCACAAT-3′ 5′-GCGAGAATTCCCGTTTGCTT-3′ 5′-ATCCCGACTCCAGACTGGGAC-3′ 5′-ACGAGTTCTTCTGAGGGGATC-3′ 5′-GTGGATAAGCCGCCTTCCCCTT-3′ 5′-GGGGACTTCCGTGTTCACTTTC-3′ 5′-ACTAAGCTTAGACAGGAGCCCAGGCCATC-3′ 5′-GTGGATCCCTGGTGTAATGCC-3′ 5′-ACATGAACCACTGCTACTCGCGCC-3′ 5′-TTCCGGAGTGAGCTCAGCTGTCTG-3′ 5′-TAGGAGGCAGGCCCCAGAAGTC-3′ 5′-CCAGAAGTGGACCTGTGGCTCC-3′ 5′-TACGAGGGCTATGCTCTC-3′ 5′-CGCAGCTCAGTAACAGTC-3′ 5′-GATACAGGCCAGACTTTGTTG-3′ 5′-GGTAGGCTGGCCTATAGGCT-3′ 5′-ACCATGTCTCGCCGCAAGCAAG-3′ 5′-CCTGTTTGGGGCAAATTCCTCT-3′ 5′-ATGAAAGCCTTCAGTCCC-3′ 5′-GCTTTGCTGTCATTTGAC-3′ 5′-GGAACTGGTACCCGGAGT-3′ 5′-GTCAGTGGCAAAAGCTCC-3′ 5′-GAAGGTGAAGGTCGGAGTC-3′ 5′-GAAGATGGTGATGGGATTTC-3′ 5′-CCTGTTGCAATACAGGACTTAGTTTG-3′ 5′-TCCCCTCTCTTCACTTTCCACA-3′ 5′-GCATTTGGAACAAATCAGACCTTAC-3′ 5′-AACTCAGCCCTGGATCTTGGAATC-3′ 5′-GCCTCCATGATGGCATTAGT-3′ 5′-ACCCCTGGAGGCTACAAAGT-3′ 5′-CTCCCCGCACTGGCCATTGGCT-3′ 5′-GCCCCCCTGAGCTGCAAGTTCA-3′ 5′-CGAGCACAAACGGAAACAATG-3′ 5′-GATTAGAGCTCCATGTGCAGAA-3′ 5′-GGAACTGGTACCCGGAGT-3′ 5′-GTCAGTGGCAAAAGCTCC-3′ 5′-GCCACCAGGACTACAGGGGCA-3′ 5′-GCCTTCTGCTCTGGTGTCAGGT-3′ 7 of 8 Table S1. Cont. Sample source and gene target Primer 5′-GTGAAGGTCGGAGTCAACG-3′ 5′-TGAGGTCAATGAAGGGGTC-3′ FWD REV ID2 FWD REV CD37 (350 bp) FWD REV 5′-TCACCAGAGACCCGGGCAGA-3′ 5′-GAACACCGCTTATTCAGCCACA-3′ 5′-AAGTACTTCCTCTTCGTTT-3′ 5′-TGGATGGTTTTCTCTACGAC-3′ Table S2. FACS antibodies used in this study Epitope B220* c-kit Cd115 Cd11b Cd11c Cd19* CD3e* CD4* CD8a* F4/80 Flt3 Gr-1 IgM* IL-7Ra* Ly6G* MHC cl.II mPDCA-1 NK1.1 Sca1 Ter-119* Streptavidin Clone Conjugate Supplier RA3-6B2 RA3-6B2 RA3-6B2 2B8 AFS98 M1/70 M1/70 M1/70 N418 N418 N418 1D3 1D3 17A2 17A2 RM4-5 53-6.7 53-6.7 BM8 A2F10 RB6-8C5 RB6-8C5 RMM-1 SB/199 SB/199 RB6-8C5 M5/114.15.2 JF05-1C2.4.1 PK136 D7 TER-119 APC PE e615 PE/Cy7 Alexa Fluor 488 FITC PerCP/Cy5.5 PE/Cy7 FITC APC/Cy7 PerCP/Cy5.5 Biotin PerCP/Cy5.5 APC/Cy7 PerCP/Cy5.5 PerCP/Cy5.5 PerCP/Cy5.5 APC Alexa Fluor 488 APC Biotin PerCP/Cy5.5 PerCP/Cy5.5 V450 V450 PE Pacific Blue PE PerCP/Cy5.5 Alexa Fluor 700 PerCP/Cy5.5 PerCP BD Biosciences BD Biosciences eBioscience BD Biosciences BioLegend BD Biosciences eBioscience BioLegend Miltenyi Biotec BioLegend eBioscience BD Biosciences eBioscience BioLegend eBioscience BioLegend eBioscience BD Biosciences BioLegend BioLegend BD Biosciences BioLegend BioLegend BD Biosciences BioLegend eBioscience BioLegend Miltenyi Biotec eBioscience eBioscience BD Biosciences BD Biosciences *Antibodies used as lineage markers. Ippolito et al. www.pnas.org/cgi/content/short/1319228111 8 of 8
© Copyright 2026 ExpyDoc