Gene, 111 (1992) 119-124 © 1992 Elsevier Science Publishers B.V. All fights reserved. 0378-1119/92/$05.00 119 GENE 06287 Analysis of a ribosomal RNA operon in the actinomycete F r a n k i a (Actinomycetales; 16S, 23S, 5S rRNA; nitrogen-fixing; Casuarina; recombinant DNA) Philippe Normand, Benoit Cournoyer, Pascal Simonet and Syhie Nazaret Laboratoire d'Ecologie Microbienne du Sol, U.R.A. C.N.R.S. 1450, Universitd Lyon I, F-69622, Villeurbanne Cedex (France) Received by K.F. Chater: 29 August 1991 Revised/Accepted: 10 October/ll October 1991 Received at publishers: 22 November 1991 SUMMARY The organisation of ribosomal RNA-encoding (rrn) genes has been studied in Frankia sp. strain ORS020606. The two rrn clusters present in Frankia strain ORS020606 were isolated from genomic banks in phage ~EMBL3 by hybridization with oligodeoxyribonucleotide probes. The 5'-3' gene order is the usual one for bacteria: 16S-23S-5S. The two clusters are not distinguishableby restriction enzyme mapping inside the coding section, but vary considerably outside it. Sequencing showed that the 16S-rRNA-encoding gene of ORS020606 is very closely related to that of another Alnus-infective Frankia strain (Ag45/Mut 15) and highly homologous to corresponding genes of Streptomyces spp. Two possible promoter sequences were detected upstream from the 16S gene, while no tRNA-encoding gene was detected in the whole operon. Regions with a high proportion of divergence for the study of phylogenetic relationships within the genus were looked for and found in the first intergenic spacer, in the 23S and in the 16S gene. INTRODUCTION The nitrogen-fixing symbiosis between the actinomycete Frankia sp. and a number of woody dicotyledonous plant genera play a major role in agroforestry. A better utilization of the Frankia-symbiosis will necessitate consideration of such properties as persistence in the soil and competitiveness of released strains, which requires precise strain identification, such as that afforded by oligo hybridization (Simonet et al., 1990). The rRNA-encoding genes, with Correspondence to: Dr. P. Normand, Laboratoire d'Ecologie Microbienne du Sol, U.R.A.C.N.R.S. 1450, B[R. 741, Universit6 Lyon I, F-69622, Villeurbanne Cedex (France) Tel. (33)72448289; Fax (33)72448466; e-mail NORMAND @CISM.UNIV-LYON I.FR. Abbreviations: bp, base pair(s); IGS, intergenic spacer; kb, kilobase(s) or 1000 bp; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; ORF, open reading frame(s); PCR, polymerase chain reaction; rrn, rRNA-encoding genes; rRNA, ribosomal RNA; tRNA, transfer RNA; Y, C or T (U). their conserved areas that alternate with highly variable zones, provide targets for oligo identification (Haun and G0bel, 1987; Wilson et al., 1988). Attempts at sequencing directly the 16S rRNA from Frankia strains were successful in the case of two Alnusinfective strains (Hahn et al., 1989) but could not be achieved in the case of Casuarina-infective strains due to problems in the isolation of suitable rRNA (S.N. and E. Stackebrandt, unpublished). For these reasons, the Casuarina-infective Frankia strain ORS020606 from which a gene bank had already been constructed (Normand et ai., 1988), was deemed an appropriate candidate for the study of rRNA-encoding genes in Frankia. EXPERIMENTAL AND DISCUSSION (a) Characterizationof rRNA-encoding gene clusters There were clear signals when probes LSUll03 and LSU2536' (Table I) labeled according to Zeffand Geliebter 120 TABLE I Listofoligosused Designation ~ 5' ~ 3 ' sequence b SSU413 SSU901 SSUllg0' SSU1508 LSU20' LSUII03 LSU2536' AGC GCC GGG TCT AGA GAA GAA GAC TTG GCA AGA TCT AGA CAG GCC GGA TGA GGT GCC GTG CCC GCG GTA TGA GAA AAG CGT AAC TGA CGG CTT GTC GCA AAT CCT GGG CCG GAC GTA TCC AGC TGG ATG CA GTC ACA ACC TCA AAC AGG GTG TAG C " The oligo designations include three letters describing whether they correspond to 16S (SSU) or to 23S (LSU) genes, a number that corresponds to the E. coli sequence coordinates (Brosius et al., 1981), and a prime or no prime when the sequence is homologous or complementary, respectively, to the RNA sequence. b Oligo probes were end-labe!ed by phosphorylation using T4 polynucleotide kinase and [~,-32P]ATP (185 TBq/mmol) according to Zeff and Geliebter (1997). (1987) were hybridized with genomic DNA prepared as described before (Normand et al., 1988)from Frankia strain CeD isolated from Casuarina equisetifolia (ORS020606; Diem et ai., 1983). One or two fragments, depending on the restriction enzyme used, gave a positive signal (Fig. 1). There are thus two rRNA-encoding gene clusters called rrnA and n'nB, present as BamHI fragments of 6 + 6 and 3.5 + 2.2 kb, respectively (Fig. 1). It has been suggested that in bacteria, the number of clusters could be directly related to the growth rate. Frankia with a doubling rate of a few days is certainly slow and the low number of clusters found would thus be consistent with this explanation. 24kb- ~'~,~,, 9.5 - tjjj~ (b) Cloning of the two rRNA-encoding gene clusters Hybridization of the ORS020606 gene bank (Normand et al., 1988) with oligo probe LSU1103 yielded five positive signals, two of which were chosen at random for further studies. These turned out to contain the two different rRNA-encoding gene clusters, i.e., they had BamHI fragments of 6 and 3.5 kb that hybridized both with oligo probe SSU413 (5' part ofl6Sgene) and LSU1103 (middle of the 23S gene). Two representative clones were named Olrnal and Olrna2 containing clusters rrnA (containing the two 6-kb BamHI fragments) and rrnB (containing the 3.5 and 2.2-kb BamHI fragments), respectively. The two phages ~i, O 6.",, 4.5 2,3 m 2.0 " 0.6 . @ A B Fig. I. Genomic blots of Frankia total DNA. Frankia strain ORS020606 total DNA was cut with the indicated restriction enzymes. Electrophoresis was carried out at 1 V/cm for 16 h in TAE buffer (Maniatis et ai., 1982), and the resulting gel was transfered onto a nylon filter and hybridized with ~2P-labeled LSU1103 that corresponds to the first half of the 23S gene (panel A) or with LSU2536' that corresponds to the second half of the 23S gen0 (panel B). Size markers were derived from phage ~. digested by HindIlI (sizes in kb marked on the left margin). Hybridizations were at 45 °C in 2 x S SC (Maniatis et al. (1982)/1 u Denhardt's (1966)/1% (w/v) SDS/10~ (w/v) dextran/l mg per ml of denatured salmon sperm DNA. 121 were hybridized with purified, labeled 16S, 23S or 5S rRNA p:epared from Frankia strain Tx30SAb (Normand and Lalonde, 1986) and partially hydrolyzed in 50 mM Tris-Cl pH 9.5 (pH at 25°C)/0.1 mM spermidine at 95°C for 15 min, and with different oligos. The resulting genetic and restriction maps of the two clones are given in Fig. 2. This map is totally consistent with the genomic blots (not shown). The three rrn genes in the two operons were found to be arranged in the order 16S-23S-5S usual for bacteria. Restriction sites were identical within the rrn genes but extensive sequence divergence started from around 700 bp upstream from the EcoRI site present at the start of the 16S genes (e.g., the Bglll site of O l r n a l is replaced by BamHl 6 3 ? 4 5 cOR 8 9 6 indl 7 I0 aral II 8 Cpnl 12 9 13 I0 II pslt -Kpnl - 14 S alI 01rnal 01rna2 Fig. 2. Comparison of the two operons. Relevant parts of the inserts in phages O l r n a l and Olrna2 are shown side by side with restriction maps. Those sites mapping at similar points on the two dusters are connected. The zones corresponding to the genes are shaded. The scales are in kb and thek coordinates start at the BamHI junction site with the phage 2 leR arm. and SalI sites in Olrna2) and about 2 kb downstream from the HindllI site where a Xhol site present in Olrnal is replaced by Sail and BamHI sites (Fig. 2). The unique EcoRI site present in the first half of several bacterial 16S genes is present in the two clusters. (c) Sequencing of the rrnA gene cluster The nt sequence ofgene cluster rrnA is shown in Fig. 3. It has been deposited in GenBank and given accession No. M55343. The whole sequence from the first of the two Bgill sites up to theXhoI site is 6481 nt long. The restriction sites found by computer search are completely consistent with the restriction analysis of the O l r n a l phage (Fig. 2). The allocation of 16S, 235 and 5S segments was determined using the high sequence similarity of that region with Streptomyces ambofaciens (Pernodet et al., 1989) with the Bestfit comparison algorithm (Smith and Waterman, 1981). The length of the 16S gene (1512 nt) is somewhat shorter (by 16 nt) than the corresponding one in S. ambofaciens, and more markedly so (by 30 nt) relative to Bacillus subtilis (Green and Void, 1983) and E. coliRI (Brosius et al., 1981). The G+C ofthe gene is 60~o, which is higher than most 16S sequences with which it was compared but lower than total DNA (71%) from Frankia according to Fernandez et al. (1989). The 16S gene is the most conserved gene of the operon, especially at its 3' end. The highest sequence similarity is with Frankia strain Ag45/Mut15 (95%) and with S. ambofaciens (90 %). The highest sequence divergence is not to be found in the first hypervariable region of Embley et al. (1988) where only two mismatches with S. ambofaciens are present. However, the hypervariable zone of Pernodet et al. (1989) at the beginning of the gene, and to a lesser extent the second hypervariable zone of Emblcy et al. (1988) are potential sites for species specific probes. This last zone has been exploited by Nazaret et al. (1991) for phylogonetic purposes in Frankia. The 23S gene was found to extend from nt 2451 to 5549 for a length of 3099 nt, a length comparable to that of S. ambofaciens (3120 nt) and thus amongst the longest bacterial 23S sequences determined so far (Pernodet et al., 1989). The percentage G+C is lower (57%) than that of the 16S gene, which appears also to be the case in other bacteria studied. The highest sequence similarity with the S. ambofaciens sequence is to be found at both extremities, especially at the 3' end of the gene (Fig. 3). Conversely, the highest divergence was found in three regions (numbered from the start of the Frankia 23S gene): at nt 310-450 (64 mismatches/140nt), at nt 1245-1350 (49 mismatches/ 105 nt) and especially at nt 1510-1715 (81 mismatches/ 210 nt). The 5S gene extends from nt 5618 to 5736 for a length of l l 9 n t . The last nt, a C, may not belong to the gene itself since it is part of the perfect inverted repeat extend- GTTGTGAGGG A T T ~ beginning of 16S qene Itpal GGTACGTGGG TAGGTTAACT ACACGGTGGT GGGCCTGTGA G G ~ T G TCGATGTCGG G G ~ C G A GCC3~TT~IT ~fACCCCG~ CATGGCCTGG CTGGGTGGTG GGrTC~TCGC TI~GAACGCG AACGTCCGGA GTGTGCAAGA " -10" ~CCGAG T~/%CTTAAAG AAGCACCAC4% ACG~AGCCCT GTACGAGAGT G G ~ C A C C TGGTGGTGTG GAAAGATTTA TCGGCTCGGG A ~ G G C C C G C GGCCTATCAG C~WGTTGGTG GGGTGATGGC ACCGGTGCCG AAGGCGGGTC TCTGGGCCGG AACTGACGCT AA~AGCGAA AGCGTGGGGA GCGAA~AG~q TTAGATACCC TGGTAGT~A Eagl G~£GGGCGCT AG~TGT~GGG ~-ACCI~CCAC GGCCTCCGTG CCGCAGCT~A CGCATTAAGC GCCCCGCCTG GGGAGTACGG C C G C ~ G C T TCGGCTGTGA EcoRV GCGCAGAT~T /~GCACCGGC AAC~CGACCC CGTGAAGTCG GAGTCGCTAG TAATC~AGA TCAGCJ~TGC TGCGG~G~T A~GTTCCCGG GCCTTGT/~A CACCGCCCGT GCACGCTGTT G G G T C C ~ G GGAGTGAGGC TCT~TCGGCT GGTGGGTTCC TGTGCTGTGG GGG/~GTGAA ACATCTCATr ACCCGCAGGA GGAGRAAACA ACCGTGA~rC CGCG~GTAGT GARTGGGCCG CCATAGA~GG TRATAGCCCT GTAGCCGARA GCAGTGTTCC TCCCGGACGT C ~ GAATGAGL'CT GCGAGIT]'GC GGTGTGTGC.C GAGGrTAACC CGTGTGGGGT AGCCGTAGCG A~GcC_~AGTC CC~AGKGGGC ~ G C Bali CCA'IGGCCAG G~I'GAAGCGC GGGTAAGACC GTUTGGAC,GA CCGA~CCAU CAGGG'I'I'GAA ,~CCTGGGGG C GTCCGCCGGA TGACC~AGGG TrCC~GGGC AG~CTMTCC C-CCCAGGGTG T A G ~ CAGGGCCGCC CGTACCCT~A N : C ~ GAGGTCAC.,GT AGAGAATACC GAGGCGTTCG #ETG~ACTGT GGTTAAGC~A CTCGC-C~AAT GCCCCGTRAE TTCGGAC~ARG GGGGUCCGTT CTCCGTGTAG GGG'ITI'ACCT CCGRACEC~G G A ~ C G C xcaI AGAGACCAGG GGA~CGAC T~TTTAUrAA AAAUACAGCT CCGTGCT~G "23CGT~AGACG&~-T&TACG6 AG'DGREGCCT GCCCGGTC~T ~ G T T A A GGffrGAT~CT AT~CTO~C~ C ~ q A A ~ T ~ CCAGC-CGGTG G'FrGTCCTGG GGCAI~GGTG TN;GACGAGG CGTN;GTAAA TCCGCGTCTr GTGTGTCTGA GkCCTGATGC CGAGCCGATT GCGGCGARGT AGTCGGGACC TAAGGCGAGG CCGACAGGCG T ~ T C G A T G G ATAACGG~'I~ C~T~TrCCCG TACCGGCGTT GACGCGGCCA ~ C C T G G ~ T BamHI 4001 AACCATCTGA TCGGATGTGT CTCTTCGGAG GTG~A-A~GG C ~ T ~ ~CCCGGCTGG TAGTAGGCAA GCGATUGGGT GACGAGGAAG GTA~CCAGC CATACGAGTG AGAATGCAGG CATGAGTAGC GAATGACGGG ~ 3501 TTCGTAGTCG AGAGGGA2~C AGCCCAGATC GCCAGCTAAG GCCCCTAI~GC G T G C U C T ~ TGTGGRGTCG CATAGACAAC CAGGTGGTGC LSUl103 TrAGAAGCAG C C A C C ~ A~C,AGTC~q' AATAGC'IEAC T C ~ ' ~ G T G A T T U ~ G ~ C GA~A~TGTAG C G G G G C T C ~ GCGCACCGCC GAAGCTGCGG SphI CATGCACAAA ATrTCCCGGC ~ C ~ T CCAGGTTTGT GTGTGGGTAG GGGAGCGTCG TGTGGCGTGT GAAGCGGCGG GGTGACCCAG CCGTGGATGC ATGAGCTGTG GGTA~GGGTG A P ~ G C C A A T C ~ ' T C G G T GATRGCTGGT TCTCCCCG~A ATGC,qTTTA~ GTGCAGCGTC GCA'AUI'A~f TGCCGGAGGT Hindl II HlndlII AGAGCACTGG ATGGCCT~J3G GGGCCCAC~d% GCTTACTGAA GTCAGCCRRA CTCCGAATGC CGGTA~GTGA AGTC~GGC~G TGAGACTC~G GGGGATAAGC ATGTCCAAGA CCCGAAGCCG AGTGATCTAC C GTTCCCAAGT AC,CACGGI~C CCGTGTAA~T CCGTGTC~AT C'IV,GCGGGAC CACCCGCTRA GCCTAAATAC TCCCTGGTGA CCGATA~CGG ACTAGTACCG Sinai 3001 TGAGC~A~%G GTGAAAAGTA CCCCGGGAGG GGAGI~AAT A G T A C ~ ACCGTGT~CC TACA~TCCGT GGGAGCTGGA CT~TGGTCTG GTG~CCGCGT TCGGGGAGTC AGAAAGAGCA TrGTTAGGCG AAGGTCATGC GGTGAGCGAA AGCGGAACAG C~TA~ACCAG TGTCGTGTGA GAGCCGGCAG GTGTTGCGAT GCTGGGG]WG TGGGATCGTC CAGGTGGAGC TGCCG'FFCUA CACCCGTGCC TGAACACATA GGGCATGTGG AGGGAACGCG TCC~GGT(3GG GATCGTGGTG GGGGGTCTGC TGGTGGAACG GACCGGTCGT GGTGGAGGAC TGCCTTCCCG T~GGGTGGGG GTGGGTTTCG CCGGGTCGGC Ball/beglnnlng o f 235 qene TGGGC,CCGTC CGTACGTTGA ~ T G C A C A GTGGACGCGA GCATCTTTGT GG~CAAGTTA T T A ~ G G C ~ ACGGTGGATG CL"TTG~CAC~ ~ G ~ C C ~ T DraI 25~I GAAGGACGT~ GGAGGCTGCG ATATGCCTCG GGGAGCTGTC ~ACCGAGCTG TGATCCGAGG ATrTCCGAAT GGGGARACCC GGCAGGGCTT TAAATCCTGT TGC~GGGTGG AACC~TCCGG GTGGGTGGCT GGGGTCCGTG CACGTCACGA A,~3TCGGTAA CACCCGAAGC CGGTGGCCTA ACCCIT~TGG GGGG~GCCGT CGAAGGTGGG ACCGGCGA~I GGGACGAAGT CGT~d~CAA~G e n d o f 16s gene SD 2001 T~C,CCGTACC GCJ%~GC:TC,CC, C~CTGGATCA~ GGCTGG'~'~ TCCTGTAGTG GGGTGGGCTG GTGCAGAGCC AGGGCCGGCT Seal GTGGATGCCG GTCTGGTTGC TCGTGGGTGG AACGCTCACG AT~GGGTT~C GGCTGGTTGT CCGGGGTCTA GTACTCCTCT GT~CTTATCT TCGGGI~GGG CGGGGTCTGC CCCTTACGTC C~V~3GCTGCA CACATGCT~J~ AATGGCCGGT ACAAAGGGCT GCGATGCCGT GAGGTGGAGC GAATCCCAPA gJ~CCGGTCT CAGT~CGGAT CAACCCTCGT CCTATGTTGC CAGCGAG~CG TGTCGGGG~ TCATAGGAGA CTGCCGGGGT CAACTCGGAG C~AGGTC~GG AT~ACGTCAA GTCATCATGC 1501 ATCTCGTAGA GATACGGGGT CCGTAAGGGT CCTGCACAGG TGGTGCATGG CTGTCGTCAG CTCGTGTCGT GAGATG~rGG G ~ A A G T C C C CCP~CGAGCG A ~ A C T C A A A GGAATTGACG GGGGCCCGCA CAAGCGGCGG AC~ATGTGGC T~AATTCGAT GCAACGCCAA C~u~CCTTACC AGGGCTTGAC ATCCAGGGAA CGCCGTAAAC CAGGAGGAAC AGCCGGCCTG C~GC~G~GCCT CTACCAAGGC GACGACGGGT AGAGGCEGAC CGGCCACACT GGGACTGACA CAEGGCCCAG A~TCCTACGG GAGGCAGCAG TGGGGAATAT TGCGCAATGG 5SU413 KpnI/Pst I GACGCAGCGA CCCCGCGTGG CC,C~I~,~EGG CCfTCGGGTr GTAAF~CTCT TTCAGCAGGG P~GAAGCGAG AGTGACGGTA CCTGCAC~AG Sstl 1001 CAACTACGTG CCAGCAGCCG CGGTAATACG TAGGGTGC~A GCG~TGTCCG GAATTA~33G GCGT~AAC~tG CTCGTAGGCG G C C T G ~ C G Smal Pstl ECORI A~ACCCGGGG CTCA%CTCCG GGCCTGCRGT CGATA~GGGC AGGCTAGAGT CCGGCAGGGG AGACTGG~AT TCCTGGTGTA GCGGTGRAAT GCCGGGCATC ATGGAGAGTT T ~ A T C ~ TCAGGACGJ~A CGCTGGCGGC GTGC~ITAACA CA~CCAAGTC GAGCCGGGAG Sstl CTTCGGCTCT CAGCGGCGAA CGGGT~AGTA ACACGTGGC-C A~CCTGCCCC GAGCTCTGGA ATAR~CTCGG GAARCCGGGG CTAATGCCGG ATATGAERTI• 501 TGZ'FL'A-J.I~-A TCGGCC'CTCT C ~ A T C - ~ TCCCACGTGG TGGGGTGGCT ~ T T G G I]qlll 1 AGATCI~CTC CGAGGC,C,GCG TAC~C~CCCC GAGGAAA~GG GCCGCGGACG GTC~CATAAG "-35" "-lO" ACCGGGCCGG AGTGATTTGA CACAATCA/~ CCPJ%AGCTCA T~ATCTAGGA / ~ A C G T T C C Bgl I I "-35" AGGTAAGATC "IY2ITCGG~TG T C ~ T T D C GC~CA~G J%AGCGATI~G J%CACCGCCGG RNA p r o c a s s l n q s l " a GAC.nGTGC,~n GTCTGGTAGC G ~ C T ~ c " r ~ ~;~:;CGTGCC GATTGTCAGT ~AGTAA AUGG~GTUG TAALWATAAC CATCCTAAGG TA~£UAAATT cuTrffI~GGG A ~ C TGGGTCCGTG A~TCA GGGACAGTGT CAC~TGGGrA GTITAACTGG AGGGCT~£CC GA~GGGATAA C C ~ G AC~A~ CGCCACGCTG CKC.~_N:CAS CTCWI"CCGGT Fig. 3. Nucleotide sequence ofoperon rrnA. Sequencing was by the chain termination method of Sanger et al. (1977) using the deazaTaqTrack TM kit of Promega (Madison, WI) and [35S]dATP on overlapping clones of both strands. The rRNA cluster was subcloned from phage OIRNAI after digestion with Sail into pBR328 (Soberon et ai., 1980) yielding pFQ180, from which further subclonings were then made. The sequencing strategy used was based on single-stranded DNA clones in Bluescript (Stratagene, San Diego, CA) or in M13mpl8 and 19 derivatives (Yanisch-Pel"ron et al., 1985) propagated in DH5otF'IQ cells (BRL), using either universal primers on clones obtained with restriction enzymes or tailor-made primers (Table l) so as to completely determine the sequence of both strands. The sequence coordinates start at the first of the two Bg/ll sites, upstream from the 16S gene. Some relevant restriction sites are shown above the sequence line. Putative promoter sites are highfighted by double underlining. The putative RNA processing site is underlined. The beginning and end of all three r r , genes are underlined. Relevant oligo sites are overlined. The messenger attachment site at the 3' end of the 16S gene (Shine and Dalgarno, 1974) is shown by a wavy line (nt 2030-2034). The putative terminator downstream from the $S gene is highlighted by a wavy line (nt 5737-5789). TCAGCTACCT CATCGAGCGC CTCCGTGCG~ GCGGI~CCGG C~ItCGTCCGG GTCTACGGt~ GCGC.~GGCGGGGTGATCCTG CCGGCGGAC~ TCGACCI~CT BclI Bcll StuI GC&CGCGCGC GGGGTCGCGC GCATCI'PC'IE CCCGCA~G~ GGGCAC.,CGGC TCGGTCTCGC A ~ A T C ~ T C AATA.~ATCA TCGN3G~CTG 1V.,ACGTCGAT Smal XhoI CTGACGGAGG ACGGGCCGAA U~TCGATGCG ~ G C T G ~CACGG CGCGCTCGC~ CGGGCGATCA CCGTGCTCGA G GCC~CGRAGT GATCCAICIC S¢a1 A ~ G C C C T G T CGTCCTATCA GGGCGGGCAT ~ A C T Eagt GCT~CGA~TA ACATCATG~ TCGCCT~TT~ CAGGOT~AGG C.~CM,CCC,GC A C ~ GTCTCATI"CC C.~CCCCC,~A GCT~%GCTCI TCAGCGCCC~ TGGTACTGCA Xcal CTAG~GAGAC AGCCCCACA~ TCGTATACGC GTATTTrCCG "-10" TACATGGAT~ TC~?ACTAT~ ~ G ~ C ~ q A G Tb'I'~CTAGGT ATC'I~GC:'CG ~f~TCC CCGACTAGAT GATCGGGTT~ ATAGGCCGGA GGTGGAAGTG EagI AAGGTGCT&C GCGTCCACTG TGCGGTIt'TC GC,G'~TACGG CCC,GTrCGGC GGTAAGGCCC GGGCATGACC GCAOCGTCGA GGAGGTCGTC ACCGCt~CGA TCCAGGAGGA CGCCCAGGGG 6001 CCGGATCGTG ACG~CGGCET C~CTCTTCC~ TG6GCATGAC GGTCTCCCAC AGGGTAGCCT e n d o f 23S gene AGGCCC~.GGG CTI'GTCT~G gene TGGCGA~SG ~ G t ' % ' C G qene XcaI ~ AD3AGTGTGG "- 35" ACTA~3GCT GGAGCACCCG CT1T~GCACC TTGGC~U~GG ~ A T ~ T A T SmaI/SD f-met CCACATCGTC C ~ C C ~ T CCTC~T,ACGC G~TGTCCIEC CC~GCGCAGG TGGCTGGTrG GCTAPT[TCG GTCGTGAUAC N3TI'CGGTCC CT&TCCGUCG AGGACCGGGA CGGACC~ACC TCTGGTC/TC~ CAGTrGTTCT GCCAAGGGCA CATCT~GCU GGAAGCCIGC ~TCG~EATGA • 5501 CGGTGACGCA TC,~J~CTGAC ~ b e g l n n t n g o f 55 TGGTATATCT G C _ ~ T A ~ I~:C-,G'I~GTrl' end o f 5S T ~ r ~ ; ~ C ~ TGTGGC~GAG ~ CTAGTACGAG I'GTTCGCCCA TTAAAGCGGT ~CGCGAGCTG GGTI~A~AAC AGTUCAASTU CACA~TC.~AG CT'IV-,)ETGTG Iq3nI/srraI 5001 AGACAGACAT GTCGAGCAGG TGCC~qAAGCA GGGACTAGTG ATCCGGCGGT G U ~ AGCGCCG~EG CTC~qUGG&T ~ G T R E C CCGGGGATAA IJJ2536 * CAGGCTGATC TTGCCCAAGA GTCCATATCG ACGGCRAGGT TTGG~ACCTC ~ATGTCGGCT C TCGCATCC TGGGGC'IGGA GTaOTrC~CA .%~..C.n'I'TC~.r-.r- GTTGTTC~AA TACCACTCIG GTCGTACTGG GGCGGTTGCC TCCTAAN~G TAACGGAC,nC GOCCA~GGT TCCCT~QCC TGG'I'IV,CCM, T C A ~ TGGTGGAGTC TAAGTI'CCGA CCTGCACGAA TC.,GCGTAAt'G ACIT~CCAC Tb'IT'Iv_A~C N~GACTCGG C ~ T I ~ : A TTACC,AGTA~ AGAIT,CTCGT TACGOSCGGC SmaI &GGACGGAAA C4qCCCt'GGC~ CCITTACTAT AGCTIT~TAT TC,GI~TI'~]G ~ GTAG~ATKC,G ~ ~ A G G ACC,CCRGI'I'C 4 5 0 | GGGGACGGGT TAGCTL'T~G GGGCGAA~ ~ A A 123 ing slightly beyond the second XcaI site 52 nt downstream. The first 411-nt IGS between the 16S and the 23S genes is markedly longer than spacers in S. ambofaciens (303 nt) and in B. subtilis (169 nt) where no tRNA-encoding genes have been detected. It is of a length comparable to that in E. coli (440 nt) which must accommodate a 75-nt tRNA °lu. In Frankia, a search using the Staden (1980) program revealed no tRNA. An 83-nt tRNA-like structure was detected in the last part of the IGS at nt 2337-2419 but the lack of a GTT(or ~)C in the side arm and the presence of mismatches in all arms make it a poor candidate for tRNA. The search for tRNAs reve',ded no other such structure in the zone upstream from the 16S gene. The second IGS is 68 nt long, comparable to the 82 nt in S. ambofaciens, 55 nt in B. subtilis and to the 92 nt in E. coll. The similarity found with S. ambofaciens between the 16S and the 23S genes is low: less than 50% similarity. Together with the three regions in the 23S gene, the first IGS is potentially the most interesting region to probe with oligos for discrimination between closely related strains. There were two potential promoters upstream from the 16S gene, one situated at nt 114-147 and the other at nt 245-276 (Fig. 3). The consensus sequence of these two was TTGACA for the --35 motif and TAAYYT for the -10 motif, separated by 18 and 17 nt respectively. The presence of two or more promoters is a common feature in E. coii (Brosius et al., 1981), B. subtilis (Green and Void, 1983) and Streptomyces spp. (Baylis and Bibb, 1988; Pernodet et al., 1989). Furthermore, a comparison with the corresponding sequence of S. ambofaciens yielded a 75% similar 99 nt sequence (with one gap) in common between the two organisms (nt 280-378), containing the motif 5'-GCTCCTTGAGAACTCAACA. The motif, which corresponds to the RNA processing site of the primary transcript postulated by Baylis and Bibb (1988), is situated 175 nt upstream from the S. ambofaciens 16S gene and 185 nt upstream from the Frankia corresponding sequence. Downstream from the 5S gene, a 53-nt sequence (5'-CGTATACGAGTGTGGGGCTGTCTCCCTAGGGAGACAGCCCCACACTCGTATAC_GCGTATTIT) of inverted symmetry (underlined) was found bordered by two Xcal sites (doubly underlined), which are otherwise rare (only one other site in the whole rrn operon). The free energy of the stem would be low (AG = -45.6 kcal/mol) as calculated using the model of Zucker and Stiegler (1981). The repeat is perfect suggesting a strong terminator, followed by a block of four Ts, characteristic of eubacterial Rho-independent terminators (Platt, 1986). Further downstream we found a putative ORF of more than 555 nt with a putative promoter (-35:TGGCAT, [N]t7,-10:TACTAT), a ribosome-binding site and an ATG. The ORF has a > 95 ~o probability of coding for a protein according to Fickett's (1982) statistic. No homologous region was found in other published sequences. (d) Conclusions (1) There are two rRNA operons in Frankia strain ORS020606. (2) Both were cloned and found to be very conserved in the coding regions and to differ outside it. The gene order is the usual one for bacteria: 16S-23S-5S. (3) The nt sequence of one operon was determined. Sequence conservation is high with S. ambofaciens. No tRNA could be detected in the spacer. ACKNOWLEDGEMENTS Thanks are expressed to Claude Lemieux, Jean Boulanger and Christian Otis (D6partement de Biochimie, Universit6 Laval) for help with cloning into Bluescript phagemids and synthesis of oligos, to P.H. Roy (D6partemerit de Biochimie, Universit6 Laval) and Guy Perri6re (Biom6trie, Universit6 Lyon I) for help with the sequence analysis programs, to Luc Simon (CRBF, Universit6 Laval) for helpful discussions about primer design and to Laurence Vergnaud for technical help with sequencing (CRBF, Universit6 Laval). REFERENCES Baylis, H.A. and Bibb, M.J.: Organization of the ribosomal RNA genes in Streptomyces coelicolor A3(2). Mol. Gen. Genet. 211 (1988) 191196. Brosius, J., Dull, TJ., Sleeter, D.D. and Noller, H,F.: Gene organization and primary structure of a ribosomal RNA operon from Escherichia coll. J. Mol. Biol. 148 (1981) 107-127. Denhardt, D.T.: A membrane filter technique for the detection of complementary DNA. Biochem. Biophys. Res. Commun. 23 (1966) 641646. Diem, H.G., Gauthier, D. and Dommergues, Y.: Isolation of Frankia from nodules of Casuarina equisetifolia. Can. J. Microbiol. 28 0983) 526530. Embley, T.M., Smida, J. and Stackebrandt, E.: Reverse transcriptase sequencing of 16S ribosomal RNA from Faenia rectivirgula, Pseudonocardia thermophila and Saccharopolyspora hirsuta, three wall type IV actinomycetes which lack mycolic acids. J. Gen. Microbiol. 134 (1988) 961-966. Fernandez, M.P., Meugnier, R.H., Grimont, P.A.D. and Bardin, R.: Deoxyribonucleic-acid relatedness amongst members of the genus Frankia. Int. J. Syst. Bacteriol. 39 (1989) 424-429. Fickett, J.W.: Recognition of protein coding regions in DNA sequences. Nucleic Acids Res. 10 (1982) 5303-5318. Green, C.J. and Void, B.S.: Sequence analysis of a cluster of twenty-one tRNA genes in Bacilf:~ subtilis. Nucleic Acids Res. 11 (1983) 57635774. Hahn, D., Lechevalier, M.P., Fisher, A. and Stackebrandt, E.: Evidence for a close phylogenetic relationship between members of the genera Frankfa, Geodermatophilus and "Blastococcus' and emendation of the family Frankiaceae. Syst. Appl. Microbiol. 11 (1989) 236-242. 124 Haun, G. and G0bel, U.: Oligonucleotide probes for genus-, species- and subspecies-specific identification of representatives of the genus Proteus. FEMS Microbiol. Lett. 43 (1987) 187-193. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Nazaret, S., Co,meyer, B., Normand, P. and Simonet, P.: Phylogenetic relationships among Frankia genomic species determined by use of amplified 16S rDNA sequences. J. Bacteriol. 173 (1991) 4072-4078. Normand, P. and Lalonde, M.: The genetics of actinorhizal Frankia: a review. Plant Soil 90 (1986) 429-453. Normand, P., Simonct, P. and Bardin, R.: Conservation ofn/f sequences in Frankia. Mol. Gen. Genct. 213 (1988) 238-246. Pomodet, J.-L., Boccard, F., Alegre, M.-T., Gagnat, J. and Gu~rineau, M.: Organization and nucleotide sequence analysis of a ribosomal RNA gene cluster from Streptomyces ambofactens. Gene 79 (1989) 33-46. Platt, T.: Transcription termination and the regulation ofgene expression. Ann. Roy. Biochem. 55 (1986) 339-372. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977) 54635467. Shine, J. and Dalgarno, L.: The 3'-terminai sequence of Escherichia coil 16S ribosomal RNA: complementary to nonsense triplets and ribo- some binding sites. Prec. Natl. Acad. Sci. USA 71 (1974) 13421346. Simonct, P., Normand, P., Moiroud, A. and Bardin, R.: Identification of Frankia strains in nodules by hybridization of polymerase chain reaction products with strain-specific oligonucleotide probes. Arch. MicrobioL 153 (1990) 235-240. Smith, T.F. and Waterman, M.S.: Comparison of bio-sequences. Adv. Appl. Math. 2 (1981) 482-489. Soberon, X., Covarmbias, L. and Bolivar, F.: Construction and characterization ofnew cloning vehicles, IV. Deletion derivatives ofpBR322 and pBR325. Gene 9 (1980) 287-305. Staden, R.: A computer program to search for tRNA genes. Nucleic Acids Res. 8 (1980) 817-825. Wilson, K.H., Blitchington, R., Hindenach, B. and Greene, R.C.: Species-specific oligonucleotide probes for rRNA of Clostridium di~icile and related species. J. Clin. Microbiol. 26 (1988) 2484-2488. Yanisch-Perron, C., Vieira, J. and Messing, J.: Improved M13 phage cloning vectors and host strains: nucleotide sequences of the Ml3mpl8 and pUCI9 vectors. Gene 33 (1985) 103-119. Zeff, R.A. and Geliebter, J.: Oligonucleotidc probes for genomic DNA blots, Focus 9 (1987) 1-2. Zucker, M. and Stiegler, P.: Optimal computer folding of large RNA sequences using thermodynamics and auxiliary information. Nucleic Acids Res. 9 (1981) 133-148.
© Copyright 2026 ExpyDoc